Next Article in Journal
Can Proximal Environments Prevent Social Inequalities Amongst People of All Ages and Abilities? An Integrative Literature Review Approach
Next Article in Special Issue
Bioactivities and Chemical Compositions of Cinnamomum burmannii Bark Extracts (Lauraceae)
Previous Article in Journal
A Systematic Review of the Scientific Literature on Pollutant Removal from Stormwater Runoff from Vacant Urban Lands
Previous Article in Special Issue
Antiviral and Antifungal of Ulva fasciata Extract: HPLC Analysis of Polyphenolic Compounds
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antifungal and Antiaflatoxigenic Activities of Different Plant Extracts against Aspergillus flavus

by
Said I. Behiry
1,*,
Najwa A. Hamad
2,
Fatimah O. Alotibi
3,
Abdulaziz A. Al-Askar
3,
Amr A. Arishi
4,
Ahmed M. Kenawy
5,
Ibrahim A. Elsamra
1,
Nesrine H. Youssef
6,
Mohsen Mohamed Elsharkawy
7,
Ahmed Abdelkhalek
8,* and
Ahmed A. Heflish
1
1
Agricultural Botany Department, Faculty of Agriculture (Saba Basha), Alexandria University, Alexandria 21531, Egypt
2
Plant Protection Department, Faculty of Agriculture, Omar Al-Mukhtar University, Al Bayda 00218-84, Libya
3
Department of Botany and Microbiology, College of Science, King Saud University, Riyadh 11451, Saudi Arabia
4
School of Molecular Sciences, The University of Western Australia, Perth 6009, Australia
5
Genetic Engineering and Biotechnology Research Institute, City of Scientific Research and Technological Applications, New Borg El Arab City 21934, Egypt
6
Microbiology and Mycotoxins Labs, Regional Center for Foods and Feeds, Agricultural Researches Center, Alexandria 12619, Egypt
7
Department of Agricultural Botany, Faculty of Agriculture, Kafrelsheikh University, Kafr El-Sheikh 33516, Egypt
8
Plant Protection and Biomolecular Diagnosis Department, ALCRI, City of Scientific Research and Technological Applications, New Borg El Arab City 21934, Egypt
*
Authors to whom correspondence should be addressed.
Sustainability 2022, 14(19), 12908; https://doi.org/10.3390/su141912908
Submission received: 12 September 2022 / Revised: 4 October 2022 / Accepted: 7 October 2022 / Published: 10 October 2022

Abstract

In the current study, four organic solvents, including ethanol, methanol, acetone, and diethyl ether, were used to extract turmeric, wheat bran, and taro peel. The efficiency of three different concentrations of each solvent was assessed for their antifungal and anti-mycotoxin production against Aspergillus flavus. The results indicated that 75% ethanolic and 25% methanolic extracts of taro peels and turmeric were active against fungus growth, which showed the smallest fungal dry weight ratios of 1.61 and 2.82, respectively. Furthermore, the 25% ethanolic extract of turmeric showed the best result (90.78%) in inhibiting aflatoxin B1 production. After 30 days of grain storage, aflatoxin B1 (AFB1) production was effectively inhibited, and the average inhibition ratio ranged between 4.46% and 69.01%. Simultaneously, the Topsin fungicide resulted in an inhibition ratio of 143.92%. Taro extract (25% acetone) produced the highest total phenolic content (61.28 mg GAE/g dry extract wt.) and showed an antioxidant capacity of 7.45 μg/mL, followed by turmeric 25% ethanol (49.82 mg GAE/g), which revealed the highest antioxidant capacity (74.16 μg/mL). RT-qPCR analysis indicated that the expression of aflD, aflP, and aflQ (structural genes) and aflR and aflS (regulatory genes) was down-regulated significantly compared to both untreated and Topsin-treated maize grains. Finally, the results showed that all three plant extracts could be used as promising source materials for potential products to control aflatoxin formation, thus creating a safer method for grain storage in the environment than the currently used protective method.

1. Introduction

Several Aspergillus sp., including A. flavus, A. nomius, A. parasiticus, and A. pseudotamarii, produce toxins, such as aflatoxins B1, B2, G1, and G2, respectively. Meanwhile, patulin is produced by A. terreus and A. clavatus; A. ochraceus produce ochratoxin A; and cyclopiazonic acid is secreted by A. versicolor and A. flavus [1,2]. Nowadays, several aflatoxins produced by Aspergillus spp. are characterized as aflatoxin B1 (AFB1), a very toxic aflatoxin to mammals [3,4]. Fungi cause severe damage to seed production and seed quality by deteriorating their formation, development, storage, and/or germination [5]. Aflatoxins are a big concern in cereal grains, such as maize, wheat, and their products, dried fruit, nuts, oilseeds, and spices [6,7]. However, maize, wheat, and groundnuts are humans’ main sources of aflatoxin exposure worldwide [8]. AFB1 is one of the most common mycotoxins, which is restricted in different countries if its concentration exceeds 20 ng/g. This restriction is due to the dangerous effects of exposure of humans to even a low dose of aflatoxins, which leads to immune suppression, cancer induction, and growth problems in children [9]. Therefore, controlling aflatoxins in stored grains is necessary for health security [10].
Plant extracts are of great importance since they are biologically active compounds that are easy to prepare and are usually used with a great deal of safety. Furthermore, no concerns for their residual effects have been raised, as they are biodegradable. Their stimulating effect on plant metabolism is evident [11,12]. Plant secondary products can afford new antibiotics against different biological agents with a potential new mode of action [13,14,15]. Their potential use as natural antioxidants affects the ability of mycotoxigenic fungi to grow and produce toxins [11,16]. For instance, plant extracts or essential oils of Cymbopogon citratus, Thymus vulgaris, and Ocimum gratissimum could replace synthetic fungicides to control fungi growth on seeds and grains, Tagne et al. [17]. Different strategies, such as physical and adsorption methods, have been adopted to remove aflatoxins from contaminated foods. Developed countries have recently increased the need for safer foods and cleaner production processes. On the other hand, fungi are widely used for bioremediation activities to remove toxic wastes from contaminated environments [18]. Hence, enhancing fungal growth for toxic material removal creates an urgent necessity for environmental remediation purposes [19]. Agro-food industrial byproducts, such as seed husks and fruit peels, usually produce a massive amount of agro-food waste [20,21]. The accumulation of such waste imposes a serious challenge to the environment after they rot due to microbial activity [22]. These wastes could be used as raw materials for high-added-value products, such as drugs or drug adjuvants, cosmetics, food constituents, antioxidants, and flavors. Therefore, researchers have spent huge efforts to reuse and recycle waste frequently in food and feed industries [23]. Plant wastes are discarded as if it is useless material, and hence, cause several waste-management and environmental problems [24]. Fruits and their peels, in particular, are rich in secondary products which produce different biological activities and/or medicinal properties [25,26]. Flavonoids, tannins, alkaloids, phenolic acids, and glycosides are secondary metabolites that usually exist in many plants, such as taro, wheat bran, and turmeric. Plant extracts containing rutin have shown in vitro antimicrobial, antioxidant, and anticarcinogenic properties [27,28,29]. In planta, linoleic acid, a substrate for the production of trihydroxy oxylipins [30], is known for being an antifungal metabolite. Linolenic acid and allylphenol have both been shown to decrease the growth of Pythium ultimum mycelia by 65% and Rhizoctonia solani mycelia by 74% at 1000 µM. Furthermore, they can decrease fungal biomass production and have been reported to act against a number of other plant pathogens [31,32].
Environmental conditions may also strongly affect the production of AFB1 and its biosynthetic pathway. As one of the well-described pathways, 30 structural genes have been reported to be involved in aflatoxin biosynthesis, including aflD, aflG, aflH, aflI, aflK, aflM, aflO, aflP, and aflQ, along with two regulatory genes, aflR and aflS [33]. Several studies have reported that different plant secondary products cease or downregulate the expression of aflatoxin biosynthesis genes and may cause AFB1 degradation [33,34,35]. For example, Liang et al. [36] showed that 0.40 mM/L cinnamaldehyde could suppress the biosynthesis of AFB1 and the expression of some of its biosynthetic genes. Furthermore, Caceres et al. [37] and El Khoury et al. [38] investigated the effects of water extracts of hyssop, as well as piperine or eugenol (terpenes), on the gene expression level of twenty-five genes of an AFB1 biosynthetic cluster (27 genes), and the expression of 15 regulatory genes was also shown to be affected. Therefore, we aim to evaluate the effect of using different plant extracts (turmeric, wheat bran, and taro peels) as antifungal treatments on the production of aflatoxins on maize grains during storage compared to Topsin-treated grains. Furthermore, the potential of the peel extracts to suppress the expression of AFB1 biosynthetic genes is evaluated.

