Low-dose Bisphenol-A Promotes Epigenetic Changes at Pparγ Promoter in Adipose Precursor Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Methods
2.2.1. Cell Culture and Adipocyte Differentiation
2.2.2. RNA Isolation and Quantitative Real-Time PCR
2.2.3. DNA Methylation Assessment
2.2.4. Reverse Transcription and Quantification of MicroRNAs Expression
2.2.5. Statistical analysis
3. Results
3.1. BPA Exerts Epigenetic Modification at Pparγ Promoter
3.2. DNA Hypomethylation Precedes the Increase in Pparγ Expression during the Adipocyte Differentiation
3.3. Spontaneous 3T3L1 Cells Differentiation Is Not Enhanced by BPA Pre-exposure
3.4. BPA Effects on Non-Adipogenic NIH3T3 Cells. Evaluation of Commitment Phase
3.5. BPA-Induced Alterations Are Reversible after the Termination of the Exposure
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Baillie-Hamilton, P.F. Chemical toxins: A hypothesis to explain the global obesity epidemic. J. Altern. Complement. Med. 2002, 8, 185–192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Sun, B.; Hou, M.; Pan, X.; Li, X. The environmental obesogen bisphenol A promotes adipogenesis by increasing the amount of 11β-hydroxysteroid dehydrogenase type 1 in the adipose tissue of children. Int. J. Obes. (Lond.) 2013, 37, 999–1005. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brenseke, B.; Prater, M.R.; Bahamonde, J.; Gutierrez, J.C. Current thoughts on maternal nutrition and fetal programming of the metabolic syndrome. J. Pregnancy 2013, 2013, 368461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- MacDonald, A.A.; Herbison, G.P.; Showell, M.; Farquhar, C.M. The impact of body mass index on semen parameters and reproductive hormones in human males: A systematic review with meta-analysis. Hum. Reprod. Update 2010, 16, 293–311. [Google Scholar] [CrossRef] [Scilit]
- Somer, R.A.; Thummel, C.S. Epigenetic inheritance of metabolic state. Curr. Opin. Genet Dev. 2014, 27, 43–47. [Google Scholar] [CrossRef] [Scilit]
- Morgen, C.S.; Sorensen, T.I. Obesity: Global trends in the prevalence of overweight and obesity. Nat. Rev. Endocrinol. 2014, 10, 513–514. [Google Scholar] [CrossRef] [Scilit]
- Brown, R.E.; Sharma, A.M.; Ardern, C.I.; Mirdamadi, P.; Mirdamadi, P.; Kuk, J.L. Secular differences in the association between caloric intake, macronutrient intake, and physical activity with obesity. Obes. Res. Clin. Pract. 2016, 10, 243–255. [Google Scholar] [CrossRef] [Scilit]
- Gore, A.C.; Chappell, V.A.; Fenton, S.E.; Flaws, J.A.; Nadal, A.; Prins, G.S.; Toppari, J.; Zoeller, R.T. EDC2: The Endocrine Society’s Second Scientific Statement on Endocrine-Disrupting Chemicals. Endocr. Rev. 2015, 36, E1–E150. [Google Scholar] [CrossRef] [Scilit]
- Grun, F.; Blumberg, B. Endocrine disrupters as obesogens. Mol. Cell Endocrinol. 2009, 304, 19–29. [Google Scholar] [CrossRef] [Scilit]
- Alonso-Magdalena, P.; Quesada, I.; Nadal, A. Endocrine disruptors in the etiology of type 2 diabetes mellitus. Nat. Rev. Endocrinol. 2011, 7, 346–353. [Google Scholar] [CrossRef] [Scilit]
- Hectors, T.L.; Vanparys, C.; van der Ven, K.; Martens, G.A.; Jorens, P.G.; Van Gaal, L.F.; Covaci, A.; De Coen, W.; Blust, R. Environmental pollutants and type 2 diabetes: A review of mechanisms that can disrupt beta cell function. Diabetologia 2011, 54, 1273–1290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- World Health Organization (WHO); International Programme on Chemical Safety (IPCS). Global Assessment of the State-of-the-Science of Endocrine Disruptors. 2002. Available online: https://www.who.int/ipcs/publications/new_issues/endocrine_disruptors/en/ (accessed on 1 June 2020).
