Centella asiatica L. Phytosome Improves Cognitive Performance by Promoting Bdnf Expression in Rat Prefrontal Cortex
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Animals
2.3. Treatment and Behavioral Test
2.4. Quantification of Centella asiatica L. Triterpenes by LC–MS/MS
2.5. RNA Preparation and Gene Expression Analysis by Quantitative Real-time PCR
2.6. Protein extraction and Western Blot Analysis
2.7. Statistical Analysis
3. Results
3.1. Quantification of Centella asiatica L. Triterpenes in Plasma by LC–MS/MS Analysis.
3.2. Chronic C. asiatica L. Administration Specifically Increased the Expression of the Neurotrophin Bdnf in the Prefrontal Cortex.
3.3. Chronic C. asiatica L. Administration Increased the Expression of Bdnf long 3′UTR and Bdnf Isoform VI in the Prefrontal Cortex.
3.4. C. asiatica L. Administration Dose-Dependently Enhanced mBDNF and its Receptor Protein Levels in the Prefrontal Cortex.
3.5. C. asiatica L. Administration Dose-Dependently Enhanced the Cognitive Performance.
3.6. C. asiatica L. Administration Affects the Expression of the Neurotrophin Following the Cognitive Test
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- World Health Organization (WHO). WHO Traditional Medicine Strategy 2002–2005; WHO: Geneva, Switzerland, 2002. [Google Scholar]
- Brinkhaus, B.; Lindner, M.; Schuppan, D.; Hahn, E.G. Chemical, pharmacological and clinical profile of the East Asian medical plant Centella asiatica. Phytomedicine 2000, 7, 427–488. [Google Scholar] [CrossRef] [Scilit]
- Inamdar, P.K.; Yeole, R.D.; Ghogare, A.B.; De Souza, N.J. Determination of biologically active constituents in Centella asiatica. J. Chromatogr. A 1996, 742, 127–130. [Google Scholar] [CrossRef] [Scilit]
- Coldren, C.D.; Hashim, P.; Ali, J.M.; Oh, S.K.; Sinskey, A.J.; Rha, C.K. Gene expression changes in the human fibroblast induced by Centella asiatica triterpenoids. Planta Med. 2003, 69, 725–732. [Google Scholar] [PubMed]
- Gray, N.E.; Zweig, J.A.; Caruso, M.; Zhu, J.Y.; Wright, K.M.; Quinn, J.F.; Soumyanath, A. Centella asiatica attenuates hippocampal mitochondrial dysfunction and improves memory and executive function in β-amyloid overexpressing mice. Mol. Cell. Neurosci. 2018, 93, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Puttarak, P.; Dilokthornsakul, P.; Saokaew, S.; Dhippayom, T.; Kongkaew, C.; Sruamsiri, R.; Chuthaputti, A.; Chaiyakunapruk, N. Effects of Centella asiatica (L.) Urb. on cognitive function and mood related outcomes: A Systematic Review and Meta-analysis. Sci. Rep. 2017, 7, 161–194. [Google Scholar] [CrossRef] [Scilit]
- Gray, N.E.; Alcazar Magana, A.; Lak, P.; Wright, K.M.; Quinn, J.; Stevens, J.F.; Maier, C.S.; Soumyanath, A. Centella asiatica: Phytochemistry and mechanisms of neuroprotection and cognitive enhancement. Phytochem. Rev. 2018, 17, 161–194. [Google Scholar] [CrossRef] [Scilit]
- Bekinschtein, P.; Cammarota, M.; Medina, J.H. BDNF and memory processing. Neuropharmacology 2014, 76, 677–683. [Google Scholar] [CrossRef] [Scilit]
- Lu, B.; Nagappan, G.; Lu, Y. BDNF and synaptic plasticity, cognitive function, and dysfunction. Handb. Exp. Pharmacol. 2015, 220, 223–250. [Google Scholar]
- Calabrese, F.; Molteni, R.; Racagni, G.; Riva, M.A. Neuronal plasticity: A link between stress and mood disorders. Psychoneuroendocrinology 2009, 24, S208–S216. [Google Scholar] [CrossRef] [Scilit]
- Soulé, J.; Messaoudi, E.; Bramham, C.R. Brain-derived neurotrophic factor and control of synaptic consolidation in the adult brain. Biochem. Soc. Trans. 2006, 34, 600–604. [Google Scholar] [CrossRef] [Scilit]