2. Materials and Methods

2.1. Source of the Fungus and Maize Grains Used in the Study

An Aspergillus isolate was used, which had been previously evaluated for its ability to produce AFB1 [39,40]. The maize grains (variety 2055 yellow hybrid) were purchased from Misr Hytech Seed Int. S.A.E. (Cairo, Egypt).

2.2. Preparation of Extracts

Extraction was performed from wheat bran (Triticum aestivum), turmeric (Curcuma longa), and taro peels (Colocasia esculenta L.) following the method published by Salem et al. [41], with slight modifications. Briefly, air-dried plant samples were ground to a fine powder using a commercial mill. Then, 100 mL of the extraction solvent (ethanol, methanol, diethyl ether, and acetone) was used to extract 20 g of plant powder at 25%, 50%, and 75% (v/v: solvent/water) concentrations. The mixtures were agitated at 200 rpm for 24 h on a bench shaker at room temperature; then, the cultures were filtered through Whatman filter paper (No.1). All the extracts were stored at 4 °C.

2.3. Total Phenolic Content Estimation in Plant Peels

Total phenolic content (TPC) was estimated using Folin–Ciocalteau reagent in all plant samples, as described by Turkmen et al. [42] and Farahmandfar et al. [43]; tests were conducted as follows. In a test tube, 0.5 mL of extract was added to 0.5 mL of 1 mol/L Folin–Ciocalteau reagent and 1 mL of distilled water. Three minutes later, 1.5 mL of 10% Na2CO3 was added, and then the mixture was incubated for 10 min. After incubation, absorbance at 725 nm was estimated for all samples by 6305 UV/VIS SPECTRO (Cole-Parmer, Stone ST15 0SA, United Kingdom). The TPC was calculated and presented as mg gallic acid equivalents (GAE)/gram (g).

2.4. Radical Scavenging Capacity of Plant Extracts

The antioxidant capacity was determined based on the radical scavenging ability of 1,1-diphenyl-2-picrylhydrazyl (DPPH). The free radical scavenging capacities of both extracts using ethanol and diethyl ether were estimated according to Asnaashari et al. [44]. The results were calculated using the following equation: Radical   scavenging   capacity   % = AB AA / AB × 100 , where AB = absorption of blank and AA= absorption of extract.

2.5. Plant Extracts Effects on Fungi Growth and Production of AFB1

2.5.1. Antifungal Growth Estimations

Potato dextrose agar (PDA) plates containing 15 mL medium were prepared, inoculated with A. flavus fungus, and incubated at 30 °C for one week. After one week, A. flavus disks of 5 mm diameter were separated and used to inoculate the previously prepared conical flasks containing 50 mL yeast extract sucrose (YES) broth. Out of the three different plant extract concentrations, 1 mL of 25%, 50%, and 75% extracts was added to the YES broth and incubated for 15 days at 30 °C. After culture filtration, the fungal mats were collected and dried in an oven for four days at 50 °C. The mats’ final dry weights (mass ratio%) were recorded for all treatments, and the filtrates were kept in the fridge at 4 °C to further determine aflatoxin B1 production. Production ratios for aflatoxin were estimated as follows [45]:
PR % = Aflatoxin   conc .   control   Aflatoxin   conc .   treatment Aflatoxin   conc .   control × 100 ) 100  
The production inhibition (PI%) was calculated with the same above equation, without the value of (−100).

2.5.2. Effect of Different Plant Extracts on the Storage of Maize Grains

Fifty grams portions of sterilized maize grains were distributed in sterile glass jars. Each jar was treated with the assigned plant extract, and Topsin fungicide was applied as a positive control. The jars were then inoculated with A. flavus discs and incubated at 30 °C for 30 days. After incubation, maize grains traits, including grain odor and shape, were recorded according to the criteria presented in Table 1. All the treated grains were kept at 4 °C for further aflatoxin production analysis.

2.5.3. Extraction of Aflatoxin B1 from Samples

AFB1 was extracted from YES media, according to Alshannaq et al. [46]. The extraction was performed using chloroform as follows: A total of 2 mL of the broth culture was mixed with an equal volume of chloroform; the mixture was vortexed in 15 mL tubes and then centrifuged for 5 min at 10,000 rpm. Approximately 2 mL of the lower layer was taken into a new glass vial. Then, the solvent (chloroform) was evaporated under airflow. Finally, the dried portions were dissolved in 1 mL methanol [46]. Extraction of AFB1 from contaminated grains was done as indicated by Hoeltz et al. [47], with a slight modification; samples (20 g of contaminated maize grains) were suspended in 12 mL 4% KCl and 100 mL of MeOH. The samples were spun down for 2 min at 10,000 rpm and then filtered. 100 mL of Copper Sulfate 10% (w/v) was added to the filtrate, mixed well, and filtered. Finally, an equal volume of dH2O water was added, and AFB1 was extracted twice using 15 mL chloroform. Then, in a water bath of 60 °C, the solvent was evaporated, and the pellet was dissolved in methanol. All the prepared samples were filtered into HPLC vials using a 0.5 μm syringe filter prior to performing HPLC analysis. Standard of AFB1 was prepared at a concentration of 25 ng/mL AFB1 (Sigma-Aldrich, St. Louis, MO, USA) in toluene–acetonitrile (9:1, v/v).

2.5.4. HPLC Analysis of AFB1

Agilent 1260 Infinity-HPLC-Series (Agilent, Santa Clara, CA, USA) was used to analyze AFB1 content. HPLC equipped with Zorbax Eclipse XDB-C18, 4.6 mm × 150 mm, 3.5 µm column, was used with a mobile phase of Water/MeOH/ACN; 50/40/10 (v/v/v) and a flow rate of 0.8 mL/min for separating the compounds. The injection volume was 10 µL [46]. A UV detector was used for detecting the analytes at 365 nm, and the temperature was adjusted to ambient.