- Filardi, T.; Panimolle, F.; Lenzi, A.; Morano, S. Bisphenol A and Phthalates in Diet: An Emerging Link with Pregnancy Complications. Rev. Nutr. 2020, 12, 525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, C.; Xu, J.; Chen, D.; Xiao, Y. Detection of phthalates migration from disposable tablewares to drinking water using hexafluoroisopropanol-induced catanionic surfactant coacervate extraction. Pharm. Anal. 2016, 6, 292–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cooper, J.E.; Kendig, E.L.; Belcher, S.M. Assessment of bisphenol A released from reusable plastic, aluminium and stainless-steel water bottles. Chemosphere 2011, 85, 943–947. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bradley, E.L.; Burden, R.A.; Bentayeb, K.; Driffield, M.; Harmer, N.; Mortimer, D.N.; Speck, D.R.; Ticha, J.; Castle, L. Exposure to phthalic acid, phthalate diesters and phthalate monoesters from foodstuffs: UK total diet study results. Food Addit. Contam. Part A Chem. Anal. Control Expo. Risk Assess 2013, 30, 735–742. [Google Scholar] [CrossRef] [Scilit]
- Fierens, T.; Van Holderbeke, M.; Willems, H.; De Henauw, S.; Sioen, I. Transfer of eight phthalates through the milk chain—A case study. Environ. Int. 2013, 51, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Liao, C.; Kannan, K. Concentrations and profiles of bisphenol A and other bisphenol analogues in foodstuffs from the United States and their implications for human exposure. J. Agric. Food Chem. 2013, 61, 4655–4662. [Google Scholar] [CrossRef] [Scilit]
- Janesick, A.; Blumberg, B. Endocrine disrupting chemicals and the developmental programming of adipogenesis and obesity. Birth Defects Res. Part C Embryo Today 2011, 93, 34–50. [Google Scholar] [CrossRef] [Scilit]
- Grun, F.; Blumberg, B. Environmental Obesogens: Organotins and Endocrine Disruption via Nuclear Receptor Signaling. Endocrinology 2006, 147, s50–s55. [Google Scholar] [CrossRef] [Scilit]
- Heindel, J.J.; Blumberg, B.; Cave, M.3; Machtinger, R.; Mantovani, A.; Mendez, M.A.; Nadal, A.; Palanza, P.; Panzica, G.; Sargis, R.; et al. Metabolism disrupting chemicals and metabolic disorders. Reprod. Toxicol. 2017, 68, 3–33. [Google Scholar] [CrossRef] [Scilit]
- Janesick, A.S.; Blumberg, B. Obesogens: An emerging threat to public health. Am. J. Obstet. Gynecol. 2016, 214, 559–565. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heindel, J.J.; Blumberg, B. Environmental Obesogens: Mechanisms and Controversies. Annu. Rev. Pharmacol. Toxicol. 2019, 59, 89–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rubin, B.S. Bisphenol A: An endocrine disruptor with widespread exposure and multiple effects. J. Steroid Biochem. Mol. Biol. 2011, 127, 27–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Filippis, E.; Li, T.; Rosen, E.D. Exposure of adipocytes to bisphenol-A in vitro interferes with insulin action without enhancing adipogenesis. PLoS ONE 2018, 13, e0201122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vandenberg, L.N.; Hauser, R.; Marcus, M.; Olea, N.; Welshons, W.V. Human exposure to bisphenol A (BPA). Reprod. Toxicol. 2007, 24, 139–177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calafat, A.M.; Ye, X.; Wong, L.Y.; Reidy, J.A.; Needham, L.L. Exposure of the U.S. Population to Bisphenol A and 4-tertiary-Octylphenol: 2003–2004. Environ. Health Perspect. 2008, 116, 39–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuruto-Niwa, R.; Tateoka, Y.; Usuki, Y.; Nozawa, R. Measurement of bisphenol A concentrations in human colostrum. Chemosphere 2007, 66, 1160–1164. [Google Scholar] [CrossRef] [Scilit]
