Influence of Excipient Composition on Survival of Vaginal Lactobacilli in Electrospun Nanofibers
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Storage and Culturing
2.2. Growth Characteristics of Lactobacilli in the Presence of Different Excipients
2.3. Preparation of Lactobacilli Dispersion in Polymer Solutions
2.4. Preparation of Nanofibers
2.5. Scanning Electron Microscopy
2.6. Thermal Analyses
2.7. Fourier Transform Infrared Spectroscopy (FTIR)
2.8. Bacterial Viability in Polymer Solutions
2.9. Bacterial Viability in Nanofibers after Electrospinning and Long-Term Storage
2.10. Colony PCR for Bacterial Identification after Nanofiber Dissolution
2.11. Statistical Analysis
3. Results
3.1. Primary Screening of the Effect of Carbohydrates on the Growth of Vaginal Lactobacilli
3.2. Bacterial Viability in Different Polymer Solutions
3.3. Nanofiber Morphology
3.4. Crystallinity and Moisture Content in Nanofibers
3.5. Interaction between Lactobacilli and Excipients
3.6. Viability of Vaginal Lactobacilli in Different Nanofiber Formulations Immediately after Incorporation and after Long-Term Storage
3.7. Identification of Vaginal Lactobacilli after Release from Nanofibers
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Suez, J.; Zmora, N.; Segal, E.; Elinav, E. The pros, cons, and many unknowns of probiotics. Nat. Med. 2019, 25, 716–729. [Google Scholar] [CrossRef] [PubMed]
- Petrova, M.I.; Lievens, E.; Malik, S.; Imholz, N.; Lebeer, S. Lactobacillus species as biomarkers and agents that can promote various aspects of vaginal health. Front. Physiol. 2015, 6, 81. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.M.; Park, Y.J. Probiotics in the Prevention and treatment of postmenopausal vaginal infections: Review article. J. Menopausal Med. 2017, 23, 139–145. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, Y.P.; Chen, W.C.; Cheng, C.M.; Shen, C.J. Vaginal pH value for clinical diagnosis and treatment of common vaginitis. Diagnostics 2021, 11, 1996. [Google Scholar] [CrossRef]
- Heczko, P.B.; Tomusiak, A.; Adamski, P.; Jakimiuk, A.J.; Stefański, G.; Mikołajczyk-Cichońska, A.; Suda-Szczurek, M.; Strus, M. Supplementation of standard antibiotic therapy with oral probiotics for bacterial vaginosis and aerobic vaginitis: A randomised, double-blind, placebo-controlled trial. BMC Women’s Health 2015, 15, 115. [Google Scholar] [CrossRef] [Green Version]
- Homayouni, A.; Bastani, P.; Ziyadi, S.; Mohammad-Alizadeh-Charandabi, S.; Ghalibaf, M.; Mortazavian, A.M.; Mehrabany, E.V. Effects of probiotics on the recurrence of bacterial vaginosis: A review. J. Low. Genit. Tract Dis. 2014, 18, 79–86. [Google Scholar] [CrossRef]
- Pino, A.; Rapisarda, A.M.C.; Vitale, S.G.; Cianci, S.; Caggia, C.; Randazzo, C.L.; Cianci, A. A clinical pilot study on the effect of the probiotic Lacticaseibacillus rhamnosus TOM 22.8 strain in women with vaginal dysbiosis. Sci. Rep. 2021, 11, 2592. [Google Scholar] [CrossRef]
- Tomusiak, A.; Strus, M.; Heczko, P.B.; Adamski, P.; Stefanski, G.; Mikolajczyk-Cichonska, A.; Suda-Szczurek, M. Efficacy and safety of a vaginal medicinal product containing three strains of probiotic bacteria: A multicenter, randomized, double-blind, and placebo-controlled trial. Drug Des. Dev. Ther. 2015, 9, 5345–5354. [Google Scholar] [CrossRef] [Green Version]
- Cribby, S.; Taylor, M.; Reid, G. Vaginal microbiota and the use of probiotics. Interdiscip. Perspect Infect. Dis. 2008, 2008, 256490. [Google Scholar] [CrossRef]