2.5.5. Real-Time PCR Assay

The guanidium isothiocyanate reagent-based method was used to isolate RNA from plant peels with slight modification as described elsewhere [48]. A Nano SPECTRO star (BMG Labtech, Ortenberg, Germany) system was used to measure the concentration of the extracted RNA. Simultaneously, agarose gel electrophoresis was used to assure RNA integrity. 1.0 μg of DNase-treated RNA of each sample was for cDNA synthesis as described previously [49,50]. Real-time quantitative PCR (RT-qPCR) reactions were carried out in a Qiagen RGQ Rotor-Gene Q 2-Plex HRM real-time PCR system (Qiagen, Hilden, Germany). Table 2 illustrate all primer sequences that were used in this study. A β-tubulin internal reference gene transcript level was utilized for normalizing the amount of RNA discrepancy in each reaction. The total volume of the RT-qPCR reaction was performed in a 20 μL volume using SYBR-Green PCR Master-Mix [51,52]. The relative levels of gene expression were calculated using the 2−ΔΔCT equation [53].

2.6. Statistical Analysis

A completely randomized statistical design was adopted to carry on the experiments [54,55], and analyses were performed using the Analysis of Variance (ANOVA) test, employing “CoSTAT” software. For analyzing the level of gene expression of the aflatoxin biosynthetic genes, gene expression values were expressed as means ±SD gene expression values were compared with the untreated samples and considered statistically significant when p ≤ 0.05.

3. Results and Discussion

The aflatoxigenic A. flavus Af1 (#MG202161) isolate, previously identified on a molecular level, was used as a high producer of AFB1 (26.79 ppb).

3.1. Effect of Plant Extracts on the Growth of A. flavus and Production of AFB1

Wheat bran, turmeric, and taro plant peels were exposed to organic solvent extraction using ethanol, acetone, methanol, and diethyl ether in the extraction phase. Each solvent was used at different concentrations (25, 50, and 75%) to study its potential effect on A. flavus growth (dry weight mass ratio) and AFB1 production (Figure 1). Regarding the effect of the extract on fungal growth, dry weight mass ratio results showed that the least significant values were 3.23, 2.82, and 1.61% when 75% methanolic extracts of wheat and taro, 25% ethanolic extract of turmeric, and 75% ethanolic extract of taro were applied, respectively, compared with control. Our results showed that the antifungal capability of turmeric extract is consistent with previous reports. For example, Hu et al. [56] reported the antifungal and antiaflatoxigenic properties of Curcuma longa L. essential oil against A. flavus. In another study, Hojo and Sato [57] reported that extract of licorice in 80% methanol exhibited significant antifungal effects when tested on Arthrinium sacchari M001 and Chaetomium funicola M002. Furthermore, less mycelial growth (about 100×) was observed after incubating licorice extract with Aspergillus parasiticus for 72 h [58].
In the present study, most of the tested extracts using different extraction concentrations of the solvents showed high efficacy against aflatoxin production. Production ratios of AFB1 (PR%) values ranged between 9.22% and 78.33% in turmeric, and PR% values in wheat bran ranged between 20.65 and 59.29%. PR% values, shown in Figure 1, indicated promising results of ethanol and acetone extracts of turmeric. It was found that the best PR% of 9.22% and the best production inhibition (PI%) of 90.78% were achieved with turmeric 25% ethanolic extract, followed by the 75% acetone extract, which produced a PR% of 10.44% and a PI% of 89.56%. The highest PR% values were obtained by 50% and 75% diethyl ether extracts (76.78% and 78.33%, respectively). Moreover, when taro peels were extracted using all solvents, the smallest PR% value was 11.79% with 25% acetone, which also produced a PI% of 88.21%. Meanwhile, the highest PR% values of 63.64% and 59.37% and the lowest PI% values of 36.36% and 40.63% for taro peel extracts were achieved when 75% methanol and 50% acetone were used in the extraction, respectively. Furthermore, wheat bran extract data presented in Figure 1 showed slight differences between the PR% values of the tested solvents. The lowest PR%, 20.65%, was achieved using 25% acetone treatment, which means there was a 79.35 % reduction in the AFB1 production compared to PR% values of the other solvents. Meanwhile, a minor effect was observed when 25% and 50% methanol extracts were tested, for which the PI% values were 40.71 and 43.81%, respectively.
The results obtained in the current study regarding fungal growth and inhibition of AFB1 production may be explained in light of the findings of Borges et al. [59]. The authors found that plant extracts act as antioxidants to inhibit aflatoxins via quenching free radicals and suppressing their propagation, converting them into less-toxic compounds. In addition, solvents showed different efficiency when different concentrations were used and the content of a given plant’s content of secondary metabolites. Naik et al. [60] and Bernardo and Sagum [61] reported that eggplant (Solanum melongena L.) peels extract and sugar apple peels (Annona squamosa) using ethanol and methanol showed great free radical scavenging capacity towards human pathogens. Their findings are in harmony with our findings in the current study. Two studies by Adom et al. [62] and Laddomada et al. [63] revealed that phenolic acids, cross-linked with plant cell wall polymers, such as in the case of wheat bran, play important antioxidant roles.

3.2. Maize Storage Experiment

3.2.1. Effect of Plant Extracts on Production of AFB1

The results shown in Table 3 clarify that turmeric extract using 25% ethanol was the best treatment for inhibiting AFB1 production (4.46 ppb), with a PI% of 98.95%. Meanwhile, wheat bran extracted with 25% acetone showed low AFB1 content (51.18 ppb). Simultaneously, the value of AFB1 in 25% acetone extract of taro peel was 69.01 ppb compared to the other treatments. These results are consistent with the results reported by Mohseni et al. [58], as they showed decreased aflatoxin production in A. parasiticus in the presence of 500 mg/mL of licorice extract.

3.2.2. Effect of Plant Extracts on Grain Shape and Smell

The results in Table 4 show significant changes in the appearance of plant-extract- and fungicide-treated grains compared to the control. Turmeric extract showed outstanding antifungal effects and maintained whole grain shape compared to the other treatments. Turmeric was followed by wheat bran extract and taro peel extract, which both showed a similar grain shape appearance. Topsin treatment using the recommended dose caused grain shape distortion, bad odors, and, consequently, unapproved grains. Similar results were obtained by Gemeda et al. [64] and El-Aziz et al. [65] when they tested reductions in fungal dry weight after treatment of Aspergillus with different essential oils. A similar reduction was observed in turmeric extract [66]. The current study’s results also agree with Yazdani et al. [67], who illustrated that some plant metabolites (phenolics) could suppress aflatoxin production in A. flavus.

