Fermented Korean Red Ginseng Extract Enriched in Rd and Rg3 Protects against Non-Alcoholic Fatty Liver Disease through Regulation of mTORC1
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation for CRG Extract
2.2. Content Analysis of Ginsenosides in CRG and RG
2.3. Animal Treatment
2.4. Measurement of Serum Biochemistry
2.5. Primary Cell Culture
2.6. Cytotoxicity
2.7. Quantitative Real-Time PCR Analysis
2.8. Western Blot Assay
2.9. Histological Analysis
2.10. Statistical Tests
3. Results
3.1. CRG Treatment Prevents Hepatic Steatosis and Inflammation in FFD-Induced NAFLD
3.2. Fermentation of RG with C. militaris Enhances the Protective Effect on Lipid Accumulation and Inflammation
3.3. CRG has High Contents of Ginsenoside Rd and Rg3 that Inhibit Lipid Accumulation
3.4. Rd and Rg3 Protects PA-Induced Aberrant Activation of mTORC1 and Subsequent Inhibition of Mitophagy and PPARα
3.5. Rd and Rg3 Exerts Anti-Inflammatory Activity via mTORC1-Mediated M2 Polarization
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Browning, J.D.; Szczepaniak, L.S.; Dobbins, R.; Nuremberg, P.; Horton, J.D.; Cohen, J.C.; Grundy, S.M.; Hobbs, H.H. Prevalence of hepatic steatosis in an urban population in the united states: Impact of ethnicity. Hepatology 2004, 40, 1387–1395. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.; Anstee, Q.M.; Marietti, M.; Hardy, T.; Henry, L.; Eslam, M.; George, J.; Bugianesi, E. Global burden of nafld and nash: Trends, predictions, risk factors and prevention. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 11–20. [Google Scholar] [CrossRef] [PubMed]
- Kim, C.H.; Younossi, Z.M. Nonalcoholic fatty liver disease: A manifestation of the metabolic syndrome. Clevel. Clin. J. Med. 2008, 75, 721–728. [Google Scholar] [CrossRef] [PubMed]
- Hardy, T.; Oakley, F.; Anstee, Q.M.; Day, C.P. Nonalcoholic fatty liver disease: Pathogenesis and disease spectrum. Ann. Rev. Pathol. 2016, 11, 451–496. [Google Scholar] [CrossRef]
- Paschos, P.; Paletas, K. Non alcoholic fatty liver disease and metabolic syndrome. Hippokratia 2009, 13, 9–19. [Google Scholar]
- Saxton, R.A.; Sabatini, D.M. Mtor signaling in growth, metabolism, and disease. Cell 2017, 169, 361–371. [Google Scholar] [CrossRef]
- Sabatini, D.M. Twenty-five years of mtor: Uncovering the link from nutrients to growth. Proc. Natl. Acad. Sci. USA 2017, 114, 11818–11825. [Google Scholar] [CrossRef]
- Kubrusly, M.S.; Correa-Giannella, M.L.; Bellodi-Privato, M.; de Sa, S.V.; de Oliveira, C.P.; Soares, I.C.; Wakamatsu, A.; Alves, V.A.; Giannella-Neto, D.; Bacchella, T.; et al. A role for mammalian target of rapamycin (mtor) pathway in non alcoholic steatohepatitis related-cirrhosis. Histol. Histopathol. 2010, 25, 1123–1131. [Google Scholar]
- Bakan, I.; Laplante, M. Connecting mtorc1 signaling to srebp-1 activation. Curr. Opin. Lipidol. 2012, 23, 226–234. [Google Scholar] [CrossRef]
- Kenerson, H.L.; Subramanian, S.; McIntyre, R.; Kazami, M.; Yeung, R.S. Livers with constitutive mtorc1 activity resist steatosis independent of feedback suppression of akt. PLoS ONE 2015, 10, e0117000. [Google Scholar] [CrossRef]
