Hygienic Characteristics and Detection of Antibiotic Resistance Genes in Crickets (Acheta domesticus) Breed for Flour Production
Abstract
1. Introduction
2. Materials and Methods
2.1. Crickets Rearing
2.2. Microbiological Analysis
2.3. Antimicrobial Resistance Genes Research by PCR
2.4. Flour Production
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Food and Agriculture Organization of the United Nations (FAO). Edible Insects: Future Prospects for Food and Feed Security; FAO: Rome, Italy, 2013. [Google Scholar]
- Anonymous. Regulation (EU) 2015/2283 of the European Parliament and of the Council of 25 November 2015 on Novel Foods; 2015. [Google Scholar]
- House, J. Consumer acceptance of insect-based foods in the Netherlands: Academic and commercial implications. Appetite 2016, 107, 47–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jongema, Y. List of Edible Insects of the World; Laboratory of Entomology, Wageningen University: Wageningen, The Netherlands,, 2017; Available online: https://www.wur.nl/upload_mm/8/a/6/0fdfc700–3929–4a74–8b69-f02fd35a1696_Worldwide%20list%20of%20edible%20insects%202017.pdf (accessed on 14 June 2021).
- EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA); Allergens, F.; Turck, D.; Castenmiller, J.; De Henauw, S.; Hirsch-Ernst, K.I.; Kearney, J.; Maciuk, A.; Mangelsdorf, I.; McArdle, H.J.; et al. Safety of dried yellow mealworm (Tenebrio molitor larva) as a novel food pursuant to Regulation (EU) 2015/2283. EFSA J. 2021, 19, e06343. [Google Scholar] [CrossRef] [Scilit]
- Efsa Scientific Committee. Risk profile related to production and consumption of insects as food and feed. EFSA J. 2015, 13, 4257. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; Bai, Y.-Y.; Li, J.-H.; Zhang, C.-X. Nutritional value of the field cricket (gryllus testaceus walker). Insect Sci. 2004, 11, 275–283. [Google Scholar] [CrossRef] [Scilit]
- Raheem, D.; Raposo, A.; Oluwole, O.B.; Nieuwland, M.; Saraiva, A.; Carrascosa, C. Entomophagy: Nutritional, ecological, safety and legislation aspects. Food Res. Int. 2019, 126, 108672. [Google Scholar] [CrossRef] [Scilit]
- Oonincx, D.G.A.B.; de Boer, I.J.M. Environmental Impact of the Production of Mealworms as a Protein Source for Humans—A Life Cycle Assessment. PLoS ONE 2012, 7, e51145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Huis, A. Edible insects are the future? Proc. Nutr. Soc. 2016, 75, 294–305. [Google Scholar] [CrossRef] [Scilit]
- Patton, R.L. Growth and Development Parameters for Acheta domesticus1,2. Ann. Entomol. Soc. Am. 1978, 71, 40–42. [Google Scholar] [CrossRef] [Scilit]
- Kao, S.J.; You, I.; Clewell, D.B.; Donabedian, S.M.; Zervos, M.J.; Petrin, J.; Shaw, K.J.; Chow, J.W. Detection of the high-level aminoglycoside resistance gene aph(2′′)-Ib in Enterococcus faecium. Antimicrob. Agents Chemother. 2000, 44, 2876–2879. [Google Scholar] [CrossRef] [Scilit]
- Martineau, F.; Picard, F.J.; Grenier, L.; Roy, P.H.; Ouellette, M.; Bergeron, M.G. Multiplex PCR assays for the detection of clinically relevant antibiotic resistance genes in staphylococci isolated from patients infected after cardiac surgery. The ESPRIT Trial. J. Antimicrob. Chemother. 2000, 46, 527–534. [Google Scholar] [CrossRef] [Scilit]
- Cenci-Goga, B.T.; Crotti, S.; Costarelli, S.; Rondini, C.; Karama, M.; Bennett, P. Detection of tet(M) gene from raw milk by rapid DNA extraction followed by a two-step PCR with nested primers. J. Food Prot. 2004, 67, 2833–2838. [Google Scholar] [CrossRef] [Scilit]
- Kozak, G.K.; Boerlin, P.; Janecko, N.; Reid-Smith, R.J.; Jardine, C. Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada. Appl. Environ. Microbiol. 2009, 75, 559–566. [Google Scholar] [CrossRef] [Scilit]