3.3. RT-qPCR Analysis of AFB1 Biosynthetic Genes

AFB1 biosynthesis is a complicated pathway of the enzymatic production of aflatoxins [68]. In A. flavus, 25 genes are responsible for producing AFB1, starting from acetyl CoA, in which the coding genes are allocated in a 75 kb cluster that controls 18 enzymatic biosynthetic steps [69,70]. Different regulatory and structural genes control such pathways [71]. In the current investigation, the effect of taro peel, turmeric, and wheat bran extracts, as well as the fungicide Topsin, on the relative gene expression of aflD, aflP, and aflQ (structural genes), as well as aflR and aflS (two regulatory genes) (Figure 2) was investigated. The aflD was found to play an important role in converting norsolorinic acid to averantin. Meanwhile, aflP and aflQ are necessary for converting sterigmatocystin to o-methylsterigmatocystin and AFB1 during the final steps of the aflatoxin biosynthetic pathway [72,73]. The results indicated a 6.43-fold increase in the relative transcription level of aflD in the infected, untreated control maize grains. Topsin treatment showed a 3.62-fold increase. Meanwhile, taro peel and wheat bran extracts using 25% acetone extraction solvent and turmeric extract using 25% ethanol solvent reduced the expression level of aflD gene to relative expression levels of 2.48-, 2.06-, and 1.63-fold, respectively (Figure 2). Furthermore, the highest relative expressions levels of aflP and aflQ were detected in the infected control treatment (5.99- and 7.54-fold higher). Moreover, turmeric extract using 25% ethanol treatment showed the lowest transcriptional levels, producing relative expression levels of 1.51 and 1.78 for aflP and aflQ, respectively. The obtained results are consistent with those published by Mayer et al. [74], who observed the presence of an association between fungal growth kinetics and AFB1 production when they studied aflD expression levels in wheat grains inoculated with an A. flavus isolate. The authors also reported that aflD, aflQ, and aflP gene expression levels could be used as markers to differentiate between aflatoxigenic and non-aflatoxigenic strains of A. flavus [75,76]. It was also reported that aflR and aflS are two important key regulatory genes that control the production of AFB1. A significant correlation was found between the expression level of aflR and aflatoxin production by Sweeney et al. [77] using RT-qPCR data analysis. In the current study, transcripts abundant in aflR and aflS were found to be downregulated in all treated grains compared to untreated controls (Figure 2). The expression of aflS and aflD was beneficial in differentiating Aspergillus AFB1-producing strains from the non-producing ones, Degola et al. [78]. Furthermore, Mohseni [58] found that aflR relative expression dropped significantly in experimental fungus trials that did not receive turmeric extract treatment compared to the control. Therefore, the obtained data show the high capability of the tested extracts to strongly inhibit A. parasiticus growth and aflatoxin production by reducing gene expression level in key limiting steps in the AFB1 biosynthetic pathway.

3.4. Total Phenolic Content (TPC) of the Studied Plant Extracts

The studied plant materials were analyzed for their TPC to determine their efficiency in affecting fungal traits. The plant TPC was estimated in mg GAE/g of dry extract weight. The results obtained in the current study clearly showed that all plant materials contain high-phenolic compound contents that ranged from 46.08 to 61.28 mg of GAE/g dry extract (Table 5). The TPC content was recorded to be highest with 25% acetone extracts of taro peels (61.28 mg of GAE/g dry extract wt.). On the contrary, the lowest TPC concentration was found in wheat bran extracts when 25% acetone was the extraction solvent (46.08 mg of GAE/g dry extract wt.). Thus, as previously reported, phenolic compounds are abundant secondary metabolites that have been the focus of many scientists due to their excellent antioxidant properties and their remarked roles in preventing oxidative stress-based diseases [79].

3.5. Antioxidant Activities of the Extracts

DPPH is a method usually utilized to investigate a compound’s free radical scavenging or hydrogen donating abilities and screen the antioxidant capacity of specific extracts [80]. This study estimated the plant extracts’ antioxidant activities (AA) by comparing DPPH scavenging and IC50 (μg/mL) values. Table 5 illustrates the antioxidant activity values of the plants. Turmeric extract exhibited the highest AA value (74.16 μg/mL), while wheat bran and taro peel extract resulted in 59.41 and 7.45 μg/mL, respectively. In the meantime, taro peel extract proved to be a potent scavenger of free radicals and an excellent inhibitor of lipid peroxidation [81,82]. However, in the current study, taro peel extracts did not show high antioxidant values. Furthermore, the turmeric plant extracts showed the highest antioxidant properties. It is well known that turmeric is rich in antioxidant and anti-inflammatory properties due to its plethora of free radical scavenging secondary metabolites [83].
The RT-qPCR analysis showed a clear downregulation for most of the aflatoxin biosynthetic genes. The results were in harmony with other published reports that have indicated a suppressing effect of some metabolites on the AFB1 biosynthetic genes [84]. Furthermore, polyphenolic compounds were found to stop the biosynthesis pathway of AFB1 in A. flavus by inhibiting norsolorinic acid accumulation, as reported by Hua et al. [85]. Moreover, Youssef et al. [86] detected several antimicrobial compounds, including 1-dodecanamine, hexadecanoic acid n, n-dimethyl, and n-hexadecanoic acid methyl ester, in methanol and ethanol beetroot extracts, which were suggested to produce potential activity against mycotoxin production. Finally, the results obtained in the current study suggest that taro, turmeric, and wheat bran extracts are promising sources for developing effective and environmentally friendly alternatives for controlling aflatoxin biosynthesis, thus, providing a new basis for the establishment of a new protective strategy for long-term grain preservation and storage.

4. Conclusions

Among different organic solvent extracts of turmeric, wheat bran, and taro peels, 75% ethanol extract of taro was extremely active against Aspergillus flavus growth, showing the best dry weight mass ratio of maize aflatoxigenic fungus. Meanwhile, the highest AFB1 production inhibition ratio was achieved using the 25% ethanol turmeric extract. All tested plant materials were active against AFB1 biosynthesis after one month of maize storage compared to Topsin fungicide. The transcription levels of aflD, aflP, aflQ, aflR, and aflS showed a significant down-regulated gene expression effect compared to the untreated control and Topsin treatments. The extracts’ antioxidant capacities proved their ability to be antifungal growth and antiaflatoxin biosynthesis agents.

Author Contributions

Conceptualization, S.I.B., N.H.Y. and A.A.H.; methodology, N.A.H., A.A., N.H.Y., A.A.H. and S.I.B.; software, S.I.B. and A.A.; validation, M.M.E., I.A.E. and F.O.A.; formal analysis, A.A.H. and S.I.B.; investigation, A.A.; resources, N.A.H.; data curation, M.M.E.; writing—original draft preparation, S.I.B., A.M.K. and A.A.H.; writing—review and editing, S.I.B. and A.A.; visualization, A.A.A.; supervision, A.A.A.-A. and I.A.E.; project administration, F.O.A., A.A.A. and A.A.A.-A.; funding acquisition, F.O.A. and A.A.A.-A. All authors have read and agreed to the published version of the manuscript.