- Borges, S.; Barbosa, J.; Teixeira, P. Drug delivery systems for vaginal infections. In Frontiers in Clinical Drug Research: Anti-Infectives; Rahman, A.U., Ed.; Bentham Science Publishers: Sharjah, United Arab Emirates, 2015; Volume 2, pp. 233–258. [Google Scholar]
- Tomas, M.S.J.; Ocana, V.S.; Nader-Macias, M.E. Viability of vaginal probiotic lactobacilli during refrigerated and frozen storage. Anaerobe 2004, 10, 1–5. [Google Scholar] [CrossRef]
- Krasaekoopt, W.; Bhandari, B. Properties and applications of different probiotic delivery systems. In Encapsulation Technologies and Delivery Systems for Food Ingredients and Nutraceuticals; Garti, N., McClements, D.J., Eds.; Woodhead Publishing: Sawston, UK, 2012; pp. 541–594. [Google Scholar]
- Asgari, S.; Pourjavadi, A.; Licht, T.R.; Boisen, A.; Ajalloueian, F. Polymeric carriers for enhanced delivery of probiotics. Adv. Drug Deliv. Rev. 2020, 161–162, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Stojanov, S.; Berlec, A. Electrospun Nanofibers as carriers of microorganisms, stem cells, proteins, and nucleic acids in therapeutic and other applications. Front. Bioeng. Biotech. 2020, 8, 130. [Google Scholar] [CrossRef] [PubMed]
- Torres-Martinez, E.J.; Bravo, J.M.C.; Medina, A.S.; Gonzalez, G.L.P.; Gomez, L.J.V. A summary of electrospun nanofibers as drug delivery system: Drugs loaded and biopolymers used as matrices. Curr. Drug Deliv. 2018, 15, 1360–1374. [Google Scholar] [CrossRef] [PubMed]
- Luraghi, A.; Peri, F.; Moroni, L. Electrospinning for drug delivery applications: A review. J. Control. Release 2021, 334, 463–484. [Google Scholar] [CrossRef] [PubMed]
- Sofi, H.S.; Abdal-hay, A.; Ivanovski, S.; Zhang, Y.S.; Sheikh, F.A. Electrospun nanofibers for the delivery of active drugs through nasal, oral and vaginal mucosa: Current status and future perspectives. Mater. Sci. Eng. C 2020, 111, 110756. [Google Scholar] [CrossRef]
- Krogstad, E.M.; Ramanathan, R.; Nhan, C.; Kraft, J.C.; Blakney, A.K.; Cao, S.; Ho, R.J.Y.; Woodrow, K.A. Nanoparticle-releasing nanofiber composites for enhanced in vivo vaginal retention. Biomaterials 2017, 144, 1–16. [Google Scholar] [CrossRef]
- Zupančič, Š.; Škrlec, K.; Kocbek, P.; Kristl, J.; Berlec, A. Effects of electrospinning on the viability of ten species of lactic acid bacteria in poly(ethylene oxide) nanofibers. Pharmaceutics 2019, 11, 483. [Google Scholar] [CrossRef] [Green Version]
- Škrlec, K.; Zupančič, Š.; Mihevc, S.P.; Kocbek, P.; Kristl, J.; Berlec, A. Development of electrospun nanofibers that enable high loading and long-term viability of probiotics. Eur. J. Pharm. Biopharm. 2019, 136, 108–119. [Google Scholar] [CrossRef]
- Yu, H.L.; Liu, W.H.; Li, D.M.; Liu, C.H.; Feng, Z.B.; Jiang, B. Targeting delivery system for Lactobacillus plantarum based on functionalized electrospun nanofibers. Polymers 2020, 12, 1565. [Google Scholar] [CrossRef]
- Amna, T.; Hassan, M.S.; Pandeya, D.R.; Khil, M.S.; Hwang, I.H. Classy non-wovens based on animate L. gasseri-inanimate poly(vinyl alcohol): Upstream application in food engineering. Appl. Microbiol. Biotechnol. 2013, 97, 4523–4531. [Google Scholar] [CrossRef]
- Stojanov, S.; Plavec, T.V.; Kristl, J.; Zupančič, Š.; Berlec, A. Engineering of vaginal lactobacilli to express fluorescent proteins enables the analysis of their mixture in nanofibers. Int. J. Mol. Sci. 2021, 22, 13631. [Google Scholar] [CrossRef] [PubMed]
