Zinc Protects Articular Chondrocytes through Changes in Nrf2-Mediated Antioxidants, Cytokines and Matrix Metalloproteinases
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Antibodies
2.2. Cell Culture
2.3. Cell Viability Assay
2.4. Effects of GSH, SOD, and PI3K Inhibitors on Cell Viability
2.5. Measurement of ROS
2.6. Measurement of GSH
2.7. Western Blot Analysis
2.8. Quantitative Real-Time PCR Analysis (qPCR)
2.9. Animals and Treatments
2.10. Histopathology of Joint Tissues: Safranin O and Fast Green Staining
2.11. Serum Biomarkers Measurements
2.12. Statistical Analysis
3. Results
3.1. Cell Viability
3.2. Oxidative Stress and Antioxidants
3.3. Expression of Cytokines and MMPs
3.4. Expression of Phosphorylated-Akt and Nrf2 Expression
3.5. MIA-Induced OA Progression in Rats, with/without Zinc Supplementation
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
OA | Osteoarthritis |
Zn | Zinc |
MIA | Monosodium iodoacetate |
p-Akt | Phosphorylated-Akt |
ECM | Extracellular matrix |
IL | Interleukin |
MMP | Matrix metalloproteinase |
ROS | Reactive oxygen species |
Nrf2 | Nuclear factor erythroid 2-related factor |
SOD | Superoxide dismutase |
GPx | Glutathione peroxidase |
GSH | Glutathione |
GCLC | Glutamate-cysteine ligase catalytic subunit |
GCLM | Glutamate-cysteine ligase modifier subunit |
HO-1 | Heme oxygenase-1 |
BSO | Buthionine sulfoximine |
DETC | Diethyldithiocarbamate |
PI3K | Phosphoinositide 3-kinase |
OARSI | Osteoarthritis Research Society International |
References
- Robinson, W.H.; Lepus, C.M.; Wang, Q.; Raghu, H.; Mao, R.; Lindstrom, T.M.; Sokolove, J. Low-grade inflammation as a key mediator of the pathogenesis of osteoarthritis. Nat. Rev. Rheumatol. 2016, 12, 580–592. [Google Scholar] [CrossRef] [PubMed]
- Tetlow, L.C.; Adlam, D.J.; Woolley, D.E. Matrix metalloproteinase and proinflammatory cytokine production by chondrocytes of human osteoarthritic cartilage: Associations with degenerative changes. Arthritis Rheum. 2001, 44, 585–594. [Google Scholar] [CrossRef]
- Kobayashi, M.; Squires, G.R.; Mousa, A.; Tanzer, M.; Zukor, D.J.; Antoniou, J.; Feige, U.; Poole, A.R. Role of interleukin-1 and tumor necrosis factor alpha in matrix degradation of human osteoarthritic cartilage. Arthritis Rheum. 2005, 52, 128–135. [Google Scholar] [CrossRef] [PubMed]
- Loeser, R.F. Aging and osteoarthritis: The role of chondrocyte senescence and aging changes in the cartilage matrix. Osteoarthr. Cartel. 2009, 17, 971–979. [Google Scholar] [CrossRef] [PubMed]
- Carlo, M.D., Jr.; Loeser, R.F. Increased oxidative stress with aging reduces chondrocyte survival: Correlation with intracellular glutathione levels. Arthritis Rheum. 2003, 48, 3419–3430. [Google Scholar] [CrossRef] [PubMed]
- Jallali, N.; Ridha, H.; Thrasivoulou, C.; Underwood, C.; Butler, P.E.; Cowen, T. Vulnerability to ros-induced cell death in ageing articular cartilage: The role of antioxidant enzyme activity. Osteoarthr. Cartil. 2005, 13, 614–622. [Google Scholar] [CrossRef] [PubMed]
- Jaramillo, M.C.; Zhang, D.D. The emerging role of the Nrf2-Keap1 signaling pathway in cancer. Genes Dev. 2013, 27, 2179–2191. [Google Scholar] [CrossRef] [PubMed]
- Ma, Q. Role of Nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 401–426. [Google Scholar] [CrossRef] [PubMed]
- Cai, D.; Yin, S.; Yang, J.; Jiang, Q.; Cao, W. Histone deacetylase inhibition activates Nrf2 and protects against osteoarthritis. Arthritis Res. Ther. 2015, 17, 269. [Google Scholar] [CrossRef] [PubMed]