Funding

This research project was supported by a grant from the Researchers Supporting Project, number (RSP-2021/114), King Saud University, Riyadh, Saudi Arabia.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors would like to extend their appreciation to the Researchers Supporting Project number (RSP-2021/114), King Saud University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Wu, F.; Bhatnagar, D.; Bui-Klimke, T.; Carbone, I.; Hellmich, R.; Munkvold, G.; Paul, P.; Payne, G.; Takle, E. Climate change impacts on mycotoxin risks in US maize. World Mycotoxin J. 2011, 4, 79–93. [Google Scholar] [CrossRef] [Scilit]
  2. Perrone, G.; Haidukowski, M.; Stea, G.; Epifani, F.; Bandyopadhyay, R.; Leslie, J.F.; Logrieco, A. Population structure and Aflatoxin production by Aspergillus Sect. Flavi from maize in Nigeria and Ghana. Food Microbiol. 2014, 41, 52–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Asters, M.C.; Williams, W.P.; Perkins, A.D.; Mylroie, J.E.; Windham, G.L.; Shan, X. Relating significance and relations of differentially expressed genes in response to Aspergillus flavus infection in maize. Sci. Rep. 2014, 4, 4815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Adhikari, B.N.; Bandyopadhyay, R.; Cotty, P.J. Degeneration of aflatoxin gene clusters in Aspergillus flavus from Africa and North America. Amb Express 2016, 6, 62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Suleiman, M.N.; Omafe, O.M. Activity of three medicinal plants on fungi isolated from stored maize seeds (Zea mays (L.). Glob. J. Med. Plant Res. 2013, 1, 77–81. [Google Scholar]
  6. Pietri, A.; Bertuzzi, T.; Pallaroni, L.; Piva, G. Occurrence of mycotoxins and ergosterol in maize harvested over 5 years in Northern Italy. Food Addit. Contam. 2004, 21, 479–487. [Google Scholar] [CrossRef] [Scilit]
  7. Galvano, F.; Ritieni, A.; Piva, G.; Pietri, A. Mycotoxins in the human food chain. In The Mycotoxin Blue Book; Context Products: Los Angeles, CA, USA, 2005; Volume 1, pp. 187–224. [Google Scholar]
  8. Strosnider, H.; Azziz-Baumgartner, E.; Banziger, M.; Bhat, R.V.; Breiman, R.; Brune, M.-N.; DeCock, K.; Dilley, A.; Groopman, J.; Hell, K. Workgroup report: Public health strategies for reducing aflatoxin exposure in developing countries. Environ. Health Perspect. 2006, 114, 1898–1903. [Google Scholar] [CrossRef] [Scilit]
  9. Ogodo, A.C.; Ugbogu, O.C. Public health significance of aflatoxin in food industry—A review. Eur. J. Clin. Biomed. Sci. 2016, 2, 51–58. [Google Scholar]
  10. Abdel-Kareem, M.M.; Rasmey, A.M.; Zohri, A.A. The action mechanism and biocontrol potentiality of novel isolates of Saccharomyces cerevisiae against the aflatoxigenic Aspergillus flavus. Lett. Appl. Microbiol. 2019, 68, 104–111. [Google Scholar] [CrossRef] [Scilit]
  11. Gauthier, L.; Bonnin-Verdal, M.-N.; Marchegay, G.; Pinson-Gadais, L.; Ducos, C.; Richard-Forget, F.; Atanasova-Penichon, V. Fungal biotransformation of chlorogenic and caffeic acids by Fusarium graminearum: New insights in the contribution of phenolic acids to resistance to deoxynivalenol accumulation in cereals. Int. J. Food Microbiol. 2016, 221, 61–68. [Google Scholar] [CrossRef] [Scilit]
  12. LAGOGIANNI, C.; TSITSIGIANNIS, D. Effective chemical management for prevention of aflatoxins in maize. Phytopathol. Mediterr. 2018, 57, 186–197. [Google Scholar]
  13. Kaur, R.; Kaur, H. The Antimicrobial activity of essential oil and plant extracts of Woodfordia fruticosa. Arch. Appl. Sci. Res. 2010, 2, 302–309. [Google Scholar]
  14. Ashmawy, N.A.; Behiry, S.I.; Ali, H.M.; Salem, M.Z.M. Evaluation of Tecoma stans and Callistemon viminalis extracts against potato soft rot bacteria in vitro. J. Pure Appl. Microbiol. 2014, 8, 667–673. [Google Scholar]
  15. Behiry, S.I.; Soliman, S.A.; Al-Askar, A.A.; Alotibi, F.O.; Basile, A.; Abdelkhalek, A.; Elsharkawy, M.M.; Salem, M.Z.M.; Hafez, E.E.; Heflish, A.A. Plantago lagopus extract as a green fungicide induces systemic resistance against Rhizoctonia root rot disease in tomato plants. Front. Plant Sci. 2022, 13, 2818. [Google Scholar] [CrossRef] [Scilit]
  16. Ferrochio, L.; Cendoya, E.; Farnochi, M.C.; Massad, W.; Ramirez, M.L. Evaluation of ability of ferulic acid to control growth and fumonisin production of Fusarium verticillioides and Fusarium proliferatum on maize based media. Int. J. Food Microbiol. 2013, 167, 215–220. [Google Scholar] [CrossRef] [Scilit]
  17. Tagne, A.; Feujio, T.P.; Sonna, C. Essential oil and plant extracts as potential substitutes to synthetic fungicides in the control of fungi. In Proceedings of the International Conference Diversifying Crop Protection, La Grande-Motte, France, 12–15 October 2008; pp. 12–15. [Google Scholar]
  18. Abd El-Rahim, W.M.; Khalil, W.K.B.; Eshak, M.G. Genotoxicity studies on the removal of a direct textile dye by a fungal strain, in vivo, using micronucleus and RAPD-PCR techniques on male rats. J. Appl. Toxicol. 2008, 28, 484–490. [Google Scholar] [CrossRef] [Scilit]
  19. Abd El-Rahim, W.M.; Moawad, H.; Khalafallah, M. Enhancing the growth of promising fungal strains for rapid dye removal. Fresenius Environ. Bull. 2003, 12, 764–770. [Google Scholar]
  20. Martin, J.G.P.; Porto, E.; Corrêa, C.B.; Alencar, S.M.; Gloria, E.M.; Cabral, I.S.R.; Aquino, L.M. Antimicrobial potential and chemical composition of agro-industrial wastes. J. Nat. Prod. 2012, 5, 27–36. [Google Scholar]
  21. Stabnikova, O.; Wang, J.-Y.; Ding, H.B. Biotransformation of vegetable and fruit processing wastes into yeast biomass enriched with selenium. Bioresour. Technol. 2005, 96, 747–751. [Google Scholar] [CrossRef] [Scilit]
  22. García-Marino, M.; Rivas-Gonzalo, J.C.; Ibáñez, E.; García-Moreno, C. Recovery of catechins and proanthocyanidins from winery by-products using subcritical water extraction. Anal. Chim. Acta 2006, 563, 44–50. [Google Scholar] [CrossRef] [Scilit]
  23. Mohamed, S.; Hassan, Z.; Hamid, N.A. Antimicrobial activity of some tropical fruit wastes (guava, starfruit, banana, papaya, passionfruit, langsat, duku, rambutan and rambai). Pertanika 1994, 17, 219. [Google Scholar]
  24. Hossain, M.A.; Ngo, H.H.; Guo, W.S.; Nguyen, T. V Removal of copper from water by adsorption onto banana peel as bioadsorbent. Int. J. Geomate 2012, 2, 227–234. [Google Scholar] [CrossRef] [Scilit]
  25. Oliveira, L.; Freire, C.S.R.; Silvestre, A.J.D.; Cordeiro, N. Lipophilic extracts from banana fruit residues: A source of valuable phytosterols. J. Agric. Food Chem. 2008, 56, 9520–9524. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Lim, Y.Y.; Lim, T.T.; Tee, J.J. Antioxidant properties of several tropical fruits: A comparative study. Food Chem. 2007, 103, 1003–1008. [Google Scholar] [CrossRef] [Scilit]
  27. Chabuck, Z.A.G.; Al-Charrakh, A.H.; Hindi, N.K.K.; Hindi, S.K.K. Antimicrobial effect of aqueous banana peel extract, Iraq. Res. Gate. Pharm. Sci. 2013, 1, 73–75. [Google Scholar]
  28. Singh, J.P.; Kaur, A.; Shevkani, K.; Singh, N. Influence of jambolan (Syzygium cumini) and xanthan gum incorporation on the physicochemical, antioxidant and sensory properties of gluten-free eggless rice muffins. Int. J. Food Sci. Technol. 2015, 50, 1190–1197. [Google Scholar] [CrossRef] [Scilit]
  29. Praveena, M.; Prabha, M.S.; Ravi, I.; Vaganan, M.M. Anti-colorectal cancer properties of Hill banana (cv. Virupakshi AAB) fruits: An in vitro assay. Indian J. Nat. Sci. 2018, 8, 13226–13233. [Google Scholar]
  30. Bouchra, C.; Mohamed, A.; Mina, I.H.; Hmamouchi, M. Antifungal activity of essential oils from several medicinal plants against four postharvest citrus pathogens. Phytopathol. Mediterr. 2003, 42, 251–256. [Google Scholar]
  31. Shehata, M.G.; Badr, A.N.; El Sohaimy, S.A.; Asker, D.; Awad, T.S. Characterization of antifungal metabolites produced by novel lactic acid bacterium and their potential application as food biopreservatives. Ann. Agric. Sci. 2019, 64, 71–78. [Google Scholar] [CrossRef] [Scilit]
  32. Walters, D.; Raynor, L.; Mitchell, A.; Walker, R.; Walker, K. Antifungal activities of four fatty acids against plant pathogenic fungi. Mycopathologia 2004, 157, 87–90. [Google Scholar]