- Peterson, T.R.; Sengupta, S.S.; Harris, T.E.; Carmack, A.E.; Kang, S.A.; Balderas, E.; Guertin, D.A.; Madden, K.L.; Carpenter, A.E.; Finck, B.N.; et al. Mtor complex 1 regulates lipin 1 localization to control the srebp pathway. Cell 2011, 146, 408–420. [Google Scholar] [CrossRef] [PubMed]
- Porstmann, T.; Santos, C.R.; Griffiths, B.; Cully, M.; Wu, M.; Leevers, S.; Griffiths, J.R.; Chung, Y.L.; Schulze, A. Srebp activity is regulated by mtorc1 and contributes to akt-dependent cell growth. Cell Metab. 2008, 8, 224–236. [Google Scholar] [CrossRef] [PubMed]
- Sengupta, S.; Peterson, T.R.; Laplante, M.; Oh, S.; Sabatini, D.M. Mtorc1 controls fasting-induced ketogenesis and its modulation by ageing. Nature 2010, 468, 1100–1104. [Google Scholar] [CrossRef] [PubMed]
- Mao, Z.; Zhang, W. Role of mtor in glucose and lipid metabolism. Int. J. Mol. Sci. 2018, 19, 2043. [Google Scholar] [CrossRef]
- Jung, C.H.; Ro, S.H.; Cao, J.; Otto, N.M.; Kim, D.H. Mtor regulation of autophagy. FEBS Lett. 2010, 584, 1287–1295. [Google Scholar] [CrossRef]
- Kim, Y.C.; Guan, K.L. Mtor: A pharmacologic target for autophagy regulation. J. Clin. Investig. 2015, 125, 25–32. [Google Scholar] [CrossRef]
- Attele, A.S.; Wu, J.A.; Yuan, C.S. Ginseng pharmacology: Multiple constituents and multiple actions. Biochem. Pharmacol. 1999, 58, 1685–1693. [Google Scholar] [CrossRef]
- Lee, S.M.; Bae, B.S.; Park, H.W.; Ahn, N.G.; Cho, B.G.; Cho, Y.L.; Kwak, Y.S. Characterization of korean red ginseng (panax ginseng meyer): History, preparation method, and chemical composition. J. Ginseng Res. 2015, 39, 384–391. [Google Scholar] [CrossRef]
- Hong, Y.J.; Kim, N.; Lee, K.; Hee Sonn, C.; Eun Lee, J.; Tae Kim, S.; Ho Baeg, I.; Lee, K.M. Korean red ginseng (panax ginseng) ameliorates type 1 diabetes and restores immune cell compartments. J. Ethnopharmacol. 2012, 144, 225–233. [Google Scholar] [CrossRef]
- Lee, H.; Park, D.; Yoon, M. Korean red ginseng (panax ginseng) prevents obesity by inhibiting angiogenesis in high fat diet-induced obese c57bl/6j mice. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2013, 53, 402–408. [Google Scholar] [CrossRef]
- Kim, C.S.; Park, J.B.; Kim, K.J.; Chang, S.J.; Ryoo, S.W.; Jeon, B.H. Effect of korea red ginseng on cerebral blood flow and superoxide production. Acta Pharmacol. Sin. 2002, 23, 1152–1156. [Google Scholar] [PubMed]
- Hasegawa, H. Proof of the mysterious efficacy of ginseng: Basic and clinical trials: Metabolic activation of ginsenoside: Deglycosylation by intestinal bacteria and esterification with fatty acid. J. Pharmacol. Sci. 2004, 95, 153–157. [Google Scholar] [CrossRef] [PubMed]
- Wakabayashi, C.; Hasegawa, H.; Murata, J.; Saiki, I. In vivo antimetastatic action of ginseng protopanaxadiol saponins is based on their intestinal bacterial metabolites after oral administration. Oncol. Res. 1997, 9, 411–417. [Google Scholar] [PubMed]
- Hasegawa, H.; Lee, K.S.; Nagaoka, T.; Tezuka, Y.; Uchiyama, M.; Kadota, S.; Saiki, I. Pharmacokinetics of ginsenoside deglycosylated by intestinal bacteria and its transformation to biologically active fatty acid esters. Biol. Pharm. Bull. 2000, 23, 298–304. [Google Scholar] [CrossRef] [PubMed]