- Nagy, Z.K.; Wagner, I.; Suhajda, A.; Tobak, T.; Harasztos, A.H.; Vigh, T.; Soti, P.L.; Pataki, H.; Molnar, K.; Marosi, G. Nanofibrous solid dosage form of living bacteria prepared by electrospinning. Express Polym. Lett. 2014, 8, 352–361. [Google Scholar] [CrossRef] [Green Version]
- Silva, J.A.; De Gregorio, P.R.; Rivero, G.; Abraham, G.A.; Nader-Macias, M.E.F. Immobilization of vaginal Lactobacillus in polymeric nanofibers for its incorporation in vaginal probiotic products. Eur. J. Pharm. Sci. 2021, 156, 105563. [Google Scholar] [CrossRef]
- Bodzen, A.; Jossier, A.; Dupont, S.; Mousset, P.Y.; Beney, L.; Lafay, S.; Gervais, P. Design of a new lyoprotectant increasing freeze-dried Lactobacillus strain survival to long-term storage. BMC Biotechnol. 2021, 21, 66. [Google Scholar] [CrossRef] [PubMed]
- Hirsch, E.; Pantea, E.; Vass, P.; Domján, J.; Molnár, M.; Suhajda, Á.; Andersen, S.K.; Vigh, T.; Verreck, G.; Marosi, G.J.; et al. Probiotic bacteria stabilized in orally dissolving nanofibers prepared by high-speed electrospinning. Food Bioprod. Process. 2021, 128, 84–94. [Google Scholar] [CrossRef]
- Wang, X.; Huang, M.; Yang, F.; Sun, H.; Zhou, X.; Guo, Y.; Wang, X.; Zhang, M. Rapeseed polysaccharides as prebiotics on growth and acidifying activity of probiotics in vitro. Carbohydr. Polym. 2015, 125, 232–240. [Google Scholar] [CrossRef]
- Singdevsachan, S.K.; Auroshree, P.; Mishra, J.; Baliyarsingh, B.; Tayung, K.; Thatoi, H. Mushroom polysaccharides as potential prebiotics with their antitumor and immunomodulating properties: A review. Bioact. Carbohydr. Diet. Fibre 2016, 7, 1–14. [Google Scholar] [CrossRef]
- Sofi, H.S.; Ashraf, R.; Khan, A.H.; Beigh, M.A.; Majeed, S.; Sheikh, F.A. Reconstructing nanofibers from natural polymers using surface functionalization approaches for applications in tissue engineering, drug delivery and biosensing devices. Mater. Sci. Eng. C 2019, 94, 1102–1124. [Google Scholar] [CrossRef]
- Stojanov, S.; Ravnikar, M.; Berlec, A.; Kreft, S. Interaction between silver fir (Abies alba) wood water extract and lactobacilli. Die Pharm. 2021, 76, 614–617. [Google Scholar]
- Baranyi, J.; Roberts, T.A. A dynamic approach to predicting bacterial growth in food. Int. J. Food Microbiol. 1994, 23, 277–294. [Google Scholar] [CrossRef]
- Herigstad, B.; Hamilton, M.; Heersink, J. How to optimize the drop plate method for enumerating bacteria. J. Microbiol. Methods 2001, 44, 121–129. [Google Scholar] [CrossRef]
- Ristić, T.; Lasič, S.; Kosalec, I.; Bračič, M.; Fras-Zemljič, L. The effect of chitosan nanoparticles onto Lactobacillus cells. React. Funct. Polym. 2015, 97, 56–62. [Google Scholar] [CrossRef]
- Arunkumar, R.; Drummond, C.J.; Greaves, T.L. FTIR Spectroscopic Study of the Secondary Structure of Globular Proteins in Aqueous Protic Ionic Liquids. Front. Chem. 2019, 7, 74. [Google Scholar] [CrossRef] [PubMed]
- Kong, J.; Yu, S. Fourier transform infrared spectroscopic analysis of protein secondary structures. Acta Biochim. Et Biophys. Sin. 2007, 39, 549–559. [Google Scholar] [CrossRef] [Green Version]
- Ganzle, M.G.; Follador, R. Metabolism of oligosaccharides and starch in lactobacilli: A review. Front. Microbiol. 2012, 3, 340. [Google Scholar] [CrossRef] [Green Version]
- Nag, A.; Das, S. Effect of trehalose and lactose as cryoprotectant during freeze-drying, in vitro gastro-intestinal transit and survival of microencapsulated freeze-dried Lactobacillus casei 431 cells. Int. J. Dairy Technol. 2013, 66, 162–169. [Google Scholar] [CrossRef]