  33. Yu, J. Current understanding on aflatoxin biosynthesis and future perspective in reducing aflatoxin contamination. Toxins 2012, 4, 1024–1057. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Roze, L.V.; Hong, S.-Y.; Linz, J.E. Aflatoxin biosynthesis: Current frontiers. Annu. Rev. Food Sci. Technol. 2013, 4, 293–311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Ehrlich, K.C. Predicted roles of the uncharacterized clustered genes in aflatoxin biosynthesis. Toxins 2009, 1, 37–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Liang, D.; Xing, F.; Selvaraj, J.N.; Liu, X.; Wang, L.; Hua, H.; Zhou, L.; Zhao, Y.; Wang, Y.; Liu, Y. Inhibitory effect of cinnamaldehyde, citral, and eugenol on aflatoxin biosynthetic gene expression and aflatoxin B1 biosynthesis in Aspergillus flavus. J. Food Sci. 2015, 80, M2917–M2924. [Google Scholar] [CrossRef] [Scilit]
  37. Caceres, I.; El Khoury, R.; Medina, Á.; Lippi, Y.; Naylies, C.; Atoui, A.; El Khoury, A.; Oswald, I.P.; Bailly, J.-D.; Puel, O. Deciphering the anti-aflatoxinogenic properties of eugenol using a large-scale q-PCR approach. Toxins 2016, 8, 123. [Google Scholar] [CrossRef] [Scilit]
  38. El Khoury, R.; Caceres, I.; Puel, O.; Bailly, S.; Atoui, A.; Oswald, I.P.; El Khoury, A.; Bailly, J.-D. Identification of the anti-aflatoxinogenic activity of Micromeria graeca and elucidation of its molecular mechanism in Aspergillus flavus. Toxins 2017, 9, 87. [Google Scholar] [CrossRef] [Scilit]
  39. Salem, M.Z.M.; Behiry, S.I.; EL-Hefny, M. Inhibition of Fusarium culmorum, Penicillium chrysogenum and Rhizoctonia solani by n-hexane extracts of three plant species as a wood-treated oil fungicide. J. Appl. Microbiol. 2019, 126, 1683–1699. [Google Scholar] [CrossRef] [Scilit]
  40. Abdelkhalek, A.; Behiry, S.I.; Al-Askar, A.A. Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus. Agronomy 2020, 10, 1312. [Google Scholar] [CrossRef] [Scilit]
  41. Salem, M.Z.M.; Behiry, S.I.; Salem, A.Z.M. Effectiveness of root-bark extract from Salvadora persica against the growth of certain molecularly identified pathogenic bacteria. Microb. Pathog. 2018, 117, 320–326. [Google Scholar] [CrossRef] [Scilit]
  42. Turkmen, N.; Sari, F.; Velioglu, Y.S. Effects of extraction solvents on concentration and antioxidant activity of black and black mate tea polyphenols determined by ferrous tartrate and Folin–Ciocalteu methods. Food Chem. 2006, 99, 835–841. [Google Scholar] [CrossRef] [Scilit]
  43. Farahmandfar, R.; Asnaashari, M.; Sayyad, R. Comparison antioxidant activity of Tarom Mahali rice bran extracted from different extraction methods and its effect on canola oil stabilization. J. Food Sci. Technol. 2015, 52, 6385–6394. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Asnaashari, M.; Farhoosh, R.; Sharif, A. Antioxidant activity of gallic acid and methyl gallate in triacylglycerols of Kilka fish oil and its oil-in-water emulsion. Food Chem. 2014, 159, 439–444. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Velluti, A.; Sanchis, V.; Ramos, A.J.; Egido, J.; Marın, S. Inhibitory effect of cinnamon, clove, lemongrass, oregano and palmarose essential oils on growth and fumonisin B1 production by Fusarium proliferatum in maize grain. Int. J. Food Microbiol. 2003, 89, 145–154. [Google Scholar] [CrossRef] [Scilit]
  46. Alshannaq, A.F.; Gibbons, J.G.; Lee, M.-K.; Han, K.-H.; Hong, S.-B.; Yu, J.-H. Controlling aflatoxin contamination and propagation of Aspergillus flavus by a soy-fermenting Aspergillus oryzae strain. Sci. Rep. 2018, 8, 16871. [Google Scholar] [CrossRef] [Scilit]
  47. Hoeltz, M.; Welke, J.E.; Noll, I.B.; Dottori, H.A. Photometric procedure for quantitative analysis of aflatoxin B1 in peanuts by thin-layer chromatography using charge coupled device detector. Quim. Nova 2010, 33, 43–47. [Google Scholar] [CrossRef] [Scilit]
  48. Abdelkhalek, A.; Sanan-Mishra, N. Differential expression profiles of tomato miRNAs induced by tobacco mosaic virus. J. Agric. Sci. Technol. 2019, 21, 475–485. [Google Scholar]
  49. AbdEl-Rahim, W.M.; Khalil, W.K.B.; Eshak, M.G. Evaluation of the gene expression changes in Nile tilapia (Oreochromis niloticus) as affected by the bio-removal of toxic textile dyes from aqueous solution in small-scale bioreactor. Environmentalist 2010, 30, 242–253. [Google Scholar] [CrossRef] [Scilit]
  50. Abdelkhalek, A.; Ismail, I.A.I.A.; Dessoky, E.S.E.S.; El-Hallous, E.I.E.I.; Hafez, E. A tomato kinesin-like protein is associated with Tobacco mosaic virus infection. Biotechnol. Biotechnol. Equip. 2019, 33, 1424–1433. [Google Scholar] [CrossRef] [Scilit]
  51. Abdelkhalek, A.; Dessoky, E.S.; Hafez, E. Polyphenolic genes expression pattern and their role in viral resistance in tomato plant infected with Tobacco mosaic virus. Biosci. Res. 2018, 15, 3349–3356. [Google Scholar]
  52. Abdelkhalek, A.; Al-Askar, A.A.; Hafez, E. Differential induction and suppression of the potato innate immune system in response to Alfalfa mosaic virus infection. Physiol. Mol. Plant Pathol. 2020, 110, 101485. [Google Scholar] [CrossRef] [Scilit]
  53. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Gomez, K.A.; Gomez, A.A. Statistical Procedures for Agricultural Research; John Wiley & Sons: Hoboken, NJ, USA, 1984; ISBN 0471870927. [Google Scholar]
  55. McDonald, J.H. Handbook of Biological Statistics; Sparky House Publishing: Baltimore, MD, USA, 2009; Volume 2. [Google Scholar]
  56. Hu, Y.; Zhang, J.; Kong, W.; Zhao, G.; Yang, M. Mechanisms of antifungal and anti-aflatoxigenic properties of essential oil derived from turmeric (Curcuma longa L.) on Aspergillus flavus. Food Chem. 2017, 220, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Hojo, H.; Sato, J. Antifungal activity of licorice (Glycyrrhiza glabra) and potential applications in beverage. Foods Food Ingred. J. Jpn. 2002, 203, 27–33. [Google Scholar]
  58. Mohseni, R.; Noorbakhsh, F.; Moazeni, M.; Omran, A.N.; Rezaie, S. Antitoxin characteristic of licorice extract: The inhibitory effect on aflatoxin production in. J. Food Saf. 2014, 34, 119–125. [Google Scholar] [CrossRef] [Scilit]
  59. Borges, C.V.; de Oliveira Amorim, V.B.; Ramlov, F.; da Silva Ledo, C.A.; Donato, M.; Maraschin, M.; Amorim, E.P. Characterisation of metabolic profile of banana genotypes, aiming at biofortified Musa spp. cultivars. Food Chem. 2014, 145, 496–504. [Google Scholar] [CrossRef] [Scilit]
  60. Naik, P.; Wedel, M.; Bacon, L.; Bodapati, A.; Bradlow, E.; Kamakura, W.; Kreulen, J.; Lenk, P.; Madigan, D.M.; Montgomery, A. Challenges and opportunities in high-dimensional choice data analyses. Mark. Lett. 2008, 19, 201–213. [Google Scholar] [CrossRef] [Scilit]
  61. Bernardo, J.S.; Sagum, R.S. Eggplant (Solanum melongena L.) peel as a potential functional ingredient in pan de sal. J. Nutr. Food Sci. 2016, 6, 68. [Google Scholar]
  62. Adom, K.K.; Sorrells, M.E.; Liu, R.H. Phytochemicals and antioxidant activity of milled fractions of different wheat varieties. J. Agric. Food Chem. 2005, 53, 2297–2306. [Google Scholar] [CrossRef] [Scilit]
  63. Laddomada, B.; Caretto, S.; Mita, G. Wheat bran phenolic acids: Bioavailability and stability in whole wheat-based foods. Molecules 2015, 20, 15666–15685. [Google Scholar] [CrossRef] [Scilit]
  64. Gemeda, N.; Woldeamanuel, Y.; Asrat, D.; Debella, A. Effect of essential oils on Aspergillus spore germination, growth and mycotoxin production: A potential source of botanical food preservative. Asian Pac. J. Trop. Biomed. 2014, 4, S373–S381. [Google Scholar] [CrossRef] [Scilit]
  65. El-Aziz, A.; Abeer, R.M.; Mahmoud, M.A.; Al-Othman, M.R.; Al-Gahtani, M.F. Use of selected essential oils to control aflatoxin contaminated stored cashew and detection of aflatoxin biosynthesis gene. Sci. World J. 2015, 2015, 958192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  66. Mabrouk, S.S.; El-Shayeb, N.M.A. Isolation of inhibitors of Aspergillus flavus from lentils (Lens culinris Medicus). In Proceedings of the Fifth International Symposium on Mycotoxins and Phycotoxins, Vienna, Austria, 1–3 September 1982. [Google Scholar]
  67. Yazdani, D.; Ahmad, Z.A.M.; How, T.Y.; Jaganath, I.B.; Shahnazi, S. Inhibition of aflatoxin biosynthesis in Aspergillus flavus by phenolic compounds extracted of Piper betle L. Iran. J. Microbiol. 2013, 5, 428. [Google Scholar]
  68. Cleveland, T.E.; Yu, J.; Fedorova, N.; Bhatnagar, D.; Payne, G.A.; Nierman, W.C.; Bennett, J.W. Potential of Aspergillus flavus genomics for applications in biotechnology. Trends Biotechnol. 2009, 27, 151–157. [Google Scholar] [CrossRef] [Scilit]