- Takino, Y. studies on the pharmacodynamics of ginsenoside-rg1, -rb1 and -rb2 in rats. Yakugaku Zasshi J. Pharm. Soc. Jpn. 1994, 114, 550–564. [Google Scholar] [CrossRef]
- Xu, Q.F.; Fang, X.L.; Chen, D.F. Pharmacokinetics and bioavailability of ginsenoside rb1 and rg1 from panax notoginseng in rats. J. Ethnopharmacol. 2003, 84, 187–192. [Google Scholar] [CrossRef]
- Tawab, M.A.; Bahr, U.; Karas, M.; Wurglics, M.; Schubert-Zsilavecz, M. Degradation of ginsenosides in humans after oral administration. Drug Metab. Dispos. Biol. Fate Chem. 2003, 31, 1065–1071. [Google Scholar] [CrossRef] [PubMed]
- Han, B.H.; Park, M.H.; Han, Y.N.; Woo, L.K.; Sankawa, U.; Yahara, S.; Tanaka, O. Degradation of ginseng saponins under mild acidic conditions. Planta Med. 1982, 44, 146–149. [Google Scholar] [CrossRef]
- Ko, S.R.; Choi, K.J.; Uchida, K.; Suzuki, Y. Enzymatic preparation of ginsenosides rg2, rh1, and f1 from protopanaxatriol-type ginseng saponin mixture. Planta Med. 2003, 69, 285–286. [Google Scholar] [CrossRef]
- Kim, H.I.; Kim, J.K.; Kim, J.Y.; Han, M.J.; Kim, D.H. Fermented red ginseng and ginsenoside rd alleviate ovalbumin-induced allergic rhinitis in mice by suppressing ige, interleukin-4, and interleukin-5 expression. J. Ginseng Res. 2019, 43, 635–644. [Google Scholar] [CrossRef]
- Ryu, J.S.; Lee, H.J.; Bae, S.H.; Kim, S.Y.; Park, Y.; Suh, H.J.; Jeong, Y.H. The bioavailability of red ginseng extract fermented by phellinus linteus. J. Ginseng Res. 2013, 37, 108–116. [Google Scholar] [CrossRef] [PubMed]
- Bae, S.H.; Lee, H.S.; Kim, M.R.; Kim, S.Y.; Kim, J.M.; Suh, H.J. Changes of ginsenoside content by mushroom mycelial fermentation in red ginseng extract. J. Ginseng Res. 2011, 35, 235–242. [Google Scholar] [CrossRef] [PubMed]
- Chan, J.S.; Barseghyan, G.S.; Asatiani, M.D.; Wasser, S.P. Chemical composition and medicinal value of fruiting bodies and submerged cultured mycelia of caterpillar medicinal fungus cordyceps militaris cbs-132098 (ascomycetes). Int. J. Med. Mushrooms 2015, 17, 649–659. [Google Scholar] [CrossRef] [PubMed]
- Cui, J.D. Biotechnological production and applications of cordyceps militaris, a valued traditional chinese medicine. Crit. Rev. Biotechnol. 2015, 35, 475–484. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.; Liu, J.; Zheng, M.; Zhao, C.; Cao, Y.; Dong, Y.; Yaqoob, S.; Xiao, Y.; Xu, X. Effect of fermentation on water mobility and distribution in fermented cornmeal using lf-nmr and its correlation with substrate. J. Food Sci. Technol. 2019, 56, 1027–1036. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Y.; Xing, G.; Rui, X.; Li, W.; Chen, X.; Jiang, M.; Dong, M. Enhancement of the antioxidant capacity of chickpeas by solid state fermentation with cordyceps militaris sn-18. J. Funct. Foods 2014, 10, 210–222. [Google Scholar] [CrossRef]
- Hong, M.; Lee, Y.H.; Kim, S.; Suk, K.T.; Bang, C.S.; Yoon, J.H.; Baik, G.H.; Kim, D.J.; Kim, M.J. Anti-inflammatory and antifatigue effect of korean red ginseng in patients with nonalcoholic fatty liver disease. J. Ginseng Res. 2016, 40, 203–210. [Google Scholar] [CrossRef]