- Aid, T.; Kazantseva, A.; Piirsoo, M.; Palm, K.; Timmusk, T. Mouse and rat BDNF gene structure and expression revisited. J. Neurosci. Res. 2007, 85, 525–535. [Google Scholar] [CrossRef] [Scilit]
- Sangiovanni, E.; Brivio, P.; Dell’Agli, M.; Calabrese, F. Botanicals as Modulators of Neuroplasticity: Focus on BDNF. Neural Plast. 2017. [Google Scholar] [CrossRef] [Scilit]
- Calabrese, F.; Brivio, P.; Gruca, P.; Lason-Tyburkiewicz, M.; Papp, M.; Riva, M.A. Chronic Mild Stress-Induced Alterations of Local Protein Synthesis: A Role for Cognitive Impairment. ACS Chem. Neurosci. 2017, 8, 817–825. [Google Scholar] [CrossRef] [Scilit]
- Paxinos, G.; Watson, C. The Rat Brain in Stereotaxic Coordinates Sixth Edition. Elsevier Acad. Press 2007. [Google Scholar]
- Brivio, P.; Sbrini, G.; Peeva, P.; Todiras, M.; Bader, M.; Alenina, N.; Calabrese, F.; Marrocco, J.; Soiza-Reilly, M.; Olivier, J.D. TPH2 Deficiency Influences Neuroplastic Mechanisms and Alters the Response to an Acute Stress in a Sex Specific Manner Citation. Front. Mol. Neurosci 2018. [Google Scholar] [CrossRef] [Scilit]
- Brivio, P.; Corsini, G.; Riva, M.A.; Calabrese, F. Chronic vortioxetine treatment improves the responsiveness to an acute stress acting through the ventral hippocampus in a glucocorticoid-dependent way. Pharmacol. Res. 2019, 142, 14–32. [Google Scholar] [CrossRef] [Scilit]
- Poo, M. ming Neurotrophins as synaptic modulators. Nat. Rev. Neurosci. 2001, 2, 24–32. [Google Scholar] [CrossRef] [Scilit]
- Greenberg, M.E.; Xu, B.; Lu, B.; Hempstead, B.L. New insights in the biology of BDNF synthesis and release: Implications in CNS function. Proc. J.Neurosci. 2009, 29, 12764–12767. [Google Scholar] [CrossRef] [Scilit]
- Kuipers, S.D.; Bramham, C.R. Brain-derived neurotrophic factor mechanisms and function in adult synaptic plasticity: New insights and implications for therapy. Curr. Opin. Drug Discov. Dev. 2006, 9, 580–586. [Google Scholar]
- Savitz, J.; Solms, M.; Ramesar, R. The molecular genetics of cognition: Dopamine, COMT and BDNF. Genes, Brain Behav. 2006, 5, 311–328. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Lin, Y. Npas4: Linking Neuronal Activity to Memory. Trends Neurosci. 2016, 39, 264–275. [Google Scholar] [CrossRef] [Scilit]
- Isaev, N.K.; Stelmashook, E.V.; Genrikhs, E.E. Role of nerve growth factor in plasticity of forebrain cholinergic neurons. Biochem. 2017, 82, 291–300. [Google Scholar] [CrossRef] [Scilit]
- Flavell, S.W.; Greenberg, M.E. Signaling Mechanisms Linking Neuronal Activity to Gene Expression and Plasticity of the Nervous System. Annu. Rev. Neurosci. 2008, 31, 563–590. [Google Scholar] [CrossRef] [Scilit]
- Kowiański, P.; Lietzau, G.; Czuba, E.; Waśkow, M.; Steliga, A.; Moryś, J. BDNF: A Key Factor with Multipotent Impact on Brain Signaling and Synaptic Plasticity. Cell. Mol. Neurobiol. 2018, 38, 579–593. [Google Scholar] [CrossRef] [Scilit]
- Bramham, C.R.; Messaoudi, E. BDNF function in adult synaptic plasticity: The synaptic consolidation hypothesis. Prog. Neurobiol. 2005, 76, 99–125. [Google Scholar] [CrossRef] [Scilit]
- Chen, D.; Zhang, X.Y.; Sun, J.; Cong, Q.J.; Chen, W.X.; Ahsan, H.M.; Gao, J.; Qian, J.J. Asiatic acid protects dopaminergic neurons from neuroinflammation by suppressing mitochondrial ROS production. Biomol. Ther. 2019, 27, 442–449. [Google Scholar] [CrossRef] [Scilit]