- Leslie, S.B.; Israeli, E.; Lighthart, B.; Crowe, J.H.; Crowe, L.M. Trehalose and sucrose protect both membranes and proteins in intact bacteria during drying. Appl. Environ. Microb. 1995, 61, 3592–3597. [Google Scholar] [CrossRef] [Green Version]
- Collins, S.L.; McMillan, A.; Seney, S.; van der Veer, C.; Kort, R.; Sumarah, M.W.; Reid, G. Promising prebiotic candidate established by evaluation of lactitol, lactulose, raffinose, and oligofructose for maintenance of a Lactobacillus-dominated vaginal microbiota. Appl. Environ. Microbiol. 2018, 84, e02200-17. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Han, F.; Hu, B.; Li, J.; Yu, W. In vivo prebiotic properties of alginate oligosaccharides prepared through enzymatic hydrolysis of alginate. Nut. Res. 2006, 26, 597–603. [Google Scholar] [CrossRef]
- Heunis, T.D.; Botes, M.; Dicks, L.M. Encapsulation of Lactobacillus plantarum 423 and its bacteriocin in nanofibers. Probiotics Antimicrob. 2010, 2, 46–51. [Google Scholar] [CrossRef]
- Knop, K.; Hoogenboom, R.; Fischer, D.; Schubert, U.S. Poly(ethylene glycol) in drug delivery: Pros and cons as well as potential alternatives. Angew. Chem. Int. Ed. 2010, 49, 6288–6308. [Google Scholar] [CrossRef] [PubMed]
- Mokhena, T.C.; Mochane, M.J.; Mtibe, A.; John, M.J.; Sadiku, E.R.; Sefadi, J.S. Electrospun alginate nanofibers toward various applications: A review. Materials 2020, 13, 934. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mirtič, J.; Balažic, H.; Zupančič, Š.; Kristl, J. Effect of solution composition variables on electrospun alginate nanofibers: Response surface analysis. Polymers 2019, 11, 692. [Google Scholar] [CrossRef] [Green Version]
- Vigani, B.; Rossi, S.; Milanesi, G.; Bonferoni, M.C.; Sandri, G.; Bruni, G.; Ferrari, F. Electrospun alginate fibers: Mixing of two different poly(ethylene oxide) grades to improve fiber functional properties. Nanomaterials 2018, 8, 971. [Google Scholar] [CrossRef] [Green Version]
- Diep, E.; Schiffman, J.D. Encapsulating bacteria in alginate-based electrospun nanofibers. Biomater. Sci. 2021, 9, 4364–4373. [Google Scholar] [CrossRef] [PubMed]
- Bratcher, D.F. Other gram-positive bacilli. In Principles and Practice of Pediatric Infectious Diseases; Long, S.S., Prober, C.G., Fischer, M., Eds.; Elsevier Inc.: Amsterdam, The Netherlands, 2018; pp. 786–790. [Google Scholar]
- Talwalkar, A.; Kailasapathy, K. The role of oxygen in the viability of probiotic bacteria with reference to L. acidophilus and Bifidobacterium spp. Curr. Issues Intest. Microbiol. 2004, 5, 1–8. [Google Scholar]
- Maldonado, K.A.; Mohiuddin, S.S. Biochemistry, Hypertonicity; StatPearls: Treasure Island, FL, USA, 2022. [Google Scholar]
- Josef, E.; Guterman, R. Designing solutions for electrospinning of poly(ionic liquid)s. Macromolecules 2019, 52, 5223–5230. [Google Scholar] [CrossRef] [Green Version]
- Beglou, M.J.; Haghi, A.K. Electrospun biodegdadable and biocompatible natural nanofibers: A detailed review. Cell. Chem. Technol. 2008, 42, 441–462. [Google Scholar]
- Lorson, T.; Ruopp, M.; Nadernezhad, A.; Eiber, J.; Vogel, U.; Jungst, T.; Luhmann, T. Sterilization methods and their influence on physicochemical properties and bioprinting of alginate as a bioink component. ACS Omega 2020, 5, 6481–6486. [Google Scholar] [CrossRef]
- Barghouthi, S.A. A universal method for the identification of bacteria based on general PCR primers. Indian J. Microbiol. 2011, 51, 430–444. [Google Scholar] [CrossRef] [Green Version]
- Bergkessel, M.; Guthrie, C. Colony PCR. Method Enzym. 2013, 529, 299–309. [Google Scholar]