- Davidson, R.K.; Jupp, O.; de Ferrars, R.; Kay, C.D.; Culley, K.L.; Norton, R.; Driscoll, C.; Vincent, T.L.; Donell, S.T.; Bao, Y.; et al. Sulforaphane represses matrix-degrading proteases and protects cartilage from destruction in vitro and in vivo. Arthritis Rheum. 2013, 65, 3130–3140. [Google Scholar] [CrossRef] [PubMed]
- Plum, L.M.; Rink, L.; Haase, H. The essential toxin: Impact of zinc on human health. Int. J. Environ. Res. Public Health 2010, 7, 1342–1365. [Google Scholar] [CrossRef] [PubMed]
- Stefanidou, M.; Maravelias, C.; Dona, A.; Spiliopoulou, C. Zinc: A multipurpose trace element. Arch. Toxicol. 2006, 80, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Prasad, A.S. Zinc is an antioxidant and anti-inflammatory agent: Its role in human health. Front. Nutr. 2014, 1, 14. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, J.P.; Rosselot, G. Effects of zinc on cell proliferation and proteoglycan characteristics of epiphyseal chondrocytes. J. Cell. Biochem. 2001, 82, 501–511. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Fosmire, G.J.; Gay, C.V.; Leach, R.M., Jr. Short-term zinc deficiency inhibits chondrocyte proliferation and induces cell apoptosis in the epiphyseal growth plate of young chickens. J. Nutr. 2002, 132, 665–673. [Google Scholar] [CrossRef] [PubMed]
- Zago, M.P.; Oteiza, P.I. The antioxidant properties of zinc: Interactions with iron and antioxidants. Free Radic. Biol. Med. 2001, 31, 266–274. [Google Scholar] [CrossRef]
- Guzman, R.E.; Evans, M.G.; Bove, S.; Morenko, B.; Kilgore, K. Mono-iodoacetate-induced histologic changes in subchondral bone and articular cartilage of rat femorotibial joints: An animal model of osteoarthritis. Toxicol. Pathol. 2003, 31, 619–624. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, B.S.; Huang, L.W.; Su, S.J.; Cheng, H.L.; Hu, Y.C.; Hung, T.C.; Chang, K.L. Combined arginine and ascorbic acid treatment induces apoptosis in the hepatoma cell line HA22T/VGH and changes in redox status involving the pentose phosphate pathway and reactive oxygen and nitrogen species. J. Nutr. Biochem. 2011, 22, 234–241. [Google Scholar] [CrossRef] [PubMed]
- Hung, T.C.; Huang, L.W.; Su, S.J.; Hsieh, B.S.; Cheng, H.L.; Hu, Y.C.; Chen, Y.H.; Hwang, C.C.; Chang, K.L. Hemeoxygenase-1 expression in response to arecoline-induced oxidative stress in human umbilical vein endothelial cells. Int. J. Cardiol. 2011, 151, 187–194. [Google Scholar] [CrossRef] [PubMed]
- Cheng, H.L.; Su, S.J.; Huang, L.W.; Hsieh, B.S.; Hu, Y.C.; Hung, T.C.; Chang, K.L. Arecoline induces HA22T/VGH hepatoma cells to undergo anoikis-involvement of STAT3 and RhoA activation. Mol. Cancer 2010, 9, 126. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Nair, A.B.; Jacob, S. A simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 2016, 7, 27–31. [Google Scholar] [CrossRef] [PubMed]
- Chiu, P.R.; Hu, Y.C.; Huang, T.C.; Hsieh, B.S.; Yeh, J.P.; Cheng, H.L.; Huang, L.W.; Chang, K.L. Vitamin C protects chondrocytes against monosodium iodoacetate-induced osteoarthritis by multiple pathways. Int. J. Mol. Sci. 2016, 18, 38. [Google Scholar] [CrossRef] [PubMed]
- Gerwin, N.; Bendele, A.M.; Glasson, S.; Carlson, C.S. The oarsi histopathology initiative—Recommendations for histological assessments of osteoarthritis in the rat. Osteoarthr. Cartil. 2010, 18 (Suppl. 3), S24–S34. [Google Scholar] [CrossRef] [PubMed]
- Fernandez, P.; Guillen, M.I.; Gomar, F.; Alcaraz, M.J. Expression of heme oxygenase-1 and regulation by cytokines in human osteoarthritic chondrocytes. Biochem. Pharmacol. 2003, 66, 2049–2052. [Google Scholar] [CrossRef]
