Immune Responses of Rhynchophorus ferrugineus to a New Strain of Beauveria bassiana
Abstract
:1. Introduction
2. Materials and Methods
2.1. Entomopathogenic Fungus
2.2. Identification of the Isolated Fungi
2.3. Virulence of B. bassiana on Rhynchophorus ferrugineus Larvae
2.4. Measurement of Enzyme Activities in R. ferrugineus Larvae
2.5. Quantitative Real-Time PCR
2.6. Statistical Analysis
3. Results
3.1. Identification of Fungal Isolate
3.2. Virulence of B. bassiana against R. ferrugineus
3.3. Effect of B. bassiana on the Mortality of R. ferrugineus Larvae
3.4. Effect of B. bassiana on Enzyme Activities in R. ferrugineus Larvae
3.5. The Expression of Detoxification Genes of Red Palm Weevils
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhang, X.N.; Jin, D.C.; Zou, X.; Guo, J.J. Laboratory and field evaluation of an entomopathogenic fungus, Isaria cateniannulata strain 08XS-1, against Tetranychus urticae (Koch). Pest Manag. Sci. 2016, 72, 1059–1066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghaffari, S.; Karimi, J.; Kamali, S.; Moghadam, E.M. Biocontrol of Planococcus citri (Hemiptera: Pseudococcidae) by Lecanicillium longisporum and Lecanicillium lecanii under laboratory and greenhouse conditions. J. Asia-Pac. Entomol. 2017, 20, 605–612. [Google Scholar] [CrossRef]
- Wasuwan, R.; Phosrithong, N.; Promdonkoy, B.; Sangsrakru, D.; Sonthirod, C.; Tangphatsornruang, S.; Likhitrattanapisal, S.; Ingsriswang, S.; Srisuksam, C.; Klamchao, K.; et al. The fungus Metarhizium sp. BCC 4849 is an effective and safe mycoinsecticide for the management of spider mites and other insect pests. Insects 2021, 13, 42. [Google Scholar] [CrossRef] [PubMed]
- Zemek, R.; Konopická, J.; Jozová, E.; Skoková, H.O. Virulence of Beauveria bassiana strains isolated from cadavers of Colorado potato beetle, Leptinotarsa decemlineata. Insects 2021, 12, 1077. [Google Scholar] [CrossRef] [PubMed]
- Clifton, E.H.; Hajek, A.E.; Jenkins, N.E.; Roush, R.T.; Rost, J.P.; Biddinger, D.J. Applications of Beauveria bassiana (Hypocreales: Cordycipitaceae) to control populations of spotted lanternfly (Hemiptera: Fulgoridae), in semi-natural landscapes and on grape-vines. Environ. Entomol. 2020, 49, 854–864. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.H.; Liu, S.; Wang, S.Y.; Lei, Z.R. Research and development of wettable powder of Beauveria bassiana and its control and application to Frankliniella occidentalis. Chin. J. Biol. Control 2020, 36, 858–861. (In Chinese) [Google Scholar] [CrossRef]
- Sullivan, C.F.; Parker, B.L.; Skinner, M. A Review of commercial Metarhizium- and Beauveria-based biopesticides for the biological control of ticks in the USA. Insects 2022, 13, 260. [Google Scholar] [CrossRef]
- Ma, X.M.; Liu, X.X.; Ning, X.; Zhang, B.; Han, F.; Guan, X.M.; Tan, Y.F.; Zhang, Q.W. Effects of Bacillus thuringiensis toxin Cry1Ac and Beauveria bassiana on Asiatic corn borer (Lepidoptera: Crambidae). J. Invertebr. Pathol. 2008, 99, 123–128. [Google Scholar] [CrossRef]
