Biomarkers of Browning in Cold Exposed Siberian Adults
Abstract
1. Introduction
2. Materials and methods
2.1. Study Design
2.2. Study Participants
2.3. Anthropometric Evaluation
2.4. Blood Sampling and Biochemical Evaluations
2.5. PBCM Collection and qPCR
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Pasquali, R.; Casanueva, F.; Haluzik, M.; van Hulsteijn, L.; Ledoux, S.; Monteiro, M.P.; Salvador, J.; Santini, F.; Toplak, H.; Dekkers, O.M. European Society of Endocrinology Clinical Practice Guideline: Endocrine work-up in obesity. Eur. J. Endocrinol. 2020, 182, G1–G32. [Google Scholar] [CrossRef] [PubMed]
- Hales, C.M.; Carroll, M.D.; Fryar, C.D.; Ogden, C.L. Prevalence of Obesity among Adults and Youth: United States, 2015–2016, 2017. National Center for Health Statistics Website. Available online: https://www.cdc.gov/nchs/products/databriefs/db288.htm (accessed on 7 July 2020).
- WHO. Obesity Report; World Health Organization Website. Available online: https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight (accessed on 25 January 2020).
- Cinti, S.; Graciotti, L.; Giordano, A.; Valerio, A.; Nisoli, E. COVID-19 and fat embolism: A hypothesis to explain the severe clinical outcome in people with obesity. Int. J. Obes. 2020. [Google Scholar] [CrossRef] [PubMed]
- Giordano, A.; Frontini, A.; Cinti, S. Convertible visceral fat as a therapeutic target to curb obesity. Nat. Rev. Drug Discov. 2016, 15, 405–424. [Google Scholar] [CrossRef]
- Cinti, S. Anatomy and physiology of the nutritional system. Mol. Asp. Med. 2019, 68, 101–107. [Google Scholar] [CrossRef] [PubMed]
- Giordano, A.; Nisoli, E. Neuroendocrinology of Energy Balance. In Obesity. Pathogenesis, Diagnosis and Treatment; Endocrinology, 5; Sbraccia, P., Finer, N., Eds.; Springer International Publishing: Cham, Switzerland, 2018. [Google Scholar]
- Cannon, B.; Nedergaard, J. Brown adipose tissue: Function and physiological significance. Physiol. Rev. 2004, 84, 277–359. [Google Scholar] [CrossRef] [PubMed]
- Barbatelli, G.; Murano, I.; Madsen, L.; Hao, Q.; Jumenez, M.; Kristiansen, K.; Giacobino, J.P.; De Matteis, R.; Cinti, S. The emergence of cold-induced brown adipocytes in mouse white fat depots is determined predominantly by white to brown adipocyte transdifferentiation. Am. J. Physiol. Endocrinol. Metab. 2010, 298, E1244–E1253. [Google Scholar] [CrossRef]
- Rosenwald, M.; Perdikari, A.; Rulicke, T.; Wolfrum, C. Bi-directional interconversion of brite and white adipocytes. Nat. Cell Biol. 2013, 15, 659–667. [Google Scholar] [CrossRef]
- Wang, Q.A.; Tao, C.; Gupta, R.K.; Scherer, P.E. Tracking adipogenesis during white adipose tissue development, expansion and regeneration. Nat. Med. 2013, 19, 1338–1344. [Google Scholar] [CrossRef]
- Bachman, E.S.; Dhillon, H.; Zhang, C.Y.; Cinti, S.; Bianco, A.C.; Kobilka, B.K.; Lowell, B.B. betaAR signaling required for diet-induced thermogenesis and obesity resistance. Science 2002, 297, 843–845. [Google Scholar] [CrossRef]