- Wojdasiewicz, P.; Poniatowski, L.A.; Szukiewicz, D. The role of inflammatory and anti-inflammatory cytokines in the pathogenesis of osteoarthritis. Mediat. Inflamm. 2014, 2014, 561459. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Lou, S. Direct protective effect of interleukin-10 on articular chondrocytes in vitro. Chin. Med. J. (Engl.) 2001, 114, 723–725. [Google Scholar] [PubMed]
- Radons, J.; Falk, W.; Schubert, T.E. Interleukin-10 does not affect IL-1-induced interleukin-6 and metalloproteinase production in human chondrosarcoma cells, SW1353. Int. J. Mol. Med. 2006, 17, 377–383. [Google Scholar] [CrossRef] [PubMed]
- Itoh, K.; Ishii, T.; Wakabayashi, N.; Yamamoto, M. Regulatory mechanisms of cellular response to oxidative stress. Free Radic. Res. 1999, 31, 319–324. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.S.; Surh, Y.J. Nrf2 as a novel molecular target for chemoprevention. Cancer Lett. 2005, 224, 171–184. [Google Scholar] [CrossRef] [PubMed]
- Gambhir, J.K.; Lali, P.; Jain, A.K. Correlation between blood antioxidant levels and lipid peroxidation in rheumatoid arthritis. Clin. Biochem. 1997, 30, 351–355. [Google Scholar] [CrossRef]
- Weydert, C.J.; Cullen, J.J. Measurement of superoxide dismutase, catalase and glutathione peroxidase in cultured cells and tissue. Nat. Protoc. 2010, 5, 51–66. [Google Scholar] [CrossRef] [PubMed]
- Kikuchi, G.; Yoshida, T.; Noguchi, M. Heme oxygenase and heme degradation. Biochem. Biophys. Res. Commun. 2005, 338, 558–567. [Google Scholar] [CrossRef] [PubMed]
- Kloubert, V.; Rink, L. Zinc as a micronutrient and its preventive role of oxidative damage in cells. Food Funct. 2015, 6, 3195–3204. [Google Scholar] [CrossRef] [PubMed]
- Maares, M.; Haase, H. Zinc and immunity: An essential interrelation. Arch. Biochem. Biophys. 2016, 611, 58–65. [Google Scholar] [CrossRef] [PubMed]
- Maywald, M.; Wessels, I.; Rink, L. Zinc signals and immunity. Int. J. Mol. Sci. 2017, 18, 2222. [Google Scholar] [CrossRef] [PubMed]
- Maret, W. Zinc in cellular regulation: The nature and significance of “zinc signals”. Int. J. Mol. Sci. 2017, 18, 2285. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Li, L.; Geng, C.; Gong, D.; Jiang, L.; Ishikawa, N.; Kajima, K.; Zhong, L. Monosodium iodoacetate induces apoptosis via the mitochondrial pathway involving ROS production and caspase activation in rat chondrocytes in vitro. J. Orthop. Res. 2013, 31, 364–369. [Google Scholar] [CrossRef] [PubMed]
- Surapaneni, K.M.; Venkataramana, G. Status of lipid peroxidation, glutathione, ascorbic acid, vitamin e and antioxidant enzymes in patients with osteoarthritis. Indian J. Med. Sci. 2007, 61, 9–14. [Google Scholar] [CrossRef] [PubMed]
- Regan, E.A.; Bowler, R.P.; Crapo, J.D. Joint fluid antioxidants are decreased in osteoarthritic joints compared to joints with macroscopically intact cartilage and subacute injury. Osteoarthr. Cartil. 2008, 16, 515–521. [Google Scholar] [CrossRef] [PubMed]
- Yasuhara, R.; Miyamoto, Y.; Akaike, T.; Akuta, T.; Nakamura, M.; Takami, M.; Morimura, N.; Yasu, K.; Kamijo, R. Interleukin-1beta induces death in chondrocyte-like ATDC5 cells through mitochondrial dysfunction and energy depletion in a reactive nitrogen and oxygen species-dependent manner. Biochem. J. 2005, 389, 315–323. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Romero, C.; Lopez-Armada, M.J.; Blanco, F.J. Mitochondrial proteomic characterization of human normal articular chondrocytes. Osteoarthr. Cartil. 2006, 14, 507–518. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Romero, C.; Calamia, V.; Mateos, J.; Carreira, V.; Martinez-Gomariz, M.; Fernandez, M.; Blanco, F.J. Mitochondrial dysregulation of osteoarthritic human articular chondrocytes analyzed by proteomics: A decrease in mitochondrial superoxide dismutase points to a redox imbalance. Mol. Cell. Proteom. 2009, 8, 172–189. [Google Scholar] [CrossRef] [PubMed]