- Reddy, G.V.P.; Zhao, Z.H.; Humber, R.A. Laboratory and field efficacy of entomopathogenic fungi for the management of the sweetpotato weevil, Cylas formicarius (Coleoptera: Brentidae). J. Invertebr. Pathol. 2014, 122, 10–15. [Google Scholar] [CrossRef] [Green Version]
- Zafar, J.; Freed, S.; Khan, B.A.; Farooq, M. Effectiveness of Beauveria bassiana against cotton whitefly, Bemisia tabaci (Gennadius) (Aleyrodidae: Homoptera) on different host plants. Pak. J. Zool. 2016, 48, 91–99. [Google Scholar]
- Fargues, J.; Remaudiere, G. Considerations on the specificity of entomopathogenic fungi. Mycopathologia 1977, 62, 31–37. [Google Scholar] [CrossRef]
- Cao, W.P.; Song, J.; Zhen, W.; Wang, J.Y.; Feng, S.L.; Du, L.X. Correlation between biological characteristics of Beauveria bassiana and its cuticle infection on different insects. Chin. J. Biol. Control 2013, 29, 503–508. (In Chinese) [Google Scholar]
- Liu, J.; Ling, Z.Q.; Wang, J.J.; Xiang, T.T.; Xu, L.; Gu, C.X.; Liu, R.; Xu, J.; Xu, C.L.; Zhou, W.; et al. In vitro transcriptomes analysis identifies some special genes involved in pathogenicity difference of the Beauveria bassiana against different insect hosts. Microb. Pathog. 2021, 154, 104824. [Google Scholar] [CrossRef] [PubMed]
- Mazet, I.; Boucias, D.G. Effects of the fungal pathogen, Beauveria bassiana on protein biosynthesis of infected Spodoptera exigua larvae. J. Insect Physiol. 1996, 42, 91–99. [Google Scholar] [CrossRef]
- Qin, G.H.; Jia, M.; Liu, T.; Xuan, T.; Zhu, K.Y.; Guo, Y.P.; Ma, E.B.; Zhang, J.Z. Identification and characterisation of ten glutathione S-transferase genes from oriental migratory locust, Locusta migratoria manilensis (Meyen). Pest Manag. Sci. 2011, 67, 697–704. [Google Scholar] [CrossRef]
- Newcomb, R.D.; Campbell, P.M.; Ollis, D.L.; Cheah, E.; Russell, R.J.; Oakeshott, J.G. A single amino acid substitution converts a carboxylesterase to an organophosphorus hydrolase and confers insecticide resistance on a blowfly. In Proceedings of the National Academy of Sciences of the United States of America, Washington, DC, USA, 4 March 1997; Volume 94, pp. 7464–7468. [Google Scholar]
- Cheng, T.C.; Wu, J.Q.; Wu, Y.Q.; Chilukuri, R.V.; Huang, L.H.; Yamamoto, K.; Feng, L.; Li, W.S.; Chen, Z.W.; Guo, H.Z.; et al. Genomic adaptation to polyphagy and insecticides in a major East Asian noctuid pest. Nat. Ecol. Evol. 2017, 1, 1747–1756. [Google Scholar] [CrossRef] [Green Version]
- Gillespie, J.P.; Bailey, A.M.; Cobb, B.; Vilcinskas, A. Fungi as elicitors of insect immune responses. Insect Biochem. Physiol. 2000, 44, 49–68. [Google Scholar] [CrossRef]
- Ding, J.N.; Zhang, H.H.; Chi, D.F. Effects of a pathogenic Beauveria bassiana (Hypocreales: Cordycipitaceae) strain on detoxifying and protective enzyme activities in Xylotrechus rusticus (Coleoptera: Cerambycidae) larvae. Fla. Entomol. 2015, 98, 1148–1156. [Google Scholar] [CrossRef] [Green Version]