- Asgharpour, A.; Cazanave, S.C.; Pacana, T.; Seneshaw, M.; Vincent, R.; Banini, B.A.; Kumar, D.P.; Daita, K.; Min, H.K.; Mirshahi, F.; et al. A diet-induced animal model of non-alcoholic fatty liver disease and hepatocellular cancer. J. Hepatol. 2016, 65, 579–588. [Google Scholar] [CrossRef]
- Degli Esposti, D.; Hamelin, J.; Bosselut, N.; Saffroy, R.; Sebagh, M.; Pommier, A.; Martel, C.; Lemoine, A. Mitochondrial roles and cytoprotection in chronic liver injury. Biochem. Res. Int. 2012, 2012, 387626. [Google Scholar] [CrossRef]
- Pickles, S.; Vigie, P.; Youle, R.J. Mitophagy and quality control mechanisms in mitochondrial maintenance. Curr. Biol. 2018, 28, R170–R185. [Google Scholar] [CrossRef]
- Sun, N.; Malide, D.; Liu, J.; Rovira, II; Combs, C.A.; Finkel, T. A fluorescence-based imaging method to measure in vitro and in vivo mitophagy using mt-keima. Nat. Protoc. 2017, 12, 1576–1587. [Google Scholar] [CrossRef] [PubMed]
- Marino, G.; Niso-Santano, M.; Baehrecke, E.H.; Kroemer, G. Self-consumption: The interplay of autophagy and apoptosis. Nat. Rev. Mol. Cell Biol. 2014, 15, 81–94. [Google Scholar] [CrossRef] [PubMed]
- Minnich, A.; Tian, N.; Byan, L.; Bilder, G. A potent pparalpha agonist stimulates mitochondrial fatty acid beta-oxidation in liver and skeletal muscle. Am. J. Physiol. Endocrinol. Metab. 2001, 280, E270–E279. [Google Scholar] [CrossRef] [PubMed]
- Laplante, M.; Sabatini, D.M. Regulation of mtorc1 and its impact on gene expression at a glance. J. Cell Sci. 2013, 126, 1713–1719. [Google Scholar] [CrossRef]
- Byles, V.; Covarrubias, A.J.; Ben-Sahra, I.; Lamming, D.W.; Sabatini, D.M.; Manning, B.D.; Horng, T. The tsc-mtor pathway regulates macrophage polarization. Nat. Commun. 2013, 4, 2834. [Google Scholar] [CrossRef]
- Park, T.Y.; Hong, M.; Sung, H.; Kim, S.; Suk, K.T. Effect of korean red ginseng in chronic liver disease. J. Ginseng Res. 2017, 41, 450–455. [Google Scholar] [CrossRef]
- Huu Tung, N.; Uto, T.; Morinaga, O.; Kim, Y.H.; Shoyama, Y. Pharmacological effects of ginseng on liver functions and diseases: A minireview. Evid. Based Complement. Altern. Med. 2012, 2012, 173297. [Google Scholar] [CrossRef]
- Choi, K.T. Botanical characteristics, pharmacological effects and medicinal components of korean panax ginseng c a meyer. Acta Pharmacol. Sin. 2008, 29, 1109–1118. [Google Scholar] [CrossRef]
- Niranjana Murthy, H.; Dandin, V.S.; Yoeup Paek, K. Hepatoprotective activity of ginsenosides from panax ginseng adventitious roots against carbon tetrachloride treated hepatic injury in rats. J. Ethnopharmacol. 2014, 158 Pt A, 442–446. [Google Scholar] [CrossRef]
- Ning, C.; Gao, X.; Wang, C.; Huo, X.; Liu, Z.; Sun, H.; Yang, X.; Sun, P.; Ma, X.; Meng, Q.; et al. Hepatoprotective effect of ginsenoside rg1 from panax ginseng on carbon tetrachloride-induced acute liver injury by activating nrf2 signaling pathway in mice. Environ. Toxicol. 2018, 33, 1050–1060. [Google Scholar] [CrossRef]
- Lee, S.; Lee, M.S.; Kim, C.T.; Kim, I.H.; Kim, Y. Ginsenoside rg3 reduces lipid accumulation with amp-activated protein kinase (ampk) activation in hepg2 cells. Int. J. Mol. Sci. 2012, 13, 5729–5739. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Yi, Y.S.; Kim, M.Y.; Cho, J.Y. Role of ginsenosides, the main active components of panax ginseng, in inflammatory responses and diseases. J. Ginseng Res. 2017, 41, 435–443. [Google Scholar] [CrossRef] [PubMed]