- Sirichoat, A.; Chaijaroonkhanarak, W.; Prachaney, P.; Pannangrong, W.; Leksomboon, R.; Chaichun, A.; Wigmore, P.; Welbat, J.U. Effects of Asiatic acid on spatial working memory and cell proliferation in the adult rat hippocampus. Nutrients 2015, 7, 8413–8423. [Google Scholar] [CrossRef] [Scilit]
- Hamid, K.; Ng, I.; Tallapragada, V.J.; Váradi, L.; Hibbs, D.E.; Hanrahan, J.; Groundwater, P.W. An Investigation of the Differential Effects of Ursane Triterpenoids from Centella asiatica, and Their Semisynthetic Analogues, on GABAA Receptors. Chem. Biol. Drug Des. 2016, 88, 386–397. [Google Scholar] [CrossRef] [Scilit]
- Siddiqui, S.; Khan, F.; Jamali, K.S.; Musharraf, S.G. Madecassic Acid Reduces Fast Transient Potassium Channels and Promotes Neurite Elongation in Hippocampal CA1 Neurons. CNS Neurol. Disord. Drug Targets 2019, 18, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Tongiorgi, E.; Armellin, M.; Giulianini, P.G.; Bregola, G.; Zucchini, S.; Paradiso, B.; Steward, O.; Cattaneo, A.; Simonato, M. Brain-derived neurotrophic factor mRNA and protein are targeted to discrete dendritic laminas by events that trigger epileptogenesis. J. Neurosci. 2004, 24, 6842–6852. [Google Scholar] [CrossRef] [Scilit]
- Pattabiraman, P.P.; Tropea, D.; Chiaruttini, C.; Tongiorgi, E.; Cattaneo, A.; Domenici, L. Neuronal activity regulates the developmental expression and subcellular localization of cortical BDNF mRNA isoforms in vivo. Mol. Cell. Neurosci. 2005, 28, 556–570. [Google Scholar] [CrossRef] [Scilit]
- Chiaruttini, C.; Sonego, M.; Baj, G.; Simonato, M.; Tongiorgi, E. BDNF mRNA splice variants display activity-dependent targeting to distinct hippocampal laminae. Mol. Cell. Neurosci. 2008, 37, 11–19. [Google Scholar] [CrossRef] [Scilit]
- Calabrese, F.; Molteni, R.; Maj, P.F.; Cattaneo, A.; Gennarelli, M.; Racagni, G.; Riva, M.A. Chronic duloxetine treatment induces specific changes in the expression of BDNF transcripts and in the subcellular localization of the neurotrophin protein. Neuropsychopharmacology 2007, 32, 2351–2359. [Google Scholar] [CrossRef] [Scilit]
- Molteni, R.; Calabrese, F.; Cattaneo, A.; Mancini, M.; Gennarelli, M.; Racagni, G.; Riva, M.A. Acute stress responsiveness of the neurotrophin bdnf in the rat hippocampus is modulated by chronic treatment with the antidepressant duloxetine. Neuropsychopharmacology 2009, 34, 1523–1532. [Google Scholar] [CrossRef] [Scilit]
- Bevins, R.A.; Besheer, J. Object recognition in rats and mice: A one-trial non-matching-to-sample learning task to study “recognition memory. ” Nat. Protoc. 2006, 3, 1306–1311. [Google Scholar] [CrossRef] [Scilit]
- Boondam, Y.; Songvut, P.; Tantisira, M.H.; Tapechum, S.; Tilokskulchai, K.; Pakaprot, N. Inverted U-shaped response of a standardized extract of Centella asiatica (ECa 233) on memory enhancement. Sci. Rep. 2019, 9, 8404. [Google Scholar] [CrossRef] [Scilit]
- Godsil, B.P.; Kiss, J.P.; Spedding, M.; Jay, T.M. The hippocampal-prefrontal pathway: The weak link in psychiatric disorders? Eur. Neuropsychopharmacol. 2013, 23, 1165–1181. [Google Scholar] [CrossRef] [Scilit]
- Sampath, D.; Sathyanesan, M.; Newton, S.S. Cognitive dysfunction in major depression and Alzheimer’s disease is associated with hippocampal–prefrontal cortex dysconnectivity. Neuropsychiatr. Dis. Treat. 2017, 13, 1509–1519. [Google Scholar] [CrossRef] [Scilit]
- Kheirbek, M.A.; Drew, L.J.; Burghardt, N.S.; Costantini, D.O.; Tannenholz, L.; Ahmari, S.E.; Zeng, H.; Fenton, A.A.; Henl, R. Differential control of learning and anxiety along the dorsoventral axis of the dentate gyrus. Neuron 2013, 77, 955–968. [Google Scholar] [CrossRef] [Scilit]