- Kandaraki, E.; Chatzigeorgiou, A.; Livadas, S.; Palioura, E.; Economou, F.; Koutsilieris, M.; Palimeri, S.; Panidis, D.; Diamanti-Kandarakis, E. Endocrine disruptors and polycystic ovary syndrome (PCOS): Elevated serum levels of bisphenol A in women with PCOS. J. Clin. Endocrinol. Metab. 2011, 96, E480–E484. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.; Yu, W.; Meng, F.; Mi, J.; Peng, J.; Liu, J.; Zhang, X.; Hai, C.; Wang, X. Polychlorinated biphenyls-153 induces metabolic dysfunction through activation of ROS/NF-κB signaling via downregulation of HNF1b. Redox Biol. 2017, 12, 300–310. [Google Scholar] [CrossRef] [Scilit]
- Robledo, C.A.; Yeung, E.; Mendola, P.; Sundaram, R.; Maisog, J.; Sweeney, A.M.; Barr, D.B.; Louis, G.M. Preconception maternal and paternal exposure to persistent organic pollutants and birth size: The LIFE study. Environ. Health Perspect. 2015, 123, 88–94. [Google Scholar] [CrossRef] [Scilit]
- Anzalone, D.A.; Sampino, S.; Czernik, M.; Iuso, D.; Ptak, G.E. Polychlorinated biphenyls (PCBs) alter DNA methylation and genomic integrity of sheep fetal cells in a simplified in vitro model of pregnancy exposure. Toxicol. In Vitro 2018, 46, 39–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calafat, A.M.; Weuve, J.; Ye, X.; Jia, L.T.; Hu, H.; Ringer, S.; Huttner, K.; Hauser, R. Exposure to bisphenol A and other phenols in neonatal intensive care unit premature infants. Environ. Health Perspect. 2009, 117, 639–644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vandenberg, L.M.; Chahoud, I.; Heindel, J.J.; Padmanabhan, V.; Paumgartten, F.J.; Schoenfelder, G. Urinary, circulating, and tissue biomonitoring studies indicate widespread exposure to bisphenol A. Environ. Health Perspect. 2010, 118, 1055–1070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Veiga-Lopez, A.; Pu, Y.; Gingrich, J.; Padmanabhan, V. Obesogenic Endocrine Disrupting Chemicals: Identifying Knowledge Gaps. Trends Endocrinol. Metab. 2018, 29, 607–625. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wetherill, Y.B.; Akingbemi, B.T.; Kanno, J.; McLachlan, J.A.; Nadal, A.; Sonnenschein, C.; Watson, C.S.; Zoeller, R.T.; Belcher, S.M. In vitro molecular mechanisms of bisphenol A action. Reprod. Toxicol. 2007, 24, 178–198. [Google Scholar] [CrossRef] [Scilit]
- Paris, F.; Balaguer, P.; Terouanne, B.; Servant, N.; Lacoste, C.; Cravedi, J.P.; Nicolas, J.C.; Sultan, C. Phenylphenols, biphenols, bisphenol-A and 4-tert-octylphenol exhibit alpha and beta estrogen activities and antiandrogen activity in reporter cell lines. Mol. Cell Endocrinol. 2002, 193, 43–49. [Google Scholar] [CrossRef] [Scilit]
- Michałowicz, J. Bisphenol A—Sources, toxicity and biotransformation. Environ. Toxicol. Pharmacol. 2014, 37, 738–758. [Google Scholar] [CrossRef] [Scilit]
- Alonso-Magdalena, P.; Ropero, A.B.; Soriano, S.; García-Arévalo, M.; Ripoll, C.; Fuentes, E.; Quesada, I.; Nadal, Á. Bisphenol-A acts as a potent estrogen via non-classical estrogen triggered pathways. Mol. Cell Endocrinol. 2012, 355, 201–207. [Google Scholar] [CrossRef] [Scilit]
- Moriyama, K.; Tagami, T.; Akamizu, T.; Usui, T.; Saijo, M.; Kanamoto, N.; Hataya, Y.; Shimatsu, A.; Kuzuya, H.; Nakao, K. Thyroid hormone action is disrupted by bisphenol A as an antagonist. J. Clin. Endocrinol. Metab. 2002, 87, 5185–5190. [Google Scholar] [CrossRef] [Scilit]
- Sohoni, P.; Sumpter, J.P. Several environmental oestrogens are also anti-androgens. J. Endocrinol. 1998, 158, 327–339. [Google Scholar] [CrossRef] [Scilit]