- Berbee, J.F.; Boon, M.R.; Khedoe, P.P.; Bartelt, A.; Schlein, C.; Worthmann, A.; Kooijman, S.; Hoeke, G.; Mol, I.M.; John, C.; et al. Brown fat activation reduces hypercholesterolaemia and protects from atherosclerosis development. Nat. Commun. 2015, 6, 6356. [Google Scholar] [CrossRef]
- Inagaki, T.; Sakai, J.; Kajimura, S. Transcriptional and epigenetic control of brown and beige adipose cell fate and function. Nat. Rev. Mol. Cell Biol. 2017, 18, 527. [Google Scholar] [CrossRef] [PubMed]
- Zingaretti, M.C.; Crosta, F.; Vitali, A.; Guerrieri, M.; Frontini, A.; Cannon, B.; Nedergaard, J.; Cinti, S. The presence of UCP1 demonstrates that metabolically active adipose tissue in the neck of adult humans truly represents brown adipose tissue. FASEB J. 2009, 23, 3113–3120. [Google Scholar] [CrossRef] [PubMed]
- Cypess, A.M.; Lehman, S.; Williams, G.; Tal, I.; Rodman, D.; Goldfine, A.B.; Kuo, F.C.; Palmer, E.L.; Tseng, Y.H.; Doria, A.; et al. Identification and importance of brown adipose tissue in adult humans. N. Engl. J. Med. 2009, 360, 1509–1517. [Google Scholar] [CrossRef] [PubMed]
- Jung, S.M.; Sanchez-Gurmaches, J.; Guertin, D.A. Brown Adipose Tissue Development and Metabolism. In Brown Adipose Tissue, 1st ed.; Handbook of Experimental Pharmacology, 251; Pfeifer, A., Klingenspor, M., Herzig, S., Eds.; Springer International Publishing: Cham, Switzerland, 2018; pp. 4–23. [Google Scholar]
- Van Marken Lichtenbelt, W.D.; Vanhommerig, J.W.; Smulders, N.M.; Drossaerts, J.M.; Kemerink, G.J.; Bouvy, N.D.; Schrauwen, P.; Teule, G.J. Cold-activated brown adipose tissue in healthy men. N. Engl. J. Med. 2009, 360, 1500–1508. [Google Scholar] [CrossRef] [PubMed]
- Reynes, B.; Garcia-Ruiz, E.; Oliver, P.; Palou, A. Gene expression of peripheral blood mononuclear cells is affected by cold exposure. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2015, 309, R824–R834. [Google Scholar] [CrossRef] [PubMed]
- Efremova, A.; Senzacqua, M.; Venema, W.; Isakov, E.; Di Vincenzo, A.; Zingaretti, M.C.; Protasoni, M.; Thomski, M.; Giordano, A.; Cinti, S. A large proportion of mediastinal and perirenal visceral fat of Siberian adult people is formed by UCP1 immunoreactive multilocular and paucilocular adipocytes. J. Physiol. Biochem. 2019. [Google Scholar] [CrossRef]
- Organization, W.M. Russian Federation, Jakutsk. Available online: http://worldweather.wmo.int/en/city.html?cityId=917 (accessed on 5 June 2020).
- Ikewuchi, C.J.; Ikewuchi, C.C. Alteration of Plasma Lipid Profiles and Atherogenic Indices by Stachytarpheta jamaicensis L. (Vahl). Biochemistry 2009, 21. [Google Scholar] [CrossRef]
- Wang, W.; Ishibashi, J.; Trefely, S.; Shao, M.; Cowan, A.J.; Sakers, A.; Lim, H.W.; O’Connor, S.; Doan, M.T.; Cohen, P.; et al. A PRDM16-Driven Metabolic Signal from Adipocytes Regulates Precursor Cell Fate. Cell Metab. 2019, 30, 174–189. [Google Scholar] [CrossRef] [PubMed]
- Nedergaard, J.; Cannon, B. The changed metabolic world with human brown adipose tissue: Therapeutic visions. Cell Metab. 2010, 11, 268–272. [Google Scholar] [CrossRef] [PubMed]
- Madsen, L.; Myrmel, L.S.; Fjaere, E.; Oyen, J.; Kristiansen, K. Dietary Proteins, Brown Fat, and Adiposity. Front. Physiol. 2018, 9, 1792. [Google Scholar] [CrossRef]
- Yoneshiro, T.; Aita, S.; Matsushita, M.; Kayahara, T.; Kameya, T.; Kawai, Y.; Iwanaga, T.; Saito, M. Recruited brown adipose tissue as an antiobesity agent in humans. J. Clin. Investig. 2013, 123, 3404–3408. [Google Scholar] [CrossRef] [PubMed]
- Goody, D.; Pfeifer, A. MicroRNAs in brown and beige fat. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2019, 1864, 29–36. [Google Scholar] [CrossRef] [PubMed]
- Villarroya, F.; Cereijo, R.; Villarroya, J.; Giralt, M. Brown adipose tissue as a secretory organ. Nat. Rev. Endocrinol. 2017, 13, 26–35. [Google Scholar] [CrossRef] [PubMed]
- Walden, T.B.; Hansen, I.R.; Timmons, J.A.; Cannon, B.; Nedergaard, J. Recruited vs. nonrecruited molecular signatures of brown, “brite,” and white adipose tissues. Am. J. Physiol. Endocrinol. Metab. 2012, 302, E19–E31. [Google Scholar] [CrossRef] [PubMed]
- Shinoda, K.; Luijten, I.H.; Hasegawa, Y.; Hong, H.; Sonne, S.B.; Kim, M.; Xue, R.; Chondronikola, M.; Cypess, A.M.; Tseng, Y.H.; et al. Genetic and functional characterization of clonally derived adult human brown adipocytes. Nat. Med. 2015, 21, 389–394. [Google Scholar] [CrossRef]
- Barneda, D.; Planas-Iglesias, J.; Gaspar, M.L.; Mohammadyani, D.; Prasannan, S.; Dormann, D.; Han, G.S.; Jesch, S.A.; Carman, G.M.; Kagan, V.; et al. The brown adipocyte protein CIDEA promotes lipid droplet fusion via a phosphatidic acid-binding amphipathic helix. Elife 2015, 4, e07485. [Google Scholar] [CrossRef] [PubMed]
- Puri, V.; Ranjit, S.; Konda, S.; Nicoloro, S.M.; Straubhaar, J.; Chawla, A.; Chouinard, M.; Lin, C.; Burkart, A.; Corvera, S.; et al. Cidea is associated with lipid droplets and insulin sensitivity in humans. Proc. Natl. Acad. Sci. USA 2008, 105, 7833–7838. [Google Scholar] [CrossRef] [PubMed]
- Slayton, M.; Gupta, A.; Balakrishnan, B.; Puri, V. CIDE Proteins in Human Health and Disease. Cells 2019, 8, 238. [Google Scholar] [CrossRef]
- Shimizu, T.; Yokotani, K. Acute cold exposure-induced down-regulation of CIDEA, cell death-inducing DNA fragmentation factor-alpha-like effector A, in rat interscapular brown adipose tissue by sympathetically activated beta3-adrenoreceptors. Biochem. Biophys. Res. Commun. 2009, 387, 294–299. [Google Scholar] [CrossRef]
- Armamento-Villareal, R.; Wingkun, N.; Aguirre, L.E.; Kulkarny, V.; Napoli, N.; Colleluori, G.; Qualls, C.; Villareal, D.T. The FTO gene is associated with a paradoxically favorable cardiometabolic risk profile in frail, obese older adults. Pharm. Genom. 2016, 26, 154–160. [Google Scholar] [CrossRef]
- Bartelt, A.; Bruns, O.T.; Reimer, R.; Hohenberg, H.; Ittrich, H.; Peldschus, K.; Kaul, M.G.; Tromsdorf, U.I.; Weller, H.; Waurisch, C.; et al. Brown adipose tissue activity controls triglyceride clearance. Nat. Med. 2011, 17, 200–205. [Google Scholar] [CrossRef]
- Chondronikola, M.; Volpi, E.; Borsheim, E.; Porter, C.; Annamalai, P.; Enerback, S.; Lidell, M.E.; Saraf, M.K.; Labbe, S.M.; Hurren, N.M.; et al. Brown adipose tissue improves whole-body glucose homeostasis and insulin sensitivity in humans. Diabetes 2014, 63, 4089–4099. [Google Scholar] [CrossRef] [PubMed]