- Santos, M.I.; Gerbino, E.; Tymczyszyn, E.; Gomez-Zavaglia, A. Applications of infrared and raman spectroscopies to probiotic investigation. Foods 2015, 4, 283–305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zupančič, S.; Potrč, T.; Baumgartner, S.; Kocbek, P.; Kristl, J. Formulation and evaluation of chitosan/polyethylene oxide nanofibers loaded with metronidazole for local infections. Eur. J. Pharm. Sci. 2016, 95, 152–160. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Primer Sequence (5′–3′) | Specificity | GenBank Target |
---|---|---|---|
Lgas-F | TCGTCGCGGTATTGAAACTG | L. gasseri | EF571590.1 |
Lgas-R | AAGGGTTGTCTAAGTCGGCT | L. gasseri | EF571590.1 |
Lcri-F | GCAGGCGATCGGATTCAAAT | L. crispatus | KF316678.1 |
Lcri-R | GGCCGTTGAAGTTTCTGGTT | L. crispatus | KF316678.1 |
Ljen-F | GGTCATGGTCTTGGTCTTGG | L. jensenii | CP018809.1 |
Ljen-R | GCAAATCATTGTGGTCAACG | L. jensenii | CP018809.1 |
Sample | PEO Melting | Sucrose Melting | Moisture Content % | ||||
---|---|---|---|---|---|---|---|
Theoretical Enthalpy (J/g) | Enthalpy (J/g) | Peak Temperature (°C) | Theoretical Enthalpy (J/g) | Enthalpy (J/g) | Peak Temperature (°C) | ||
PEO | −186.8 | −186.8 | 70.8 | - | - | - | 0 |
PEO nanofibers | −186.8 | −109.4 | 66.4 | - | - | - | 0 |
ALG | - | - | - | - | - | - | 12.3 |
PEO/ALG physical mixture (80/20) | −149.5 | −152.81 | 70.6 | - | - | - | - |
PEO/ALG nanofibers (80/20) | −149.5 | −81.1 | 60.4 | - | - | - | 2.4 |
SUC | - | - | - | −178.3 | −178.3 | 191.9 | 0 |
PEO/ALG/SUC physical mixture (40/10/50) | −74.7 | −66.6 | 70.5 | −89.1 | −92.5 | 193.1 | - |
PEO/ALG/SUC nanofibers (40/10/50) | −74.7 | −40.9 | 56.7 | −89.1 | −33.4 | 187.3 | 1.2 |
L. gasseri | - | - | - | - | - | - | 5.1 |
L. gasseri PEO nanofibers | −128.6 | −76.8 | 73.9 | - | - | - | 2.8 |
L. gasseri PEO/ALG nanofibers | −91.2 | −60.3 | 63.8 | - | - | - | 4.1 |
L. gasseri PEO/ALG/SUC nanofibers | −57.7 | −30.9 | 63.3 | −68.8 | −7.2 | 173.4 | 3.5 |
L. crispatus | - | - | - | - | - | - | 5.0 |
L. crispatus PEO nanofibers | −100.8 | −84.8 | 70.9 | - | - | - | 2.6 |
L. crispatus PEO/ALG nanofibers | −79.2 | −60.9 | 64.1 | - | - | - | 3.4 |
L. crispatus PEO/ALG/SUC nanofibers | −48.4 | −27.9 | 63.2 | −57.8 | −6.4 | 167.9 | 3.5 |
L. jensenii | - | - | - | - | - | - | 5.8 |
L. jensenii PEO nanofibers | −119.3 | −83.8 | 71.9 | - | - | - | 1.7 |
L. jensenii PEO/ALG nanofibers | −84.1 | −41.5 | 63.3 | - | - | - | 3.3 |
L. jensenii PEO/ALG/SUC nanofibers | −55.2 | −27.1 | 59.7 | −65.9 | −17.8 | 183.4 | 2.4 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stojanov, S.; Kristl, J.; Zupančič, Š.; Berlec, A. Influence of Excipient Composition on Survival of Vaginal Lactobacilli in Electrospun Nanofibers. Pharmaceutics 2022, 14, 1155. https://doi.org/10.3390/pharmaceutics14061155
Stojanov S, Kristl J, Zupančič Š, Berlec A. Influence of Excipient Composition on Survival of Vaginal Lactobacilli in Electrospun Nanofibers. Pharmaceutics. 2022; 14(6):1155. https://doi.org/10.3390/pharmaceutics14061155
Chicago/Turabian StyleStojanov, Spase, Julijana Kristl, Špela Zupančič, and Aleš Berlec. 2022. "Influence of Excipient Composition on Survival of Vaginal Lactobacilli in Electrospun Nanofibers" Pharmaceutics 14, no. 6: 1155. https://doi.org/10.3390/pharmaceutics14061155
APA StyleStojanov, S., Kristl, J., Zupančič, Š., & Berlec, A. (2022). Influence of Excipient Composition on Survival of Vaginal Lactobacilli in Electrospun Nanofibers. Pharmaceutics, 14(6), 1155. https://doi.org/10.3390/pharmaceutics14061155