- Aigner, T.; Fundel, K.; Saas, J.; Gebhard, P.M.; Haag, J.; Weiss, T.; Zien, A.; Obermayr, F.; Zimmer, R.; Bartnik, E. Large-scale gene expression profiling reveals major pathogenetic pathways of cartilage degeneration in osteoarthritis. Arthritis Rheum. 2006, 54, 3533–3544. [Google Scholar] [CrossRef] [PubMed]
- Espinosa-Diez, C.; Miguel, V.; Mennerich, D.; Kietzmann, T.; Sanchez-Perez, P.; Cadenas, S.; Lamas, S. Antioxidant responses and cellular adjustments to oxidative stress. Redox Biol. 2015, 6, 183–197. [Google Scholar] [CrossRef] [PubMed]
- Kensler, T.W.; Wakabayashi, N.; Biswal, S. Cell survival responses to environmental stresses via the keap1-Nrf2-are pathway. Annu. Rev. Pharmacol. Toxicol. 2007, 47, 89–116. [Google Scholar] [CrossRef] [PubMed]
- Qiao, Y.-Q.; Jiang, P.-F.; Gao, Y.-Z. Lutein prevents osteoarthritis through Nrf2 activation and downregulation of inflammation. Arch. Med. Sci. 2016, 12. [Google Scholar] [CrossRef]
- Yin, W.; Park, J.I.; Loeser, R.F. Oxidative stress inhibits insulin-like growth factor-I induction of chondrocyte proteoglycan synthesis through differential regulation of phosphatidylinositol 3-kinase-akt and mek-erk mapk signaling pathways. J. Biol. Chem. 2009, 284, 31972–31981. [Google Scholar] [CrossRef] [PubMed]
- Beier, F.; Loeser, R.F. Biology and pathology of rho gtpase, pi-3 kinase-akt, and map kinase signaling pathways in chondrocytes. J. Cell. Biochem. 2010, 110, 573–580. [Google Scholar] [CrossRef] [PubMed]
- Takada, T.; Miyaki, S.; Ishitobi, H.; Hirai, Y.; Nakasa, T.; Igarashi, K.; Lotz, M.K.; Ochi, M. Bach1 deficiency reduces severity of osteoarthritis through upregulation of heme oxygenase-1. Arthritis Res. Ther. 2015, 17, 285. [Google Scholar] [CrossRef] [PubMed]
- Clerigues, V.; Murphy, C.L.; Guillen, M.I.; Alcaraz, M.J. Haem oxygenase-1 induction reverses the actions of interleukin-1beta on hypoxia-inducible transcription factors and human chondrocyte metabolism in hypoxia. Clin. Sci. (Lond.) 2013, 125, 99–108. [Google Scholar] [CrossRef] [PubMed]
Primer Name | NCBI Reference Sequence | Primer Sequence (5′ → 3′) |
---|---|---|
RPS18 | NM_022551.2 | F: GAGGATGAGGTGGAACGTGT |
R: TCTTCAGTCGCTCCAGGTCT | ||
GCLC | NM_001498 | F: GAGGTCAAACCCAACCCAGT |
R: AAGGTACTGAAGCGAGGGTG | ||
GCLM | XM_005270754.3 | F: CTTGGAGCATTTACAGCCTTAC |
R: GGTGGCATCACACAGCAG | ||
IL-10 | NM_000572.2 | F: GGCTTCCTAACTGCTACAAATAC |
R: AATCCCTCCGAGACACTGG | ||
IL-1β | NM_000576.2 | F: TGATGGCTTATTACAGTGGCAATG |
R: GTAGTGGTGGTCGGAGATTCG |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, T.-C.; Chang, W.-T.; Hu, Y.-C.; Hsieh, B.-S.; Cheng, H.-L.; Yen, J.-H.; Chiu, P.-R.; Chang, K.-L. Zinc Protects Articular Chondrocytes through Changes in Nrf2-Mediated Antioxidants, Cytokines and Matrix Metalloproteinases. Nutrients 2018, 10, 471. https://doi.org/10.3390/nu10040471
Huang T-C, Chang W-T, Hu Y-C, Hsieh B-S, Cheng H-L, Yen J-H, Chiu P-R, Chang K-L. Zinc Protects Articular Chondrocytes through Changes in Nrf2-Mediated Antioxidants, Cytokines and Matrix Metalloproteinases. Nutrients. 2018; 10(4):471. https://doi.org/10.3390/nu10040471
Chicago/Turabian StyleHuang, Tzu-Ching, Wen-Tsan Chang, Yu-Chen Hu, Bau-Shan Hsieh, Hsiao-Ling Cheng, Jeng-Hsien Yen, Pu-Rong Chiu, and Kee-Lung Chang. 2018. "Zinc Protects Articular Chondrocytes through Changes in Nrf2-Mediated Antioxidants, Cytokines and Matrix Metalloproteinases" Nutrients 10, no. 4: 471. https://doi.org/10.3390/nu10040471