- Dubovskiy, I.M.; Martemyanov, V.V.; Vorontsova, Y.L.; Rantala, M.J.; Gryzanova, E.V.; Glupov, V.V. Effect of bacterial infection on antioxidant activity and lipid peroxidation in the midgut of Galleria mellonella L. larvae (Lepidoptera, Pyralidae). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2008, 148, 1–5. [Google Scholar] [CrossRef]
- Turrens, J.F. Mitochondrial formation of reactive oxygen species. J. Physiol. 2003, 552, 335–344. [Google Scholar] [CrossRef]
- Ki, Y.W.; Lee, J.E.; Park, J.H.; Shin, I.C.; Koh, H.C. Reactive oxygen species and mitogen-activated protein kinase induce apoptotic death of SH-SY5Y cells in response to fipronil. Toxicol. Lett. 2012, 211, 18–28. [Google Scholar] [CrossRef]
- Li, P.W.; Fu, X.L.; Chen, S.C.; Hu, X.; Wang, X.Q.; Peng, P. Effect of temperature stress on four protective enzymes and overall antioxidant capacity in Darna trima (Moore). Chinese. J. Appl. Entomol. 2016, 53, 809–816. (In Chinese) [Google Scholar]
- Jayanthi, P.D.K.; Arthikirubha, A.; Vivek, K.; Ravindra, M.A.; Selvakumar, G.; Abraham, V. Aspergillus flavus impairs antioxidative enzymes of Sternochetus mangiferae during mycosis. J. Invertebr. Pathol. 2015, 124, 73–77. [Google Scholar] [CrossRef] [PubMed]
- Li, G.N.; Shi, M.; Zhao, S.; Long, Y.H.; Zhu, Y. Toxicity response of silkworm intestine to Bacillus cereus SW7-1 pathogen. Sci. Total Environ. 2019, 692, 1282–1290. [Google Scholar] [CrossRef] [PubMed]
- Pedrini, N. Molecular interactions between entomopathogenic fungi (Hypocreales) and their insect host: Perspectives from stressful cuticle and hemolymph battlefields and the potential of dual RNA sequencing for future studies (Review). Fungal. Biol. 2018, 122, 538–545. [Google Scholar] [CrossRef] [PubMed]
- Pedrini, N.; Crespo, R.; Juárez, M.P. Biochemistry of insect epicuticle degradation by entomopathogenic fungi. Comp. Biochem. Physiol. C Toxicol. Pharmacol 2007, 146, 124–137. [Google Scholar] [CrossRef]
- Butt, T.M.; Coates, C.J.; Dubovskiy, I.M.; Ratcliffe, N.A. Entomopathogenic fungi: New insights into host-pathogen interactions. Adv. Genet. 2016, 94, 307–364. [Google Scholar]
- Zhang, L.; Fasoyin, O.E.; Molnár, I.; Xu, Y. Secondary metabolites from hypocrealean entomopathogenic fungi: Novel bioactive compounds. Nat. Prod. Rep. 2020, 37, 1181–1206. [Google Scholar] [CrossRef]
- Altimira, F.; Arias-Aravena, M.; Jian, L.; Real, N.; Correa, P.; González, C.; Godoy, S.; Castro, J.F.; Zamora, O.; Vergara, C.; et al. Genomic and experimental analysis of the insecticidal factors secreted by the entomopathogenic fungus Beauveria pseudobassiana RGM 2184. J. Fungi 2022, 8, 253. [Google Scholar] [CrossRef]
- Lu, H.-L.; St Leger, R.J. Insect Immunity to Entomopathogenic Fungi. Adv. Genet. 2016, 94, 251–285. [Google Scholar] [CrossRef]
- Mondal, S.; Baksi, S. Strain-specific identification of Beauveria bassiana isolated from a novel habitat, using rDNA-based sequence analogy. Egypt J. Biol. Pest Control 2018, 28, 29. [Google Scholar] [CrossRef]
- Fernandes, E.K.K.; Keyser, C.A.; Rangel, D.E.N.; Foster, R.N.; Roberts, D.W. CTC medium: A novel dodine-free selective medium for isolating entomopathogenic fungi, especially Metarhizium acridum, from soil. Biol. Control 2010, 54, 197–205. [Google Scholar] [CrossRef]
- Park, J.; Kim, G.; Park, H.; Nam, B.; An, W.; Cha, J.; Lee, T.H.; Lee, J. Phylogenetic analysis of caterpillar fungi by comparing ITS 1-5.8S-ITS 2 ribosomal DNA sequences. Mycobiology 2001, 29, 121–131. [Google Scholar] [CrossRef] [Green Version]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef]
- Ahmed, F.A.G.; El-Sobki, A.E.A.M. Biochemical and histological responses of red palm weevil, Rhynchophorus ferrugineus exposed to sub-lethal levels of different insecticide classes. Egypt. Acad. J. Biolog. Sci. 2021, 13, 293–308. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Hussain, A.; Rizwan-ul-Haq, M.; Al-Jabr, A.M.; Al-Ayied, H.Y. Managing invasive populations of red palm weevil: A worldwide perspective. J. Food Agric. Environ. 2013, 11, 456–463. [Google Scholar]
- Abdallah, O.I.; Alamer, S.S.; Alrasheed, A.M. Monitoring pesticide residues in dates marketed in Al-Qassim, Saudi Arabia using a QuEChERS methodology and Liquid Chromatography-Tandem Mass Spectrometry. Biomed. Chromatogr. 2018, 32, e4199. [Google Scholar] [CrossRef]
- Mahmood, I.; Imadi, S.R.; Shazadi, K.; Gul, A.; Hakeem, K.R. Effects of Pesticides on Environment. In Plant, Soil and Microbes; Springer International Publishing: Cham, Switzerland, 2016; pp. 253–269. [Google Scholar]
- Al-Ayedh, H.; Hussain, A.; Rizwan-ul-Haq, M.; Al-Jabr, A.M. Status of insecticide resistance in field-collected populations of Rhynchophorus ferrugineus (Olivier) (Coleoptera: Curculionidae). Int. J. Agric. Biol. 2016, 18, 103–110. [Google Scholar] [CrossRef]
- Kohler, H.-R.; Triebskorn, R. Wildlife ecotoxicology of pesticides: Can we track effects to the population level and beyond? Science 2013, 341, 759–765. [Google Scholar] [CrossRef] [Green Version]
- Imoulan, A.; Wu, H.J.; Lu, W.L.; Li, Y.; Li, B.B.; Yang, R.H.; Wang, W.J.; Wang, X.L.; Kirk, P.M.; Yao, Y.J. Beauveria majiangensis sp. nov., a new fungus of the entomopathogenic genus from China. J. Invertebr. Pathol. 2016, 139, 74–81. [Google Scholar] [CrossRef] [PubMed]
- Khonsanit, A.; Luangsa-ard, J.J.; Thanakitpipattana, D.; Noisripoom, W.; Chaitika, T.; Kobmoo, N. Cryptic diversity of the genus Beauveria with a new species from Thailand. Mycol. Prog. 2020, 19, 291–315. [Google Scholar] [CrossRef]
- Rehner, S.A.; Minnis, A.M.; Sung, G.H.; Luangsa-ard, J.J.; Devotto, L.; Humber, R.A. Phylogeny and systematics of the anamorphic, entomopathogenic genus Beauveria. Mycologia 2011, 103, 1055–1073. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.-L.; He, L.-M.; Chen, X.; Huang, B. Beauveria lii sp. nov. isolated from Henosepilachna vigintioctopunctata. Mycotaxon 2012, 121, 199–206. [Google Scholar] [CrossRef]