- Hofseth, L.J.; Wargovich, M.J. Inflammation, cancer, and targets of ginseng. J. Nutr. 2007, 137, 183S–185S. [Google Scholar] [CrossRef] [PubMed]
- Glick, D.; Zhang, W.; Beaton, M.; Marsboom, G.; Gruber, M.; Simon, M.C.; Hart, J.; Dorn, G.W., 2nd; Brady, M.J.; Macleod, K.F. Bnip3 regulates mitochondrial function and lipid metabolism in the liver. Mol. Cell. Biol. 2012, 32, 2570–2584. [Google Scholar] [CrossRef] [PubMed]
- Rosen, E.D.; MacDougald, O.A. Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell Biol. 2006, 7, 885–896. [Google Scholar] [CrossRef] [PubMed]
- Ahmadian, M.; Suh, J.M.; Hah, N.; Liddle, C.; Atkins, A.R.; Downes, M.; Evans, R.M. Ppargamma signaling and metabolism: The good, the bad and the future. Nat. Med. 2013, 19, 557–566. [Google Scholar] [CrossRef] [PubMed]
- Greenberg, A.S.; Coleman, R.A.; Kraemer, F.B.; McManaman, J.L.; Obin, M.S.; Puri, V.; Yan, Q.W.; Miyoshi, H.; Mashek, D.G. The role of lipid droplets in metabolic disease in rodents and humans. J. Clin. Investig. 2011, 121, 2102–2110. [Google Scholar] [CrossRef]
- Rashid, H.O.; Yadav, R.K.; Kim, H.R.; Chae, H.J. Er stress: Autophagy induction, inhibition and selection. Autophagy 2015, 11, 1956–1977. [Google Scholar] [CrossRef]
- Gump, J.M.; Thorburn, A. Autophagy and apoptosis: What is the connection? Trends Cell Biol. 2011, 21, 387–392. [Google Scholar] [CrossRef]
- Gordy, C.; He, Y.W. The crosstalk between autophagy and apoptosis: Where does this lead? Protein Cell 2012, 3, 17–27. [Google Scholar] [CrossRef]
- Kurihara, Y.; Kanki, T.; Aoki, Y.; Hirota, Y.; Saigusa, T.; Uchiumi, T.; Kang, D. Mitophagy plays an essential role in reducing mitochondrial production of reactive oxygen species and mutation of mitochondrial DNA by maintaining mitochondrial quantity and quality in yeast. J. Biol. Chem. 2012, 287, 3265–3272. [Google Scholar] [CrossRef] [PubMed]
- Bin-Umer, M.A.; McLaughlin, J.E.; Butterly, M.S.; McCormick, S.; Tumer, N.E. Elimination of damaged mitochondria through mitophagy reduces mitochondrial oxidative stress and increases tolerance to trichothecenes. Proc. Natl. Acad. Sci. USA 2014, 111, 11798–11803. [Google Scholar] [CrossRef] [PubMed]
- Von Stockum, S.; Nardin, A.; Schrepfer, E.; Ziviani, E. Mitochondrial dynamics and mitophagy in parkinson’s disease: A fly point of view. Neurobiol. Dis. 2016, 90, 58–67. [Google Scholar] [CrossRef] [PubMed]









| LS-MS Condition | |
|---|---|
| Column | ACQUITY BEH C18 (50 mm x 2.1 mm, 1.7μm) |
| Flow rate | 0.6 mL/min |
| Injection volume | 2 μL |
| UV Absorbance | 203 nm |
| Column temperature | 40 ℃ |
| Component | Western Diet (g) | Sugar Solution (g/L) |
|---|---|---|
| Casein, Lactic, 30 Mesh | 195 | 0 |
| Methionine, DL | 3 | 0 |
| Sucrose, Fine Granulated | 350 | 0 |
| Lodex 10 | 100 | 0 |
| Starch, Corn | 50 | 0 |
| Solka Floc, FCC200 | 50 | 0 |
| Butter, Anhydrous | 200 | 0 |
| Corn Oil | 10 | 0 |
| S10001A | 17.5 | 0 |