- Sargis, R.M.; Johnson, D.N.; Choudhury, R.A.; Brady, M.J. Environmental endocrine disruptors promote adipogenesis in the 3T3L1 cell line through glucocorticoid receptor activation. Obesity (Silver Spring) 2010, 18, 1283–1288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alonso-Magdalena, P.; Rivera, F.J.; Guerrero-Bosagna, C. Bisphenol-A and metabolic diseases: Epigenetic, developmental and transgenerational basis. Environ. Epigenet 2016, 2, dvw022. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cwiek-Ludwicka, K. Bisphenol A (BPA) in food contact materials-new scientific opinion from EFSA regarding public health risk. Rocz. Panstw. Zakl. Hig. 2015, 66, 299–307. [Google Scholar] [PubMed]
- Fromme, H.; Gruber, L.; Schlummer, M.; Wolz, G.; Böhmer, S.; Angerer, J.; Mayer, R.; Liebl, B.; Bolte, G. Intake of phthalates and di(2-ethylhexyl) adipate: Results of the Integrated Exposure Assessment Survey based on duplicate diet samples and biomonitoring data. Environ. Int. 2007, 33, 1012–1020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lakind, J.S.; Naiman, D.Q. Daily intake of bisphenol A and potential sources of exposure: 2005-2006 National Health and Nutrition Examination Survey. J. Expo. Sci. Environ. Epidemiol. 2011, 21, 272–279. [Google Scholar] [CrossRef] [Scilit]
- Lorber, M.; Schecter, A.; Paepke, O.; Shropshire, W.; Christensen, K.; Birnbaumf, L. Exposure assessment of adult intake of bisphenol A (BPA) with emphasis on canned food dietary exposures. Environ. Int. 2015, 77, 55–62. [Google Scholar] [CrossRef] [Scilit]
- Hoekstra, E.J.; Simoneau, C. Release of bisphenol A from polycarbonate: A review. Crit. Rev. Food Sci. Nutr. 2013, 53, 386–402. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.Y.; Shen, Y.P.; Chen, S.C. Assessing bisphenol A (BPA) exposure risk from long-term dietary intakes in Taiwan. Sci. Total Environ. 2016, 543, 140–146. [Google Scholar] [CrossRef] [Scilit]
- Geens, T.; Aerts, D.; Berthot, C.; Bourguignon, J.P.; Goeyens, L.; Lecomte, P.; Maghuin-Rogister, G.; Pironnet, A.M.; Pussemier, L.; Scippo, M.L.; et al. A review of dietary and non-dietary exposure to bisphenol-A. Food Chem. Toxicol. 2012, 50, 3725–3740. [Google Scholar] [CrossRef] [Scilit]
- vom Saal, F.S.; Hughes, C. An extensive new literature concerning low-dose effects of bisphenol A shows the need for a new risk assessment. Environ. Health Perspect. 2005, 113, 926–933. [Google Scholar] [CrossRef] [Scilit]
- Khalil, N.; Ebert, J.R.; Wang, L.; Belcher, S.; Lee, M.; Czerwinski, S.A.; Kannan, K. Bisphenol A and cardiometabolic risk factors in obese children. Sci. Total Environ. 2014, 470–471, 726–732. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rochester, J.R. Bisphenol A and human health: A review of the literature. Reprod. Toxicol. 2013, 42, 132–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dai, Y.E.; Chen, W.; Qi, H.; Liu, Q.Q. Effect of bisphenol A on SOCS-3 and insulin signaling transduction in 3T3L1 adipocytes. Mol. Med. Rep. 2016, 14, 331–336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moon, M.K.; Jeong, I.; Oh, T.J.; Ahn, H.Y.; Kim, H.H.; Park, Y.J.; Jang, H.C.; Park, C.S. Long-term oral exposure to bisphenol A induces glucose intolerance and insulin resistance. J. Endocrinol. 2015, 226, 35–42. [Google Scholar] [CrossRef] [Scilit]
- Yang, M.; Chen, M.; Wang, J.; Xu, M.; Sun, J.; Ding, L.; Lv, X.; Ma, Q.; Bi, Y.; Liu, R.; et al. Bisphenol A Promotes Adiposity and Inflammation in a Nonmonotonic Dose-response Way in 5-week-old Male and Female C57BL/6J Mice Fed a Low-calorie Diet. Endocrinology 2016, 157, 2333–2345. [Google Scholar] [CrossRef] [Scilit]