- Gjerris, M.; Gamborg, C.; Röcklinsberg, H. Ethical aspects of insect production for food and feed. J. Insects Food Feed 2016, 2, 101–110. [Google Scholar] [CrossRef] [Scilit]
- Anonymous. Commission Regulation (EC) No 2073/2005 of 15 November 2005 on Microbiological Criteria for Foodstuffs; 2005. [Google Scholar]
- Caparros Megido, R.; Desmedt, S.; Blecker, C.; Béra, F.; Haubruge, É.; Alabi, T.; Francis, F. Microbiological Load of Edible Insects Found in Belgium. Insects 2017, 8, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernandez-Cassi, X.; Supeanu, A.; Jansson, A.; Boqvist, S.; Vagsholm, I. Novel foods: A risk profile for the house cricket (Acheta domesticus). EFSA J. 2018, 16, e16082. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cazemier, A.E.; Hackstein, J.H.P.; Op den Camp, H.J.M.; Rosenberg, J.; van der Drift, C. Bacteria in the Intestinal Tract of Different Species of Arthropods. Microb. Ecol. 1997, 33, 189–197. [Google Scholar] [CrossRef] [Scilit]
- Vandeweyer, D.; Crauwels, S.; Lievens, B.; Van Campenhout, L. Metagenetic analysis of the bacterial communities of edible insects from diverse production cycles at industrial rearing companies. Int. J. Food Microbiol. 2017, 261, 11–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vandeweyer, D.; Wynants, E.; Crauwels, S.; Verreth, C.; Viaene, N.; Claes, J.; Lievens, B.; Van Campenhout, L. Microbial Dynamics during Industrial Rearing, Processing, and Storage of Tropical House Crickets (Gryllodes sigillatus) for Human Consumption. Appl. Environ. Microbiol. 2018, 84. [Google Scholar] [CrossRef] [Scilit]
- Boomsma, J.J.; Jensen, A.B.; Meyling, N.V.; Eilenberg, J. Evolutionary interaction networks of insect pathogenic fungi. Annu. Rev. Entomol. 2014, 59, 467–485. [Google Scholar] [CrossRef] [Scilit]
- Cenci-Goga, B.T.; Sechi, P.; Karama, M.; Ciavarella, R.; Pipistrelli, M.V.; Goretti, E.; Elia, A.C.; Gardi, T.; Pallottini, M.; Rossi, R.; et al. Cross-sectional study to identify risk factors associated with the occurrence of antimicrobial resistance genes in honey bees Apis mellifera) in Umbria, Central Italy. Environ. Sci. Pollut. Res. Int. 2020, 27, 9637–9645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mariano, V.; McCrindle, C.M.; Cenci-Goga, B.; Picard, J.A. Case-control study to determine whether river water can spread tetracycline resistance to unexposed impala (Aepyceros melampus) in Kruger National Park (South Africa). Appl. Environ. Microbiol. 2009, 75, 113–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Milanović, V.; Osimani, A.; Pasquini, M.; Aquilanti, L.; Garofalo, C.; Taccari, M.; Cardinali, F.; Riolo, P.; Clementi, F. Getting insight into the prevalence of antibiotic resistance genes in specimens of marketed edible insects. Int. J. Food Microbiol. 2016, 227, 22–28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garofalo, C.; Osimani, A.; Milanović, V.; Taccari, M.; Cardinali, F.; Aquilanti, L.; Riolo, P.; Ruschioni, S.; Isidoro, N.; Clementi, F. The microbiota of marketed processed edible insects as revealed by high-throughput sequencing. Food Microbiol. 2017, 62, 15–22. [Google Scholar] [CrossRef] [Scilit]
- Osimani, A.; Garofalo, C.; Milanović, V.; Taccari, M.; Cardinali, F.; Aquilanti, L.; Pasquini, M.; Mozzon, M.; Raffaelli, N.; Ruschioni, S.; et al. Insight into the proximate composition and microbial diversity of edible insects marketed in the European Union. Eur. Food Res. Technol. 2017, 243, 1157–1171. [Google Scholar] [CrossRef] [Scilit]
- Osimani, A.; Milanović, V.; Garofalo, C.; Cardinali, F.; Roncolini, A.; Sabbatini, R.; De Filippis, F.; Ercolini, D.; Gabucci, C.; Petruzzelli, A.; et al. Revealing the microbiota of marketed edible insects through PCR-DGGE, metagenomic sequencing and real-time PCR. Int. J. Food Microbiol. 2018, 276, 54–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Target Gene | Description | Nucleotide Sequence (5’-3’) | Ampl (bp) | Amplification |