| Calcium Phosphate, Dibasic | 4 | 0 |
| Choline Bitartrate | 2 | 0 |
| V10001C | 1 | 0 |
| Ethoxyquin | 0.04 | 0 |
| Cholesterol, NF | 1.5 | 0 |
| Sucrose | 0 | 23.1 |
| Glucose | 0 | 18.9 |
| Total | 1001.54 | 42 |
| Gene | Forward (5′ to 3′) | Reverse (5′ to 3′) |
|---|---|---|
| Acc | GGACAACACCTGTGTGGTAGAA | CGTGGGGATGTTCCCTCT |
| Fas | AGGTGCTAGAGGCCCTGCTA | GTGCACAGACACCTTCCCAT |
| Srebp-1c | GGAGCCATGGATTGCACATT | AGGAAGGCTTCCAGAGAGGA |
| Cpt-1 | CGGTTCAAGAATGGCATCATC | TCACACCCACCACCACGAT |
| Acox1 | CTCACTCGAAGCCAGCGTTA | TTGAGGCCAACAGGTTCCAC |
| CD36 | AATGAGACTGGGACCATCG | CTCCAACACCAAGTAAGACCAT |
| Acsl | ACCATCAGTGGTACCCGCTA | CGCTCACCACCTTCTGGTAT |
| Hmgcs2 | ATACCACCAACGCCTGTTATG | CAATGTCACCACAGACCACCA |
| Ccl2 | ATTGGGATCATCTTGCTGGT | CCTGCTGTTCACAGTTGCC |
| Ccl5 | ACTCCCTGCTGCTTTGCCTAC | TGTATTCTTGAACCCACTTCTTCTCTG |
| Tnf-α | AGGGTCTGGGCCATAGAACT | CCACCACGCTCTTCTGTCTA |
| Il-1β | CTCGCAGCAGCACATCAACAAG | CCACGGGAAAGACACAGGTAGC |
| Il-6 | ACAAAGCCAGAGTCCTTCAGAGAG | TTGGATGGTCTTGGTCCTTAGCC |
| CD163 | TCCACACGTCCAGAACAGTC | CCTTGGAAACAGAGACAGGC |
| Il-10 | GCTGGACAACATACTGCTAACCG | TCCGATAAGGCTTGGCAACCC |
| iNos | GCACCACCCTCCTCGTTCAG | TCCACAACTCGCTCCAAGATTCC |
| β-actin | CATCCGTAAAGACCTCTATGCCAAC | ATGGAGCCACCGATCCACA |
| Sample | Rg1 | Re | Rf | Rg2s | Rb1 | Rc | Rb2 | Rd | Rg3s | Rg3r | Rk1 |
|---|---|---|---|---|---|---|---|---|---|---|---|
| RG | 2.38 ± 0.14 | 3.13 ± 0.37 | 0.93 ± 0.05 | 1.12 ± 0.55 | 6.06 ± 0.21 | 2.49 ± 0.03 | 1.69 ± 0.13 | 1.06 ± 0.01 | 1.50 ± 0.80 | 0.79 ± 0.45 | 0.62 ± 0.08 |
| CRG | 1.05 ± 0.44 | 1.63 ± 0.74 | 1.32 ± 0.09 * | 2.31 ± 0.35 | 6.82 ± 0.54 | 2.98 ± 0.44 | 2.07 ± 0.33 | 2.23 ± 0.28 * | 3.50 ± 0.29 * | 2.04 ± 0.33 * | 1.36 ± 0.14 * |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, S.-Y.; Park, J.-S.; Shon, C.-H.; Lee, C.-Y.; Ryu, J.-M.; Son, D.-J.; Hwang, B.-Y.; Yoo, H.-S.; Cho, Y.-C.; Lee, J.; et al. Fermented Korean Red Ginseng Extract Enriched in Rd and Rg3 Protects against Non-Alcoholic Fatty Liver Disease through Regulation of mTORC1. Nutrients 2019, 11, 2963. https://doi.org/10.3390/nu11122963
Choi S-Y, Park J-S, Shon C-H, Lee C-Y, Ryu J-M, Son D-J, Hwang B-Y, Yoo H-S, Cho Y-C, Lee J, et al. Fermented Korean Red Ginseng Extract Enriched in Rd and Rg3 Protects against Non-Alcoholic Fatty Liver Disease through Regulation of mTORC1. Nutrients. 2019; 11(12):2963. https://doi.org/10.3390/nu11122963
Chicago/Turabian StyleChoi, Su-Yeon, Jeong-Su Park, Chang-Ho Shon, Chae-Young Lee, Jae-Myun Ryu, Dong-Ju Son, Bang-Yeon Hwang, Hwan-Soo Yoo, Young-Chang Cho, Jin Lee, and et al. 2019. "Fermented Korean Red Ginseng Extract Enriched in Rd and Rg3 Protects against Non-Alcoholic Fatty Liver Disease through Regulation of mTORC1" Nutrients 11, no. 12: 2963. https://doi.org/10.3390/nu11122963
APA StyleChoi, S.-Y., Park, J.-S., Shon, C.-H., Lee, C.-Y., Ryu, J.-M., Son, D.-J., Hwang, B.-Y., Yoo, H.-S., Cho, Y.-C., Lee, J., Kim, J.-W., & Roh, Y.-S. (2019). Fermented Korean Red Ginseng Extract Enriched in Rd and Rg3 Protects against Non-Alcoholic Fatty Liver Disease through Regulation of mTORC1. Nutrients, 11(12), 2963. https://doi.org/10.3390/nu11122963