- Ariemma, F.; D’Esposito, V.; Liguoro, D.; Oriente, F.; Cabaro, S.; Liotti, A.; Cimmino, I.; Longo, M.; Beguinot, F.; Formisano, P.; et al. Low-Dose Bisphenol-A Impairs Adipogenesis and Generates Dysfunctional 3T3L1 Adipocytes. PLoS ONE 2016, 11, e0150762. [Google Scholar] [CrossRef] [Scilit]
- Valentino, R.; D’Esposito, V.; Passaretti, F.; Liotti, A.; Cabaro, S.; Longo, M.; Perruolo, G.; Oriente, F.; Beguinot, F.; Formisano, P. Bisphenol-A impairs insulin action and up-regulates inflammatory pathways in human subcutaneous adipocytes and 3T3L1 cells. PLoS ONE 2013, 8, e82099. [Google Scholar] [CrossRef] [Scilit]
- Zatterale, F.; Longo, M.; Naderi, J.; Raciti, G.A.; Desiderio, A.; Miele, C.; Beguinot, F. Chronic Adipose Tissue Inflammation Linking Obesity to Insulin Resistance and Type 2 Diabetes. Front. Physiol. 2020, 10, 1607. [Google Scholar] [CrossRef] [Scilit]
- Longo, M.; Zatterale, F.; Naderi, J.; Parrillo, L.; Formisano, P.; Raciti, G.A.; Beguinot, F.; Miele, C. Adipose Tissue Dysfunction as Determinant of Obesity-Associated Metabolic Complications. Int. J. Mol. Sci. 2019, 20, 2358. [Google Scholar] [CrossRef] [Scilit]
- Ahmed, S.; Atlas, E. Bisphenol S- and bisphenol A-induced adipogenesis of murine preadipocytes occurs through direct peroxisome proliferator-activated receptor gamma activation. Int. J. Obes. (Lond.) 2016, 40, 1566–1573. [Google Scholar] [CrossRef] [Scilit]
- Boucher, J.G.; Boudreau, A.; Atlas, E. Bisphenol A induces differentiation of human preadipocytes in the absence of glucocorticoid and is inhibited by an estrogen-receptor antagonist. Nutr. Diabetes 2014, 4, e102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohlstein, J.F.; Strong, A.L.; McLachlan, J.A.; Gimble, J.M.; Burow, M.E.; Bunnell, B.A. Bisphenol A enhances adipogenic differentiation of human adipose stromal/stem cells. J. Mol. Endocrinol. 2014, 53, 345–353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Somm, E.; Schwitzgebel, V.M.; Toulotte, A.; Cederroth, C.R.; Combescure, C.; Nef, S.; Aubert, M.L.; Hüppi, P.S. Perinatal Exposure to Bisphenol A Alters Early Adipogenesis in the Rat. Environ. Health Perspect. 2009, 117, 1549–1555. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atlas, E.; Pope, L.; Wade, M.G.; Kawata, A.; Boudreau, A.; Boucher, J.G. Bisphenol A increases aP2 expression in 3T3L1 by enhancing the transcriptional activity of nuclear receptors at the promoter. Adipocyte 2014, 3, 170–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chamorro-García, R.; Kirchner, S.; Li, X.; Janesick, A.; Casey, S.C.; Chow, C.; Blumberg, B. Bisphenol A diglycidyl ether induces adipogenic differentiation of multipotent stromal stem cells through a peroxisome proliferator-activated receptor gamma-independent mechanism. Environ. Health Perspect. 2012, 120, 984–989. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Linehan, C.; Gupta, S.; Samali, A.; O’Connor, L. Bisphenol A-Mediated Suppression of LPL Gene Expression Inhibits Triglyceride Accumulation during Adipogenic Differentiation of Human Adult Stem Cells. PLoS ONE 2012, 7, e36109. [Google Scholar] [CrossRef] [Scilit]
- Kamstra, J.H.; Hruba, E.; Blumberg, B.; Janesick, A.; Mandrup, S.; Hamers, T.; Legler, J. Transcriptional and epigenetic mechanisms underlying enhanced in vitro adipocyte differentiation by the brominated flame-retardant BDE-47. Environ. Sci. Technol. 2014, 48, 4110–4119. [Google Scholar] [CrossRef] [Scilit]
- Longo, M.; Raciti, G.A.; Zatterale, F.; Parrillo, L.; Desiderio, A.; Spinelli, R.; Hammarstedt, A.; Hedjazifar, S.; Hoffmann, J.M.; Nigro, C.; et al. Epigenetic modifications of the Zfp/ZNF423 gene control murine adipogenic commitment and are dysregulated in human hypertrophic obesity. Diabetologia 2018, 61, 369–380. [Google Scholar] [CrossRef] [Scilit]