|---|---|---|---|---|
| aph | aac(6′)-aph(2″) gene, which encodes for a bi-functional, aminoglycoside modifying enzyme [12] | GAGCAATAAGGGCATACCAAAAATC CCGTGCATTTGTCTTAAAAAACTGG | 505 bp | 94 °C × 5′; (94 °C × 30″, 55 °C × 30″, 72 × 30″) × 35 cycles, 72 °C × 7’ |
| blaZ | blaZ gene, which encodes for the predominantly β-lactamase in S. aureus [13] | ACTTCAACACCTGCTGCTTTC TGACCACTTTTATCAGCAACC | 173 bp | 94 °C × 4′; (94 °C × 30″, 58 °C × 30″, 72 × 30″) × 30 cycles, 72 °C × 7’ |
| tetM | tetM gene, which encodes for a tetracycline resistance protein [14] | ACCCGTATACTATTTCATGCACT CCTTCCATAACCGCATTTTG | 1115 bp | 95 °C × 3′; (95 °C × 1′, 48 °C × 1′, 72 × 1′) × 35 cycles, 72 °C × 10’ |
| sul1 | sul1 gene normally found in class 1 integrons, which encodes for a form of dihydropteroate synthase responsible for sulphonamide resistance in gram-negative bacilli [15] | CGGCGTGGGCTACCTGAACG GCCGATCGCGTGAAGTTCCG | 433 bp | 94 °C × 3′; (94 °C × 15″, 69 °C × 30″, 72 × 1′) × 30 cycles, 72 °C × 7’ |
| PCA | PS 103 | VRBL | VRBG | ENT | MRS | BP | CYG | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mean | s.d. | Mean | s.d. | Mean | s.d. | Mean | s.d. | Mean | s.d. | Mean | s.d. | Mean | s.d. | Mean | s.d. | |
| T0 | 4.44 | 1.14 | 3.63 | 1.44 | 3.56 | 0.66 | 3.49 | 0.64 | 4.28 | 0.82 | 4.70 | 0.97 | 3.74 | 0.99 | 2.06 | 1.24 |
| T7 | 3.71 | 0.78 | 2.10 | 0.91 | 2.38 | 1.21 | 2.48 | 1.16 | 3.74 | 1.18 | 4.14 | 0.98 | 2.14 | 0.59 | 1.50 | 0.71 |
| T14 | 3.90 | 1.58 | 3.30 | 0.71 | 3.13 | 0.83 | 3.29 | 0.92 | 3.56 | 1.06 | 4.39 | 0.89 | 3.33 | 0.98 | 2.00 | |
| T21 | 3.71 | 1.03 | 4.48 | 3.10 | 1.56 | 2.80 | 1.30 | 2.83 | 0.34 | 3.60 | 1.34 | 2.50 | 0.58 | 2.00 | ||
| T28 | 4.59 | 1.50 | 2.00 | 2.34 | 0.31 | 2.41 | 0.35 | 5.49 | 0.34 | 5.21 | 0.53 | 1.23 | 0.40 | 1.89 | 0.16 | |
| T42 | 4.90 | 0.62 | 3.73 | 0.53 | 3.77 | 0.91 | 4.38 | 0.59 | 5.05 | 0.47 | 3.97 | 0.31 | ||||
| T49 | 5.61 | 1.06 | 4.92 | 0.45 | 4.66 | 0.51 | 5.32 | 0.55 | 5.40 | 0.93 | 5.86 | 1.12 | 3.91 | 0.72 | ||
| T56 | 4.38 | 1.46 | 2.68 | 0.88 | 2.35 | 0.78 | 2.64 | 0.83 | 4.60 | 0.68 | 4.38 | 0.96 | 4.25 | 1.43 | ||
| T63 | 5.38 | 0.28 | 3.71 | 0.89 | 4.38 | 0.81 | 4.68 | 0.33 | 5.08 | 0.53 | 4.77 | 0.46 | 3.14 | 0.32 | ||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Grispoldi, L.; Karama, M.; El-Ashram, S.; Saraiva, C.M.; García-Díez, J.; Chalias, A.; Barbera, S.; Cenci-Goga, B.T. Hygienic Characteristics and Detection of Antibiotic Resistance Genes in Crickets (Acheta domesticus) Breed for Flour Production. Microbiol. Res. 2021, 12, 503-512. https://doi.org/10.3390/microbiolres12020034
Grispoldi L, Karama M, El-Ashram S, Saraiva CM, García-Díez J, Chalias A, Barbera S, Cenci-Goga BT. Hygienic Characteristics and Detection of Antibiotic Resistance Genes in Crickets (Acheta domesticus) Breed for Flour Production. Microbiology Research. 2021; 12(2):503-512. https://doi.org/10.3390/microbiolres12020034
Chicago/Turabian StyleGrispoldi, Luca, Musafiri Karama, Saeed El-Ashram, Cristina Maria Saraiva, Juan García-Díez, Athanasios Chalias, Salvatore Barbera, and Beniamino T. Cenci-Goga. 2021. "Hygienic Characteristics and Detection of Antibiotic Resistance Genes in Crickets (Acheta domesticus) Breed for Flour Production" Microbiology Research 12, no. 2: 503-512. https://doi.org/10.3390/microbiolres12020034
APA StyleGrispoldi, L., Karama, M., El-Ashram, S., Saraiva, C. M., García-Díez, J., Chalias, A., Barbera, S., & Cenci-Goga, B. T. (2021). Hygienic Characteristics and Detection of Antibiotic Resistance Genes in Crickets (Acheta domesticus) Breed for Flour Production. Microbiology Research, 12(2), 503-512. https://doi.org/10.3390/microbiolres12020034