- Fanselow, M.S.; Dong, H.W. Are the Dorsal and Ventral Hippocampus Functionally Distinct Structures? Neuron 2010, 65, 7–19. [Google Scholar] [CrossRef] [Scilit]
- Leng, D.D.; Han, W.J.; Rui, Y.; Dai, Y.; Xia, Y.F. In vivo disposition and metabolism of madecassoside, a major bioactive constituent in Centella asiatica (L.) Urb. J. Ethnopharmacol. 2013, 150, 601–608. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Time (min) | Phase A (%) | Phase B (%) |
|---|---|---|
| 0 | 95 | 5 |
| 1 | 95 | 5 |
| 6 | 5 | 95 |
| 9.5 | 5 | 95 |
| 10.5 | 95 | 5 |
| 25 | 95 | 5 |
| Gene | Forward Primer | Reverse Primer | Probe |
|---|---|---|---|
| 36b4 | TTCCCACTGGCTGAAAAGGT | CGCAGCCGCAAATGC | AAGGCCTTCCTGGCCGATCCATC |
| total Bdnf | AAGTCTGCATTACATTCCTCGA | GTTTTCTGAAAGAGGGACAGTTTAT | TGTGGTTTGTTGCCGTTGCCAAG |
| Ngf | AAGGACGCAGCTTTCTATCC | CTATCTGTGTACGGTTCTGCC | CTCTGAGGTGCATAGCGTAATGTCCA |
| Npas4 | TCATTGACCCTGCTGACCAT | AAGCACCAGTTTGTTGCCTG | TGATCGCCTTTTCCGTTGTC |
| Gene | Accession Number | Assay ID |
|---|---|---|
| Bdnf long 3′UTR | EF125675 | Rn02531967_s1 |
| Bdnf isoform IV | EF125679 | Rn01484927_m1 |
| Bdnf isoform VI | EF125680 | Rn01484928_m1 |
| Gadd45β | BC085337.1 | Rn01452530_g1 |
| Protein | Primary Antibody | Secondary Antibody |
|---|---|---|
| mBDNF | 1:1000 (Icosagen) 4 °C O/N | anti-mouse 1:1000 RT 1 h |
| pTRKb Y816 | 1:1000 (Immunological Sciences) 4 °C O/N | anti-rabbit 1:2000 RT 1 h |
| TRKb | 1:750 (Cell Signaling) 4 °C O/N | anti-rabbit 1:2000 RT 1 h |
| β-Actin | 1:10000 (Sigma) RT 45 min | anti-mouse 1:1000 RT 45 min |
| Treatment | Prefrontal Cortex | Dorsal Hippocampus | Ventral Hippocampus | |
|---|---|---|---|---|
| Gadd45β | vehicle | 100 ± 6 | 100 ± 3 | 100 ± 3 |
| C. asiatica L. 20 mg/kg | 118 ± 13 | 113 ± 7 | 118 ± 10 | |
| C. asiatica L. 100 mg/kg | 125 ± 15 | 118 ± 11 | 106 ± 8 | |
| Ngf | Vehicle | 100 ± 6 | 100 ± 8 | 100 ± 5 |
| C. asiatica L. 20 mg/kg | 101 ± 11 | 79 ± 4 | 105 ± 11 | |
| C. asiatica L. 100 mg/kg | 104 ± 9 | 103 ± 8 | 83 ± 7 | |
| Npas4 | Vehicle | 100 ± 13 | 100 ±20 | 100 ± 15 |
| C. asiatica L. 20 mg/kg | 180 ± 19 ** | 88 ± 10 | 100 ± 4 | |
| C. asiatica L. 100 mg/kg | 76 ± 6 | 92 ± 13 | 56 ± 13 * |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sbrini, G.; Brivio, P.; Fumagalli, M.; Giavarini, F.; Caruso, D.; Racagni, G.; Dell’Agli, M.; Sangiovanni, E.; Calabrese, F. Centella asiatica L. Phytosome Improves Cognitive Performance by Promoting Bdnf Expression in Rat Prefrontal Cortex. Nutrients 2020, 12, 355. https://doi.org/10.3390/nu12020355
Sbrini G, Brivio P, Fumagalli M, Giavarini F, Caruso D, Racagni G, Dell’Agli M, Sangiovanni E, Calabrese F. Centella asiatica L. Phytosome Improves Cognitive Performance by Promoting Bdnf Expression in Rat Prefrontal Cortex. Nutrients. 2020; 12(2):355. https://doi.org/10.3390/nu12020355
Chicago/Turabian StyleSbrini, Giulia, Paola Brivio, Marco Fumagalli, Flavio Giavarini, Donatella Caruso, Giorgio Racagni, Mario Dell’Agli, Enrico Sangiovanni, and Francesca Calabrese. 2020. "Centella asiatica L. Phytosome Improves Cognitive Performance by Promoting Bdnf Expression in Rat Prefrontal Cortex" Nutrients 12, no. 2: 355. https://doi.org/10.3390/nu12020355
APA StyleSbrini, G., Brivio, P., Fumagalli, M., Giavarini, F., Caruso, D., Racagni, G., Dell’Agli, M., Sangiovanni, E., & Calabrese, F. (2020). Centella asiatica L. Phytosome Improves Cognitive Performance by Promoting Bdnf Expression in Rat Prefrontal Cortex. Nutrients, 12(2), 355. https://doi.org/10.3390/nu12020355