- El Husseini, M.M.M. Effect of the fungus, Beauveria bassiana (Balsamo) Vuillemin, on the beet armyworm, Spodoptera exigua (Hübner) larvae (Lepidoptera: Noctuidae), under laboratory and open field conditions. Egypt. J. Biol. Pest Control 2019, 29, 52. [Google Scholar] [CrossRef]
- Omar, G.; Ibrahim, A.; Hamadah, K. Virulence of Beauveria bassiana and Metarhizium anisopliae on different stages of the pink bollworm, Pectinophora gossypiella (Saunders) (Lepidoptera: Gelechiidae). Egypt. J. Biol. Pest Control 2021, 31, 102. [Google Scholar] [CrossRef]
- Schulte, M.J.; Martin, K.; Büchse, A.; Sauerborn, J. Entomopathogens (Beauveria bassiana and Steinernema carpocapsae) for biological control of bark-feeding moth Indarbela dea on field-infested litchi trees. Pest Management Science 2009, 65, 105–112. [Google Scholar] [CrossRef]
- Wilson, K.; Cotter, S.C.; Reeson, A.F.; Pell, J.K. Melanism and disease resistance in insects. Ecol. Lett. 2011, 4, 637–649. [Google Scholar] [CrossRef] [Green Version]
- Mannino, M.C.; Huarte-Bonnet, C.; Davyt-Colo, B.; Pedrini, N. Is the insect cuticle the only entry gate for fungal infection? insights into alternative modes of action of entomopathogenic fungi. J. Fungi 2019, 5, 33. [Google Scholar] [CrossRef] [Green Version]
- Lü, L.H.; He, Y.R.; Wu, Y.J.; Feng, X.; Chen, H.Y. The time-dose-mortality model of a Paecilomyces fumosoroseus isolate on the diamondback moth, Plutella xylostella. Acta Entomol. Sin. 2007, 50, 567–573. [Google Scholar]
- Jiang, X.C.; Shen, Y.D.; Sun, J.C.; Li, X.X.; Huang, Y.; Dong, Y.C.; Cao, H.Q. Effect of chlorantraniliprole and emamectin benzoate on toxicity and detoxification enzymes activity in Spodoptera frugiperda larva. J. Environ. Entomol. 2019, 41, 961–967. [Google Scholar]
- Wen, S.F.; Xue, Y.N.; Du, R.S.; Liu, C.; Wang, X.T.; Wang, Y.W.; Liu, C.; Wang, S.; Wang, J.H.; Xia, X.M. Toxicity and sublethal effects of triflumezopyrim on the development and detoxification enzymatic activities in the small brown planthopper (SBPH), Laodelphax striatellus (Fallen). Crop Prot. 2021, 150, 105813. [Google Scholar] [CrossRef]
- Wang, H.M.; Zhang, H.; Hao, C.; Zhang, X.H. Effects of Isaria fumosorosea infection on different enzyme activities in the larvae of Plutella xylostella. Mycosystema 2013, 32, 269–276. [Google Scholar]
- Tian, J.; Diao, H.L.; Liang, L.; Hao, C.; Arthurs, S.; Ma, R.Y. Pathogenicity of Isaria fumosorosea to Bemisia tabaci, with some observations on the fungal infection process and host immune response. J. Invertebr Pathol. 2015, 130, 147–153. [Google Scholar] [CrossRef]
- Zhang, C.; Chen, S.B.; Wu, C.Y.; Zhang, B.Y.; Zhang, Y.; Teng, B.; Hu, B.J. Screening of Beauveria bassiana strains with high virulence against armyworm and activities of protective enzymes in the larvae infected by fungi. J. Nucl. Agr. Sci. 2020, 34, 2701–2707. [Google Scholar]