- Parrillo, L.; Spinelli, R.; Longo, M.; Desiderio, A.; Mirra, P.; Nigro, C.; Fiory, F.; Hedjazifar, S.; Mutarelli, M.; Carissimo, A.; et al. Altered PTPRD DNA methylation associates with restricted adipogenesis in healthy first-degree relatives of Type 2 diabetes subjects. Epigenomics 2020, 12, 873–888. [Google Scholar] [CrossRef] [Scilit]
- Raciti, G.A.; Spinelli, R.; Desiderio, A.; Longo, M.; Parrillo, L.; Nigro, C.; D’Esposito, V.; Mirra, P.; Fiory, F.; Pilone, V.; et al. Specific CpG hyper-methylation leads to Ankrd26 gene down-regulation in white adipose tissue of a mouse model of diet-induced obesity. Sci. Rep. 2017, 7, 43526. [Google Scholar] [CrossRef] [Scilit]
- Nic-Can, G.I.; Rodas-Junco, B.A.; Carrillo-Cocom, L.M.; Zepeda-Pedreguera, A.; Peñaloza-Cuevas, R.; Aguilar-Ayala, F.J.; Rojas-Herrera, R.A. Epigenetic Regulation of Adipogenic Differentiation by Histone Lysine Demethylation. Int. J. Mol. Sci. 2019, 20, 3918. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oriente, F.; Cabaro, S.; Liotti, A.; Longo, M.; Parrillo, L.; Pagano, T.B.; Raciti, G.A.; Penkov, D.; Paciello, O.; Miele, C.; et al. PREP1 deficiency downregulates hepatic lipogenesis and attenuates steatohepatitis in mice. Diabetologia 2013, 56, 2713–2722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Welshons, W.V.; Nagel, S.C.; vom Saal, F.S. Large effects from small exposures. III. Endocrine mechanisms mediating effects of bisphenol A at levels of human exposure. Endocrinology 2006, 147, S56–S69. [Google Scholar] [CrossRef] [Scilit]
- Longo, M.; Spinelli, R.; D’Esposito, V.; Zatterale, F.; Fiory, F.; Nigro, C.; Raciti, G.A.; Miele, C.; Formisano, P.; Beguinot, F.; et al. Pathologic endoplasmic reticulum stress induced by glucotoxic insults inhibits adipocyte differentiation and induces an inflammatory phenotype. Biochim. Biophys. Acta 2016, 1863, 1146–1156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parrillo, L.; Costa, V.; Raciti, G.A.; Longo, M.; Spinelli, R.; Esposito, R.; Nigro, C.; Vastolo, V.; Desiderio, A.; Zatterale, F.; et al. Hoxa5 undergoes dynamic DNA methylation and transcriptional repression in the adipose tissue of mice exposed to high-fat diet. Int. J. Obes. (Lond.) 2016, 40, 929–937. [Google Scholar] [CrossRef] [Scilit]
- Hugo, E.R.; Brandebourg, T.D.; Woo, J.G.; Loftus, J.; Alexander, J.W.; Ben-Jonathan, N. Bisphenol A at environmentally relevant doses inhibits adiponectin release from human adipose explants and adipocytes. Environ. Health Perspect. 2008, 116, 1642–1647. [Google Scholar] [CrossRef] [Scilit]
- Valentino, R.; D’Esposito, V.; Ariemma, F.; Cimmino, I.; Beguinot, F.; Formisano, p. Bisphenol A Environmental Exposure and the Detrimental Effects on Human Metabolic Health: Is It Necessary to Revise the Risk Assessment in Vulnerable Population? Rev. J. Endocrinol. Investig. 2016, 39, 259–263. [Google Scholar] [CrossRef] [Scilit]
- Kang, J.H.; Kondo, F.; Katayama, Y. Human exposure to bisphenol A. Toxicology 2006, 226, 79–89. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Yu, P.; Qian, W.; Li, Y.; Zhao, J.; Huan, F.; Wang, J.; Xiao, H. Perinatal bisphenol A exposure and adult glucose homeostasis: Identifying critical windows of exposure. PLoS ONE 2013, 8, e64143. [Google Scholar] [CrossRef] [Scilit]
- Vandenberg, L.N.; Colborn, T.; Hayes, T.B.; Heindel, J.J.; Jacobs, D.R.; Lee, D.; Shioda, T.; Soto, A.M.; vom Saal, F.S.; Welshons, W.V.; et al. Hormones and endocrine-disrupting chemicals: Low-dose effects and nonmonotonic dose responses. Endocr. Rev. 2012, 33, 378–455. [Google Scholar] [CrossRef] [Scilit]
- Vandenberg, L.N. Non-Monotonic Dose Responses in Studies of Endocrine Disrupting Chemicals: Bisphenol A as a Case Study. Dose Response 2014, 12, 259–276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lagarde, F.; Beausoleil, C.; Belcher, S.M.; Belzunces, L.P.; Emond, C.; Guerbet, M.; Rousselle, C. Non-monotonic dose-response relationships and endocrine disruptors: A qualitative method of assessment. Environ. Health 2015, 14, 13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujiki, K.; Kano, F.; Shiota, K.; Murata, M. Expression of the peroxisome proliferator activated receptor γ gene is repressed by DNA methylation in visceral adipose tissue of mouse models of diabetes. BMC Biol. 2009, 7, 38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clarke, S.L.; Robinson, C.E.; Gimble, J.M. CAAT/enhancer Binding Proteins Directly Modulate Transcription from the Peroxisome Proliferator-Activated Receptor Gamma 2 Promoter. Biochem. Biophys. Res. Commun. 1997, 240, 99–103. [Google Scholar] [CrossRef] [Scilit]
- Eeckhoute, J.; Oger, F.; Staels, B.; Lefebvre, P. Coordinated Regulation of PPARγ Expression and Activity through Control of Chromatin Structure in Adipogenesis and Obesity. PPAR Res. 2012, 2012, 164140. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.K.; Kim, A.Y.; Lee, H.W.; Son, Y.H.; Lee, G.Y.; Lee, J.; Lee, Y.S.; Kim, J.B. miR-27a is a negative regulator of adipocyte differentiation via suppressing PPARgamma expression. Biochem. Biophys. Res. Commun. 2010, 392, 323–328. [Google Scholar] [CrossRef] [Scilit]
- Reed, B.G.; Babayev, S.N.; Chen, L.X.; Carr, B.R.; Word, R.A.; Jimenez, P.T. Estrogen-regulated miRNA-27b is altered by bisphenol A in human endometrial stromal cells. Reproduction 2018, 156, 559–567. [Google Scholar] [CrossRef] [Scilit]
- Tilghman, S.L.; Bratton, M.R.; Segar, H.C.; Martin, E.C.; Rhodes, L.V.; Li, M.; McLachlan, J.A.; Wiese, T.E.; Nephew, K.P.; Burow, M.E. Endocrine disruptor regulation of microRNA expression in breast carcinoma cells. PLoS ONE 2012, 7, e32754. [Google Scholar] [CrossRef] [Scilit]
- Portius, D.; Sobolewski, C.; Foti, M. MicroRNAs-Dependent Regulation of PPARs in Metabolic Diseases and Cancers. PPAR Res. 2017, 2017, 7058424. [Google Scholar] [CrossRef] [Scilit]
- Hilton, C.; Neville, M.J.; Karpe, F. MicroRNAs in adipose tissue: Their role in adipogenesis and obesity. Int. J. Obes. (Lond.) 2013, 37, 325–332. [Google Scholar] [CrossRef] [Scilit]
- Wu, Z.; Bucher, N.L.; Farmer, S.R. Induction of Peroxisome Proliferator-Activated Receptor Gamma During the Conversion of 3T3 Fibroblasts into Adipocytes Is Mediated by C/EBPbeta, C/EBPdelta, and Glucocorticoids. Mol. Cell Biol. 1996, 16, 4128–4136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keating, S.T.; El-Osta, A. Epigenetic changes in diabetes. Clin. Genet. 2013, 84, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alonso-Magdalena, P.; Morimoto, S.; Ripoll, C.; Fuentes, E.; Nadal, A. The Estrogenic Effect of Bisphenol A Disrupts Pancreatic β-Cell Function In Vivo and Induces Insulin Resistance. Environ. Health Perspect. 2006, 114, 106–112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alonso-Magdalena, P.; Vieira, E.; Soriano, S.; Menes, L.; Burks, D.; Quesada, I.; Nadal, A. Bisphenol A Exposure during Pregnancy Disrupts Glucose Homeostasis in Mothers and Adult Male Offspring. Environ. Health Perspect. 2010, 118, 1243–1250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Batista, T.M.; Alonso-Magdalena, P.; Vieira, E.; Amaral, M.E.C.; Cederroth, C.R.; Nef, S.; Quesada, I.; Carneiro, E.M.; Nadal, A. Short-term treatment with bisphenol-A leads to metabolic abnormalities in adult male mice. PLoS ONE 2012, 7, e33814. [Google Scholar] [CrossRef] [Scilit]
- Nile, C.J.; Read, R.C.; Akil, M.; Duff, G.W.; Wilson, A.G. Methylation status of a single CpG site in the IL6 promoter is related to IL6 messenger RNA levels and rheumatoid arthritis. Arthritis Rheum. 2008, 58, 2686–2693. [Google Scholar] [CrossRef] [Scilit]
- Hashimoto, K.; Oreffo, R.O.C.; Gibson, M.B.; Goldring, M.B.; Roach, H.I. DNA demethylation at specific CpG sites in the IL1B promoter in response to inflammatory cytokines in human articular chondrocytes. Arthritis Rheum. 2009, 60, 3303–3313. [Google Scholar] [CrossRef] [Scilit]
- Kaut, O.; Ramirez, A.; Pieper, H.; Schmitt, I.; Jessen, F.; Wüllner, U. DNA methylation of the TNF-α promoter region in peripheral blood monocytes and the cortex of human Alzheimer’s disease patients. Dement. Geriatr. Cogn. Disord. 2014, 38, 10–15. [Google Scholar] [CrossRef] [Scilit]
- Nicolia, V.; Cavallaro, R.A.; López-González, I.; Maccarrone, M.; Scarpa, S.; Ferrer, I.; Fuso, A. DNA Methylation Profiles of Selected Pro-Inflammatory Cytokines in Alzheimer Disease. J. Neuropathol. Exp. Neurol. 2017, 76, 27–31. [Google Scholar] [CrossRef] [Scilit]






| Gene name | Primer sequence (5′ to 3′) |
|---|---|
| CCAAT/enhancer binding protein alpha (Cebpα) | Forward: CGCGAGCCAGTTGGGGCACT Reverse: GGGGCTCTGGAGGTGACTGCT |
| Cyclophilin A | Forward: GCAGACAAAGTTCCAAAGACAG Reverse: CACCCTGGCACATGAATCC |
| Fatty acid binding protein 4 (Fabp4 or Ap2) | Forward: TCTCACCTGGAAGACAGCTCC Reverse: GCTGATGATCATGTTGGGCTTGG |
| Glucose transporter member 4 (Glut4) | Forward: CAATGTCTTGGCCGTGTTGG Reverse: GCCCTGATGTTAGCCCTGAG |
| Interferon γ (Ifnγ) | Forward: CCAAGCGGCTGACTGAACTC Reverse: CACTGCAGCTCTGAATGTTTCTT |
| Interleukin 1β (Il1β) | Forward: AGAGCCTGTGTTTCCTCCTTG Reverse: AAAGACCTCAAGTGCAAGGCTA |
| Interleukin 6 (Il6) | Forward: GGAGTGGCTAAGGACCAAGAC Reverse: GCATAACGCACTAGGTTTGCC |
| Monocyte chemoattractant protein 1 (Mcp1) | Forward: CTGTAGTTTTTGTCACCAAGCTCA Reverse: GTGCTGAAGACCTTAGGGCA |
| Peroxisome proliferator-activated receptor gamma 2 (Pparγ2) | Forward: CAGTGGAGACCGCCCAGGCT Reverse: TGGAGCAGGGGGTGAAGGCT |
| Tumor necrosis factor α (Tnfα) | Forward: AGCCCCGAGTCTGTATCCTT Reverse: CTCCCTTTGCAGAACTCAGG |
| Primers used for DNA methylation analysis | |
| Pparγ2 gene promoter | Forward: GATGTGTGATTAGGAGTTTTAATTAAA Reverse:CAAACCTAAATTAACTAACACTATCCTAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Longo, M.; Zatterale, F.; Naderi, J.; Nigro, C.; Oriente, F.; Formisano, P.; Miele, C.; Beguinot, F. Low-dose Bisphenol-A Promotes Epigenetic Changes at Pparγ Promoter in Adipose Precursor Cells. Nutrients 2020, 12, 3498. https://doi.org/10.3390/nu12113498
Longo M, Zatterale F, Naderi J, Nigro C, Oriente F, Formisano P, Miele C, Beguinot F. Low-dose Bisphenol-A Promotes Epigenetic Changes at Pparγ Promoter in Adipose Precursor Cells. Nutrients. 2020; 12(11):3498. https://doi.org/10.3390/nu12113498
Chicago/Turabian StyleLongo, Michele, Federica Zatterale, Jamal Naderi, Cecilia Nigro, Francesco Oriente, Pietro Formisano, Claudia Miele, and Francesco Beguinot. 2020. "Low-dose Bisphenol-A Promotes Epigenetic Changes at Pparγ Promoter in Adipose Precursor Cells" Nutrients 12, no. 11: 3498. https://doi.org/10.3390/nu12113498
APA StyleLongo, M., Zatterale, F., Naderi, J., Nigro, C., Oriente, F., Formisano, P., Miele, C., & Beguinot, F. (2020). Low-dose Bisphenol-A Promotes Epigenetic Changes at Pparγ Promoter in Adipose Precursor Cells. Nutrients, 12(11), 3498. https://doi.org/10.3390/nu12113498