  69. Yu, J.; Fedorova, N.D.; Montalbano, B.G.; Bhatnagar, D.; Cleveland, T.E.; Bennett, J.W.; Nierman, W.C. Tight control of mycotoxin biosynthesis gene expression in Aspergillus flavus by temperature as revealed by RNA-Seq. FEMS Microbiol. Lett. 2011, 322, 145–149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  70. Lappa, I.K.; Dionysopoulou, A.M.; Paramithiotis, S.; Georgiadou, M.; Drosinos, E.H. Dual Transcriptional Profile of Aspergillus flavus during Co-Culture with Listeria monocytogenes and Aflatoxin B1 Production: A Pathogen–Pathogen Interaction. Pathogens 2019, 8, 198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  71. Ullah, N.; Akhtar, K.P.; ul Hassan, S.W.; Asi, M.R.; Sadef, Y. First report of molecular characterization of Aspergillus flavus from maize in Pakistan. J. Plant Pathol. 2019, 101, 1289–1290. [Google Scholar] [CrossRef] [Scilit]
  72. Papa, K.E. Norsolorinic acid mutant of Aspergillus flavus. Microbiology 1982, 128, 1345–1348. [Google Scholar] [CrossRef] [Scilit]
  73. Bhatnagar, D.; Ehrlich, K.C.; Cleveland, T.E. Molecular genetic analysis and regulation of aflatoxin biosynthesis. Appl. Microbiol. Biotechnol. 2003, 61, 83–93. [Google Scholar] [CrossRef] [Scilit]
  74. Mayer, Z.; Färber, P.; Geisen, R. Monitoring the production of aflatoxin B1 in wheat by measuring the concentration of nor-1 mRNA. Appl. Environ. Microbiol. 2003, 69, 1154–1158. [Google Scholar] [CrossRef] [Scilit]
  75. Rodrigues, P.; Venâncio, A.; Kozakiewicz, Z.; Lima, N. A polyphasic approach to the identification of aflatoxigenic and non-aflatoxigenic strains of Aspergillus section Flavi isolated from Portuguese almonds. Int. J. Food Microbiol. 2009, 129, 187–193. [Google Scholar] [CrossRef] [Scilit]
  76. Scherm, B.; Palomba, M.; Serra, D.; Marcello, A.; Migheli, Q. Detection of transcripts of the aflatoxin genes aflD, aflO, and aflP by reverse transcription–polymerase chain reaction allows differentiation of aflatoxin-producing and non-producing isolates of Aspergillus flavus and Aspergillus parasiticus. Int. J. Food Microbiol. 2005, 98, 201–210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Sweeney, M.J.; Pàmies, P.; Dobson, A.D.W. The use of reverse transcription-polymerase chain reaction (RT-PCR) for monitoring aflatoxin production in Aspergillus parasiticus 439. Int. J. Food Microbiol. 2000, 56, 97–103. [Google Scholar] [CrossRef] [Scilit]
  78. Degola, F.; Berni, E.; Spotti, E.; Ferrero, I.; Restivo, F.M. Facing the problem of “false positives”: Re-assessment and improvement of a multiplex RT-PCR procedure for the diagnosis of A. flavus mycotoxin producers. Int. J. Food Microbiol. 2009, 129, 300–305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  79. Dai, J.; Mumper, R.J. Plant Phenolics: Extraction, Analysis and Their Antioxidant and Anticancer Properties. Molecules 2010, 15, 7313–7352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  80. Blois, M. Antioxidant determinations by the use of a stable free radical. Nature 1958, 181, 1199–1200. [Google Scholar] [CrossRef] [Scilit]
  81. González-Montelongo, R.; Lobo, M.G.; González, M. Antioxidant activity in banana peel extracts: Testing extraction conditions and related bioactive compounds. Food Chem. 2010, 119, 1030–1039. [Google Scholar] [CrossRef] [Scilit]
  82. Fatemeh, S.R.; Saifullah, R.; Abbas, F.M.A.; Azhar, M.E. Total phenolics, flavonoids and antioxidant activity of banana pulp and peel flours: Influence of variety and stage of ripeness. Int. Food Res. J. 2012, 19, 1041. [Google Scholar]
  83. Tanvir, E.M.; Hossen, M.; Hossain, M.; Afroz, R.; Gan, S.H.; Khalil, M.; Karim, N. Antioxidant properties of popular turmeric (Curcuma longa) varieties from Bangladesh. J. Food Qual. 2017, 2017, 8471785. [Google Scholar] [CrossRef] [Scilit]
  84. Sadhasivam, S.; Shapiro, O.H.; Ziv, C.; Barda, O.; Zakin, V.; Sionov, E. Synergistic inhibition of mycotoxigenic fungi and mycotoxin production by combination of pomegranate peel extract and azole fungicide. Front. Microbiol. 2019, 10, 1919. [Google Scholar] [CrossRef] [Scilit]
  85. Hua, S.; Grosjean, O.; Baker, J.L. Inhibition of aflatoxin biosynthesis by phenolic compounds. Lett. Appl. Microbiol. 1999, 29, 289–291. [Google Scholar] [CrossRef] [Scilit]
  86. Youssef, N.H.; Qari, S.H.; Behiry, S.I.; Dessoky, E.S.; El-Hallous, E.I.; Elshaer, M.M.; Kordy, A.; Maresca, V.; Abdelkhalek, A.; Heflish, A.A. Antimycotoxigenic Activity of Beetroot Extracts against Altenaria alternata Mycotoxins on Potato Crop. Appl. Sci. 2021, 11, 4239. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Effect of plant extracts on A. flavus mat dry weight (mass ratio %) and AFB1 production ratio (PR%).
Figure 1. Effect of plant extracts on A. flavus mat dry weight (mass ratio %) and AFB1 production ratio (PR%).
Sustainability 14 12908 g001
Figure 2. Expression of aflD, aflP, and aflQ (structural genes) and aflR and aflS genes control key limiting steps in the aflatoxin B1 (AFB1) biosynthetic pathway. The different letters above the columns mean the indicated values were significantly different at p ≤ 0.05.
Figure 2. Expression of aflD, aflP, and aflQ (structural genes) and aflR and aflS genes control key limiting steps in the aflatoxin B1 (AFB1) biosynthetic pathway. The different letters above the columns mean the indicated values were significantly different at p ≤ 0.05.
Sustainability 14 12908 g002
Table 1. Maize grain approval criteria according to changes in grain shape/odor and trait scale.
Table 1. Maize grain approval criteria according to changes in grain shape/odor and trait scale.
Grain Shape ChangeOdor ChangeApprovingScale
Whole grains (no change in shape) No smellHighly approved5
Very simple very simpleVery very approved4
Moderate ModerateVery approved3
GreatGreatApproved2
SeverPungentUnapproved1
Table 2. Primers used in this study and their corresponding aflatoxin biosynthesis genes show the enzymes responsible for their functions.
Table 2. Primers used in this study and their corresponding aflatoxin biosynthesis genes show the enzymes responsible for their functions.
Target GeneSequences (5′-3′)Function in the Biosynthetic PathwayTarget Size (bp)
β-tubulin (benA)Forward: CTTGTTGACCAGGTTGTGGAT
Reverse: GTCGCAGCCCTCAGCCT
Reference housekeeping gene51
aflD (nor-1)Forward: GTCCAAGCAACAGGCCAAGT
Reverse: TCGTGCATGTTGGTGATGGT
Norsolorinic acid (NOR) → Averantin 9 (AVN)66
aflP (omtA)Forward: GGCCGCCGCTTTGATCTAGG
Reverse: ACCACGACCGCCGCC
Sterigmatocystin (ST) → O-methylsterigmatocystin (OMST)123
aflQ (ordA)Forward: GTGTCCGCAGTGTCTAGCTT
Reverse: GCTCAAAGGTCGCCAGAGTA
O-methylsterigmatocystin (OMST) → aflatoxin B1 (AFB1)115
aflRForward: CTCAAGGTGCTGGCATGGTA
Reverse: CAGCTGCCACTGTTGGTTTC
Pathway regulator86
aflSForward: CTGCAGCTATATTGCCCACA
Reverse: TAAACCCAGGCAGAGTTGGT
Pathway regulator117
Table 3. The ability of plant extracts to affect AFB1 production from A. flavus in stored inoculated maize grains.
Table 3. The ability of plant extracts to affect AFB1 production from A. flavus in stored inoculated maize grains.
TreatmentsSolvent ConcentrationAFB1 (ppb)PI%PR%
Healthy moistened control-0.00--
Infected control-425-100
Wheat bran Acetone 25%51.18 87.9612.04
Turmeric Ethanol 25%4.46 98.951.05
Taro Acetone 25%69.01 83.7616.24
Topsin2.5 mg/mL143.9266.1443.96
Table 4. Effect of plant extracts on grain appearance and smell compared to the control fungicide Topsin.
Table 4. Effect of plant extracts on grain appearance and smell compared to the control fungicide Topsin.
TreatmentsSolvent ConcentrationGrain ShapeSmellGranted Grade
Healthy moistened control-505
Infected control-050
Wheat branAcetone 25%434
TurmericEthanol 25%515
TaroAcetone 25%414
Topsin2.5 mg/mL151
Table 5. Plant extracts total phenolic contents (TPC) and their antioxidant activity (AA).
Table 5. Plant extracts total phenolic contents (TPC) and their antioxidant activity (AA).
Plant ExtractSolvent ConcentrationTPC (mgGAE/g dry Extract wt) ± SDAA (μg/mL)
Ascorbic acid--4.28
Wheat branAcetone 25%46.08 ± 0.5459.41
TurmericEthanol 25%49.82 ± 1.9974.16
TaroAcetone 25%61.28 ± 0.647.45
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Behiry, S.I.; Hamad, N.A.; Alotibi, F.O.; Al-Askar, A.A.; Arishi, A.A.; Kenawy, A.M.; Elsamra, I.A.; Youssef, N.H.; Elsharkawy, M.M.; Abdelkhalek, A.; et al. Antifungal and Antiaflatoxigenic Activities of Different Plant Extracts against Aspergillus flavus. Sustainability 2022, 14, 12908. https://doi.org/10.3390/su141912908