- Wang, S.C.; He, R.F.; Lu, M.Q.; Huang, H.P.; Wang, N.Y.; Guo, X.J.; Geng, T. Effects on antioxidant levels of silkworm larvae infected with Beauveria bassiana. Chin. J. Trop. Crops. 2017, 38, 2136–2144. [Google Scholar]
- Felton, G.W.; Summers, C.B. Antioxidant systems in insects. Arch. Insect Biochem. 1995, 29, 187–197. [Google Scholar] [CrossRef]
- Wang, Y.; Oberley, L.W.; Murhammer, D.W. Antioxidant defense systems of two lipidopteran insect cell lines. Free Radic. Biol. Med. 2001, 30, 1254–1262. [Google Scholar] [CrossRef]
Primer | Forward | Reverse | Accession Number |
---|---|---|---|
GST | ATAGCCAACCACCACTGTCG | CGTTCCTCTTGCCGCTAGTT | KR902496 |
Esterase | ACCTACAAGAATCCGACGCC | ACTCCGAAACTTTGGGCCAT | KT748822 |
Cytochrome P450 | TGGAGAAACACCCGCAAGAA | CGGCGATTTTGCCTACCAAG | KT748789 |
β-Actin | AAAGGTTCCGTTGCCCTGAA | TGGCGTACAAGTCCTTCCTG | KM438516 |
Instar | Regression Equation | χ2 | P | LC50 (×105 Spores/mL) | 95% Confidence Limit (Spores/mL) |
---|---|---|---|---|---|
Second | y = 0.473x − 3.124 * | 1.14 | 0.52 | 490.42 | 2.1 × 106~1.1 × 108 |
Fourth | y = 0.413x − 3.652 | 0.59 | 0.73 | 2974.47 | 6.3 × 107~6.9 × 109 |
Concentrations (Spores/mL) | Second Instar | Fourth Instar | ||||
---|---|---|---|---|---|---|
3 d | 5 d | 7 d | 3 d | 5 d | 7 d | |
1 × 105 spores/mL | 30.6 d | 39.6 d | 54.6 e | 27.4 d | 31.4 e | 45.2 e |
1 × 106 spores/mL | 41.2 c | 46.7 c | 63.4 d | 34.6 c | 38.9 d | 49.8 d |
1 × 107 spores/mL | 47.5 b | 49.6 c | 71.3 c | 39.5 b | 43.7 c | 55.7 c |
1 × 108 spores/mL | 49.8 b | 58.6 b | 80.5 b | 40.2 b | 49.6 b | 60.2 b |
2 × 108 spores/mL | 54.3 a | 70.3 a | 88.9 a | 44.6 a | 59.5 a | 71.2 a |
Control | 11.6 e | 15.6 e | 17.6 f | 10.1 e | 12.5 f | 14.7 f |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elsharkawy, M.M.; Alotibi, F.O.; Al-Askar, A.A.; Kamran, M.; Behiry, S.I.; Alasharari, S.S.; Galal, F.H.; Adnan, M.; Abdelkhalek, A. Immune Responses of Rhynchophorus ferrugineus to a New Strain of Beauveria bassiana. Sustainability 2022, 14, 13002. https://doi.org/10.3390/su142013002
Elsharkawy MM, Alotibi FO, Al-Askar AA, Kamran M, Behiry SI, Alasharari SS, Galal FH, Adnan M, Abdelkhalek A. Immune Responses of Rhynchophorus ferrugineus to a New Strain of Beauveria bassiana. Sustainability. 2022; 14(20):13002. https://doi.org/10.3390/su142013002
Chicago/Turabian StyleElsharkawy, Mohsen Mohamed, Fatimah O. Alotibi, Abdulaziz A. Al-Askar, Muhammad Kamran, Said I. Behiry, Salam S. Alasharari, Fatma H. Galal, Muhammad Adnan, and Ahmed Abdelkhalek. 2022. "Immune Responses of Rhynchophorus ferrugineus to a New Strain of Beauveria bassiana" Sustainability 14, no. 20: 13002. https://doi.org/10.3390/su142013002
APA StyleElsharkawy, M. M., Alotibi, F. O., Al-Askar, A. A., Kamran, M., Behiry, S. I., Alasharari, S. S., Galal, F. H., Adnan, M., & Abdelkhalek, A. (2022). Immune Responses of Rhynchophorus ferrugineus to a New Strain of Beauveria bassiana. Sustainability, 14(20), 13002. https://doi.org/10.3390/su142013002