- Ouellet, V.; Labbe, S.M.; Blondin, D.P.; Phoenix, S.; Guerin, B.; Haman, F.; Turcotte, E.E.; Richard, D.; Carpentier, A.C. Brown adipose tissue oxidative metabolism contributes to energy expenditure during acute cold exposure in humans. J. Clin. Investig. 2012, 122, 545–552. [Google Scholar] [CrossRef] [PubMed]
- Madaniyazi, L.; Guo, Y.; Williams, G.; Jaakkola, J.J.K.; Wu, S.; Li, S. The nonlinear association between outdoor temperature and cholesterol levels, with modifying effect of individual characteristics and behaviors. Int. J. Biometeorol. 2020, 64, 367–375. [Google Scholar] [CrossRef] [PubMed]
Gene | Function | Primers |
---|---|---|
CIDEA | Encoding for a protein recognized as a marker of brown adipose tissue | Forward:ATCGGCTCCTTAACGTGAA Reverse:AACCGCAGCAGACTCCTCA |
PRDM16 | Encoding for a protein regulating brown adipose tissue differentiation | Forward:CCCAACAAGTACAGCCTGGA Reverse:GCGGATGAGGTTGGACTTCC |
SLC27A1 | Encoding for a protein recognized as a marker of beige/brite adipocytes (white in brown) conversion | Forward:GCGATATACCAGGAGCTGCA Reverse:TCTTGAAGGTGCCTGTGGTG |
HOXC9 | Encoding for a protein marker of beige/brite adipocytes (white in brown) conversion | Forward:CAGCAACCCCGTGGCC Reverse:CCGAGGTCCCTGGTTAAA |
CPT1A4 | Encoding for a protein (liver isoform) involved in the mitochondrial oxidation of long-chain fatty acids | Forward:TCCACGA TTCCACTCTGCTC Reverse:CAGCAACCCCGTGGCC |
Control n = 29 | Cold-Exposed n = 150 | p | |
---|---|---|---|
Age [years, median (IQR)] | 34 (29; 38) | 32 (28; 38.5) | 0.522 |
Height [cm, median (IQR)] | 174 (171; 176) | 172 (168; 176) | 0.011 |
Weight [kg, median (IQR)] | 75 (73; 81) | 70 (64; 78) | <0.001 |
BMI [kg/m2, median (IQR)] | 25.61 (23.84; 27.04) | 24.06 (22.15; 26.51) | 0.023 |
WC [cm, median (IQR)] | 92 (84; 96) | 85 (78; 95) | 0.082 |
HC [cm, median (IQR)] | 100 (99; 102) | 95 (92; 101) | 0.001 |
WC/HC [median (IQR)] | 0.91 (0.85; 0.93) | 0.89 (0.85; 0.95) | 0.872 |
Control n = 29 | Cold-Exposed n = 150 | ||||
---|---|---|---|---|---|
Adj. Median (CI 95%) | Adj. Median (CI 95%) | RSE | Coefficient | p * | |
PBMC Markers | |||||
CIDEA | 0.49 (0.43; 0.58) | 0.30 (0.22; 0.43) | 0.467 | 0.019 | 0.042 |
PRDM16 | 2.97 (1.99; 3.64) | 1.74 (0.66; 3.42) | 3.727 | 0.362 | 0.622 |
SLC27A1 | 1.30 (0.92; 1.88) | 1.12 (0.73; 1.78) | 2.772 | 0.125 | 0.761 |
HOXC9 | 0.96 (0.61; 1.18) | 1.75 (0.90; 2.42) | 2.891 | 0.271 | 0.038 |
CPT1A4 | 2.40 (1.73; 2.83) | 2.30 (0.55; 2.99) | 4.167 | 0.155 | 0.931 |
Biochemical Variables | |||||
Glucose (mmol/L) | 4.42 (4.35; 4.69) | 5.29 (5.22; 5.36) | 0.851 | 0.121 | 0.025 |
Triglycerides (mmol/L) | 1.27 (1.00; 1.61) | 1.22 (1.08; 1.47) | 0.563 | 0.016 | 0.763 |
Total cholesterol (mmol/L) | 5.12 (4.71; 5.54) | 4.99 (4.81; 5.17) | 0.728 | 0.019 | 0.888 |
LDL (mmol/L) | 3.30 (2.95; 3.63) | 3.08 (2.79; 3.20) | 0.842 | 0.191 | 0.856 |
HDL (mmol/L) | 1.21 (1.02; 1.41) | 1.59 (1.13; 1.99) | 0.534 | 0.011 | 0.557 |
VLDL (mmol/L) | 0.71 (0.58; 0.84) | 0.55 (0.49; 0.62) | 0.474 | 0.021 | 0.899 |
Ka | 3.42 (2.56; 4.51) | 3.33 (2.61; 4.07) | 0.062 | 0.062 | 0.878 |
1–2 h | 4–4.5 h | 8–10 h | 11 h | p | |||||
---|---|---|---|---|---|---|---|---|---|
n = 31 | n = 21 | n = 14 | n = 82 | ||||||
BMI [Median (CI 95%)] | 31 | 26.26 (23.51; 28.54) | 20 | 25.51 (24.57; 26.39) | 14 | 24.22 (23.70; 25.39) | 82 | 23.12 (21.73; 24.49) | <0.05 |
Markers | |||||||||
CIDEA [Adj. median (CI 95%)] | 1 | - | 8 | 0.36 (0.11; 0.82) | 7 | 0.33 (0.01; 0.848) | 22 | 0.30 (0.02; 0.58) | 0.974 † |
PRDM16 [Adj. median (CI 95%)] | 15 | 0.64 (0.12; 2.55) | 16 | 2.57 (0.74; 4.39) | 8 | 0.85 (0.15; 3.46) | 43 | 1.77 (0.64; 2.89) | 0.684 † |
SLC27A1 [Adj. median (CI 95%)] | 6 | 0.18 (0.01; 2.74) | 7 | 1.68 (0.05; 4.14) | 8 | 3.05 (0.78; 5.26) | 20 | 1.20 (0.03; 2.59) | 0.799 † |
HOXC9 [Adj. median (CI 95%)] | 24 | 2.02 (0.61; 3.42) | 14 | 1.78 (0.11; 3.50) | 11 | 3.33 (1.24; 5.41) | 52 | 1.68 (0.72; 2.64) | 0.524 † |
CPT1A4 [Adj. median (CI 95%)] | 9 | 0.27 (0.08; 3.44) | 9 | 2.58 (0.15; 5.80) | 8 | 4.25 (0.86; 7.64) | 22 | 2.29 (0.26; 4.32) | 0.668 † |
Biochemical variables | |||||||||
Glucose (mmol/L) [Adj. median (CI 95%)] | 31 | 5.10 (4.74; 5.47) | 20 | 5.28 (4.86; 5.70) | 14 | 5.46 (4.91; 6.02) | 82 | 5.20 (4.98; 5.42) | 0.831 |
Triglycerides (mmol/ L) [Adj. median (CI 95%)] | 31 | 0.96 (0.75; 1.18) | 20 | 0.98 (0.74; 1.23) | 14 | 1.29 (0.96; 1.61) | 82 | 1.22 (1.09; 1.35) | 0.217 |
Tot cholesterol (mmol\L) [Adj. median (CI 95%)] | 31 | 4.99 (4.71; 5.27) | 20 | 4.63 (4.31; 4.96) | 14 | 4.39 (3.96; 4.72) | 82 | 4.43 (4.16; 4.68) | <0.05 |
LDL (mmol/L) [Adj. median (CI 95%)] | 31 | 2.93 (2.58; 3.27) | 20 | 3.22 (2.83; 3.62) | 14 | 2.87 (2.36; 3.89) | 82 | 3.10 (2.90; 3.31) | 0.881 |
HDL (mmol/L) [Adj. median (CI 95%)] | 31 | 1.78 (1.35; 2.16) | 20 | 1.19 (0.95; 1.49) | 14 | 1.26 (0.93; 1.68) | 82 | 1.38 (1.25; 1.51) | 0.679 |
VLDL (mmol/L) [Adj. median (CI 95%)] | 31 | 0.45 (0.35; 0.55) | 20 | 0.48 (0.36; 0.59) | 14 | 0.56 (0.41; 0.72) | 82 | 0.56 (0.50; 0.62) | 0.558 |
Ka [Adj. median (CI 95%)] | 31 | 3.34 (2.97; 3.72) | 21 | 3.04 (2.62; 3.46) | 14 | 2.61 (2.04; 3.18) | 82 | 2.64 (2.41; 2.86) | <0.05 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Efremova, A.; Colleluori, G.; Thomsky, M.; Perugini, J.; Protasoni, M.; Reguzzoni, M.; Faragalli, A.; Carle, F.; Giordano, A.; Cinti, S. Biomarkers of Browning in Cold Exposed Siberian Adults. Nutrients 2020, 12, 2162. https://doi.org/10.3390/nu12082162
Efremova A, Colleluori G, Thomsky M, Perugini J, Protasoni M, Reguzzoni M, Faragalli A, Carle F, Giordano A, Cinti S. Biomarkers of Browning in Cold Exposed Siberian Adults. Nutrients. 2020; 12(8):2162. https://doi.org/10.3390/nu12082162
Chicago/Turabian StyleEfremova, Agrafena, Georgia Colleluori, Mikhail Thomsky, Jessica Perugini, Marina Protasoni, Marcella Reguzzoni, Andrea Faragalli, Flavia Carle, Antonio Giordano, and Saverio Cinti. 2020. "Biomarkers of Browning in Cold Exposed Siberian Adults" Nutrients 12, no. 8: 2162. https://doi.org/10.3390/nu12082162
APA StyleEfremova, A., Colleluori, G., Thomsky, M., Perugini, J., Protasoni, M., Reguzzoni, M., Faragalli, A., Carle, F., Giordano, A., & Cinti, S. (2020). Biomarkers of Browning in Cold Exposed Siberian Adults. Nutrients, 12(8), 2162. https://doi.org/10.3390/nu12082162