AMA Style

Behiry SI, Hamad NA, Alotibi FO, Al-Askar AA, Arishi AA, Kenawy AM, Elsamra IA, Youssef NH, Elsharkawy MM, Abdelkhalek A, et al. Antifungal and Antiaflatoxigenic Activities of Different Plant Extracts against Aspergillus flavus. Sustainability. 2022; 14(19):12908. https://doi.org/10.3390/su141912908

Chicago/Turabian Style

Behiry, Said I., Najwa A. Hamad, Fatimah O. Alotibi, Abdulaziz A. Al-Askar, Amr A. Arishi, Ahmed M. Kenawy, Ibrahim A. Elsamra, Nesrine H. Youssef, Mohsen Mohamed Elsharkawy, Ahmed Abdelkhalek, and et al. 2022. "Antifungal and Antiaflatoxigenic Activities of Different Plant Extracts against Aspergillus flavus" Sustainability 14, no. 19: 12908. https://doi.org/10.3390/su141912908

APA Style

Behiry, S. I., Hamad, N. A., Alotibi, F. O., Al-Askar, A. A., Arishi, A. A., Kenawy, A. M., Elsamra, I. A., Youssef, N. H., Elsharkawy, M. M., Abdelkhalek, A., & Heflish, A. A. (2022). Antifungal and Antiaflatoxigenic Activities of Different Plant Extracts against Aspergillus flavus. Sustainability, 14(19), 12908. https://doi.org/10.3390/su141912908

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop