Anti-Adipogenic Effect of Neferine in 3T3-L1 Cells and Primary White Adipocytes
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture and Differentiation of Preadipocytes
2.3. Cell Viability Assay
2.4. Lipids Quantification
2.5. Quantification of Gene Expression
2.6. Protein Quantification and Immunoblot Analysis
2.7. Statistical Analysis
3. Results
3.1. Effect of Neferine on the Viability of 3T3-L1 Cells
3.2. Effect of Neferine on Intracellular Lipid Accumulation in 3T3-L1 Adipocytes
3.3. Effect of Neferine on the Adipogenesis of 3T3-L1 Cells
3.4. Effect of Neferine on Fatty Acid Oxidation in 3T3-L1 Adipocytes
3.5. Effect of Neferine on the AMPK Pathway of 3T3-L1 Adipocytes
3.6. Effect of Neferine on the Adipogenesis of Primary White Adipocytes
3.7. Effect of Neferine on the AMPK Pathway of Primary White Adipocytes
3.8. Effect of Neferine on the AMPK Pathway of 3T3-L1 Adipocytes
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Dhurandhar, E.J.; Keith, S.W. The aetiology of obesity beyond eating more and exercising less. Best Pr. Res. Clin. Gastroenterol. 2014, 28, 533–544. [Google Scholar] [CrossRef] [PubMed]
- Donohoe, C.L.; O’Farrell, N.J.; Doyle, S.L.; Reynolds, J.V. The role of obesity in gastrointestinal cancer: Evidence and opinion. Ther. Adv. Gastroenterol. 2013, 7, 38–50. [Google Scholar] [CrossRef] [PubMed]
- Tremmel, M.; Gerdtham, U.-G.; Nilsson, P.M.; Saha, S. Economic Burden of Obesity: A Systematic Literature Review. Int. J. Environ. Res. Public Health 2017, 14, 435. [Google Scholar] [CrossRef] [PubMed]
- Gurmaches, J.S.; Guertin, D.A. Adipocyte lineages: Tracing back the origins of fat. Biochim. Biophys. Acta Bioenerg. 2013, 1842, 340–351. [Google Scholar] [CrossRef]
- Haslam, D.W.; James, W.P.T. Obesity. Lancet 2005, 367, 1197–1209. [Google Scholar] [CrossRef]
- Wajchenberg, B.L. Subcutaneous and Visceral Adipose Tissue: Their Relation to the Metabolic Syndrome. Endocr. Rev. 2000, 21, 697–738. [Google Scholar] [CrossRef]
- Finelli, C.; Padula, M.C.; Martelli, G.; Tarantino, G. Could the improvement of obesity-related co-morbidities depend on modified gut hormones secretion? World J. Gastroenterol. 2014, 20, 16649–16664. [Google Scholar] [CrossRef]
- Karamadoukis, L.; Shivashankar, G.H.; Ludeman, L.; Williams, A. An unusual complication of treatment with orlistat. Clin. Nephrol. 2009, 71, 430–432. [Google Scholar] [CrossRef]
- Slovacek, L.; Pavlík, V.; Slovackova, B. The effect of sibutramine therapy on occurrence of depression symptoms among obese patients. Nutr. Metab. Cardiovasc. Dis. 2008, 18, 18–43. [Google Scholar] [CrossRef]
- Gamboa-Gómez, C.I.; Rocha-Guzmán, N.E.; Gallegos-Infante, J.A.; Moreno-Jiménez, M.R.; Vázquez-Cabral, B.D.; González-Laredo, R.F. Plants with potential use on obesity and its complications. EXCLI J. 2015, 14, 809–831. [Google Scholar]
- Asokan, S.M.; Mariappan, R.; Muthusamy, S.; Velmurugan, B.K.; Shibu, M.A.; Ravichandran, M.; Shanmugavadivu, M. Pharmacological benefits of neferine—A comprehensive review. Life Sci. 2018, 199, 60–70. [Google Scholar] [CrossRef] [PubMed]
- Sharma, B.R.; Gautam, L.N.S.; Adhikari, D.; Karki, R. A Comprehensive Review on Chemical Profiling ofNelumbo Nucifera: Potential for Drug Development. Phytother. Res. 2016, 31, 3–26. [Google Scholar] [CrossRef] [PubMed]
- Kadioglu, O.; Law, B.Y.K.; Mok, S.W.F.; Xu, S.-W.; Efferth, T.; Wong, V.K.W. Mode of Action Analyses of Neferine, a Bisbenzylisoquinoline Alkaloid of Lotus (Nelumbo nucifera) against Multidrug-Resistant Tumor Cells. Front. Pharmacol. 2017, 8, 308. [Google Scholar] [CrossRef] [PubMed]
- Sivalingam, K.S.; Paramasivan, P.; Weng, C.F.; Viswanadha, V.P. Neferine Potentiates the Antitumor Effect of Cisplatin in Human Lung Adenocarcinoma Cells Via a Mitochondria-Mediated Apoptosis Pathway. J. Cell. Biochem. 2017, 118, 2865–2876. [Google Scholar] [CrossRef] [PubMed]
- Jung, H.A.; Jin, S.E.; Choi, R.J.; Kim, N.H.; Kim, Y.S.; Ryu, J.H.; Kim, N.-W.; Son, Y.K.; Park, J.J.; Choi, J.S. Anti-amnesic activity of neferine with antioxidant and anti-inflammatory capacities, as well as inhibition of ChEs and BACE1. Life Sci. 2010, 87, 420–430. [Google Scholar] [CrossRef]
- Paudel, K.R.; Panth, N. Phytochemical Profile and Biological Activity of Nelumbo nucifera. Evid. Based Complement. Altern. Med. 2015, 2015, 1–16. [Google Scholar] [CrossRef]
- Miura, D.S.; Wynn, J.; Torres, V.; Laux, B.; Keefe, D.; Somberg, J.C. Antiarrhythmic efficacy of ethmozine in patients with ventricular tachycardia as determined by programmed electrical stimulation. Am. Heart J. 1986, 111, 661–666. [Google Scholar] [CrossRef]
- Zhou, Y.-J.; Xiang, J.-Z.; Yuan, H.; Liu, H.; Tang, Q.; Hao, H.-Z.; Yin, Z.; Wang, J.; Ming, Z. Neferine exerts its antithrombotic effect by inhibiting platelet aggregation and promoting dissociation of platelet aggregates. Thromb. Res. 2013, 132, 202–210. [Google Scholar] [CrossRef]
- Jung, H.A.; Karki, S.; Kim, J.H.; Choi, J.S. BACE1 and cholinesterase inhibitory activities of Nelumbo nucifera embryos. Arch. Pharm. Res. 2014, 38, 1178–1187. [Google Scholar] [CrossRef]
- Sugimoto, Y.; Nishimura, K.; Itoh, A.; Tanahashi, T.; Nakajima, H.; Oshiro, H.; Sun, S.; Toda, T.; Yamada, J. Serotonergic mechanisms are involved in antidepressant-like effects of bisbenzylisoquinolines liensinine and its analogs isolated from the embryo of Nelumbo nucifera Gaertner seeds in mice. J. Pharm. Pharmacol. 2015, 67, 1716–1722. [Google Scholar] [CrossRef]
- Drolet, R.; Richard, C.; Sniderman, A.D.; Mailloux, J.; Fortier, M.; Huot, C.; Rhéaume, C.; Tchernof, A.; Rh, C. Hypertrophy and hyperplasia of abdominal adipose tissues in women. Int. J. Obes. 2007, 32, 283–291. [Google Scholar] [CrossRef] [PubMed]
- Gregoire, F.M.; Smas, C.M.; Sul, H.S. Understanding adipocyte differentiation. Physiol. Rev. 1998, 78, 783–809. [Google Scholar] [CrossRef] [PubMed]
- Farmer, S.R. Transcriptional control of adipocyte formation. Cell Metab. 2006, 4, 263–273. [Google Scholar] [CrossRef] [PubMed]
- Eberlé, D.; Hegarty, B.; Bossard, P.; Ferre, P.; Foufelle, F. SREBP transcription factors: Master regulators of lipid homeostasis. Biochimie 2004, 86, 839–848. [Google Scholar] [CrossRef]
- Herzig, S.; Shaw, R.J. AMPK: Guardian of metabolism and mitochondrial homeostasis. Nat. Rev. Mol. Cell Biol. 2017, 19, 121–135. [Google Scholar] [CrossRef]
- Schreurs, M.; Kuipers, F.; Van Der Leij, F. Regulatory enzymes of mitochondrial β-oxidation as targets for treatment of the metabolic syndrome. Obes. Rev. 2010, 11, 380–388. [Google Scholar] [CrossRef]
- Saggerson, E.D. Malonyl-CoA, a Key Signaling Molecule in Mammalian Cells. Annu. Rev. Nutr. 2008, 28, 253–272. [Google Scholar] [CrossRef]
- Wolfgang, M.J.; Kurama, T.; Dai, Y.; Suwa, A.; Asaumi, M.; Matsumoto, S.-I.; Cha, S.H.; Shimokawa, T.; Lane, M.D. The brain-specific carnitine palmitoyltransferase-1c regulates energy homeostasis. Proc. Natl. Acad. Sci. USA 2006, 103, 7282–7287. [Google Scholar] [CrossRef]
- Kim, E.; Lee, J.-H.; Ntambi, J.M.; Hyun, C.-K. Inhibition of stearoyl-CoA desaturase1 activates AMPK and exhibits beneficial lipid metabolic effects in vitro. Eur. J. Pharmacol. 2011, 672, 38–44. [Google Scholar] [CrossRef]
- Hausman, R.B.; Park, H.J.; Hausman, G.J. Isolation and Culture of Preadipocytes from Rodent White Adipose Tissue. In Advanced Structural Safety Studies; Springer Science and Business Media: Berlin, Germany, 2008; Volume 456, pp. 201–219. [Google Scholar]
- Lavie, C.J.; De Schutter, A.; Parto, P.; Jahangir, E.; Kokkinos, P.; Ortega, F.B.; Arena, R.; Milani, R.V. Obesity and Prevalence of Cardiovascular Diseases and Prognosis—The Obesity Paradox Updated. Prog. Cardiovasc. Dis. 2016, 58, 537–547. [Google Scholar] [CrossRef]
- Elagizi, A.; Kachur, S.; Lavie, C.J.; Carbone, S.; Pandey, A.; Ortega, F.B.; Milani, R.V. An Overview and Update on Obesity and the Obesity Paradox in Cardiovascular Diseases. Prog. Cardiovasc. Dis. 2018, 61, 142–150. [Google Scholar] [CrossRef]
- Onakpoya, I.; Heneghan, C.J.; Aronson, J.K. Post-marketing withdrawal of anti-obesity medicinal products because of adverse drug reactions: A systematic review. BMC Med. 2016, 14, 191. [Google Scholar] [CrossRef] [PubMed]
- Rayalam, S.; Della-Fera, M.A.; Baile, C.A. Phytochemicals and regulation of the adipocyte life cycle. J. Nutr. Biochem. 2008, 19, 717–726. [Google Scholar] [CrossRef] [PubMed]
- Jang, B.-C. Artesunate inhibits adipogeneis in 3T3-L1 preadipocytes by reducing the expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3. Biochem. Biophys. Res. Commun. 2016, 474, 220–225. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Rosen, E.D.; Brun, R.; Hauser, S.; Adelmant, G.; Troy, E.A.; McKeon, C.; Darlington, G.J.; Spiegelman, B. Cross-Regulation of C/EBPα and PPARγ Controls the Transcriptional Pathway of Adipogenesis and Insulin Sensitivity. Mol. Cell 1999, 3, 151–158. [Google Scholar] [CrossRef]
- Tang, Q.; Lane, M.D. Adipogenesis: From Stem Cell to Adipocyte. Annu. Rev. Biochem. 2012, 81, 715–736. [Google Scholar] [CrossRef]
- Ji, S.; Doumit, M.E.; Hill, R.A. Regulation of Adipogenesis and Key Adipogenic Gene Expression by 1, 25-Dihydroxyvitamin D in 3T3-L1 Cells. PLoS ONE 2015, 10, e0126142. [Google Scholar] [CrossRef]
- Engin, A. Fat Cell and Fatty Acid Turnover in Obesity; Springer Science and Business Media: Berlin, Germany, 2017; Volume 960, pp. 135–160. [Google Scholar]
- Rosen, E.D.; Hsu, C.-H.; Wang, X.; Sakai, S.; Freeman, M.W.; Gonzalez, F.J.; Spiegelman, B.M. C/EBPalpha induces adipogenesis through PPARgamma: A unified pathway. Genes Dev. 2002, 16, 22–26. [Google Scholar] [CrossRef]
- Yahagi, N.; Shimano, H.; Hasty, A.H.; Amemiya-Kudo, M.; Okazaki, H.; Tamura, Y.; Iizuka, Y.; Shionoiri, F.; Ohashi, K.; Osuga, J.-I.; et al. A crucial role of sterol regulatory element-binding protein-1 in the regulation of lipogenic gene expression by polyunsaturated fatty acids. J. Biol. Chem. 1999, 274, 35840–35844. [Google Scholar] [CrossRef]
- Viollet, B.; Andreelli, F. AMP-Activated Protein Kinase and Metabolic Control. Handb. Exp. Pharmacol. 2011, 203, 303–330. [Google Scholar] [CrossRef]
- O’Neill, H.M.; Holloway, G.P.; Steinberg, G.R. AMPK regulation of fatty acid metabolism and mitochondrial biogenesis: Implications for obesity. Mol. Cell. Endocrinol. 2013, 366, 135–151. [Google Scholar] [CrossRef] [PubMed]
- Habinowski, S.A.; Witters, L.A. The Effects of AICAR on Adipocyte Differentiation of 3T3-L1 Cells. Biochem. Biophys. Res. Commun. 2001, 286, 852–856. [Google Scholar] [CrossRef] [PubMed]
- Angin, Y.; Beauloye, C.; Horman, S.; Bertrand, L. Regulation of Carbohydrate Metabolism, Lipid Metabolism, and Protein Metabolism by AMPK. Exp. Suppl. 2016, 107, 23–43. [Google Scholar] [CrossRef] [PubMed]
- Michan, S.; Sinclair, D.A. Sirtuins in mammals: Insights into their biological function. Biochem. J. 2007, 404, 1–13. [Google Scholar] [CrossRef]
- Fullerton, M.D.; Steinberg, G.R. SIRT1 takes a backseat to AMPK in the regulation of insulin sensitivity by resveratrol. Diabetes 2010, 59, 551–553. [Google Scholar] [CrossRef]
- Banks, A.S.; Kon, N.; Knight, C.; Matsumoto, M.; Gutierrez-Juarez, R.; Rossetti, L.; Gu, W.; Accili, M. SirT1 Gain of Function Increases Energy Efficiency and Prevents Diabetes in Mice. Cell Metab. 2008, 8, 333–341. [Google Scholar] [CrossRef]
- Ducharme, N.A.; Bickel, P.E. Minireview: Lipid Droplets in Lipogenesis and Lipolysis. Endocrinology 2008, 149, 942–949. [Google Scholar] [CrossRef]
- McGarry, J.D.; Brown, N.F. The Mitochondrial Carnitine Palmitoyltransferase System—From Concept to Molecular Analysis. Eur. J. Biochem. 1997, 244, 1–14. [Google Scholar] [CrossRef]
- Szkudelski, T.; Szkudelska, K. Effects of AMPK activation on lipolysis in primary rat adipocytes: Studies at different glucose concentrations. Arch. Physiol. Biochem. 2016, 123, 1–7. [Google Scholar] [CrossRef]









| Gene | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| PPARγ | TTTTCAAGGGTGCCAGTTTC | AATCCTTGGCCCTCTGAGAT |
| C/EBPα | TTACAACAGGCCAGGTTTCC | GGCTGGCGACATACAGTACA |
| SREBP-1 | TGTTGGCATCCTGCTATCTG | AGGGAAAGCTTTGGGGTCTA |
| β-actin | CTGTCCCTGTATGCCTCTG | ATGTCACGCACGATTTCC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, M.; Han, J.; Lee, H.-J. Anti-Adipogenic Effect of Neferine in 3T3-L1 Cells and Primary White Adipocytes. Nutrients 2020, 12, 1858. https://doi.org/10.3390/nu12061858
Park M, Han J, Lee H-J. Anti-Adipogenic Effect of Neferine in 3T3-L1 Cells and Primary White Adipocytes. Nutrients. 2020; 12(6):1858. https://doi.org/10.3390/nu12061858
Chicago/Turabian StylePark, Miey, Jinyoung Han, and Hae-Jeung Lee. 2020. "Anti-Adipogenic Effect of Neferine in 3T3-L1 Cells and Primary White Adipocytes" Nutrients 12, no. 6: 1858. https://doi.org/10.3390/nu12061858
APA StylePark, M., Han, J., & Lee, H.-J. (2020). Anti-Adipogenic Effect of Neferine in 3T3-L1 Cells and Primary White Adipocytes. Nutrients, 12(6), 1858. https://doi.org/10.3390/nu12061858

