Heat Stress Induces Partial Resistance to Tomato Bushy Stunt Virus in Nicotiana benthamiana Via Combined Stress Pathways
Abstract
1. Introduction
2. Results
2.1. Phenotypic and Physiological Effects of Combined Temperature and Viral Stress
2.2. Oxidative Stress and Antioxidant Responses Under Combined Stress Conditions
2.3. Effects of Combined Temperature and Viral Stress on the Accumulation of TBSV Virions and Host Stress-Responsive Markers
3. Discussion
4. Materials and Methods
4.1. Plant Material, Growth Conditions, and Virus Inoculation
4.2. Determination of Chlorophyll Content
4.3. ROS Determination
4.4. Determination of Malondialdehyde (MDA) Content
4.5. Determination of Catalase (CAT) Activity
4.6. Determination of 8-Oxoguanine
4.7. Determination of Viral Particles in Leaves
4.8. Westernblot
4.9. Extraction of Total RNA
4.10. RT-qPCR
4.11. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| TBSV | Tomato bushy stunt virus |
| CAT | Catalase |
| ROS | Reactive oxygen species |
| MDA | Malondialdehyde |
| H2H2 | Hydrogen peroxide |
| HSP | Heat shock proteins |
| OGG1 | 8-oxoguanine DNA glycosylase |
| 8-OxoG | 8-oxoguanine |
References
- Misiou, O.; Koutsoumanis, K. Climate change and its implications for food safety and spoilage. Trends Food Sci. Technol. 2022, 126, 142–152. [Google Scholar] [CrossRef]
- Rao, G.P.; Reddy, M.G. Overview of yield losses due to plant viruses. Appl. Plant Virol. 2020, 531–562. [Google Scholar] [CrossRef]
- Seifert, M.; van Nies, P.; Papini, F.; Arnold, J.; Poranen, M.; Cameron, C.; Depken, M.; Dulin, D. Temperature controlled high-throughput magnetic tweezers show striking difference in activation energies of replicating viral RNA-dependent RNA polymerases. Nucleic Acids Res. 2020, 48, 5591–5602. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Hamborg, Z.; Blystad, D.; Wang, Q. Combining thermotherapy with meristem culture for improved eradication of onion yellow dwarf virus and shallot latent virus from infected in vitro—Cultured shallot shoots. Ann. Appl. Biol. 2020, 178, 442–449. [Google Scholar] [CrossRef]
- Holopainen, J.K.; Gershenzon, J. Multiple stress factors and the emission of plant VOCs. Trends Plant Sci. 2010, 15, 176–184. [Google Scholar] [CrossRef]
- Sardanyés, J.; Alcaide, C.; Gómez, P.; Elena, S. Modelling temperature-dependent dynamics of single and mixed infections in a plant virus. Appl. Math. Model. 2021, 102, 694–705. [Google Scholar] [CrossRef]
- Kim, J.; Jeon, E.J.; Jun, M.; Lee, D.-S.; Lee, S.-J.; Lim, S. Complete genome sequences of two tombusvirus-like viruses identified in Echinacea purpurea seeds. Virus Genes 2024, 60, 572–575. [Google Scholar] [CrossRef]
- Ramachandran, V.; Wyatt, N.; Santiago, E.R.; Barth, H.; Bloomquist, M.; Weiland, J.; Bolton, M. First report of tomato bushy stunt virus naturally infecting sugar beet in the united states. Plant Dis. 2023, 107, 1957. [Google Scholar] [CrossRef]
- Kassanis, B.; Lebeurier, G. The Behaviour of tomato bushy stunt virus and bromegrass mosaic virus at different temperatures in vivo and in vitro. J. Gen. Virol. 1969, 4, 385–395. [Google Scholar] [CrossRef]
- Jeger, M.J. The epidemiology of plant virus disease: Towards a new synthesis. Plants 2020, 9, 1768. [Google Scholar] [CrossRef]
- Omarov, R.; Sparks, K.; Smith, S.; Zindović, J.; Scholthof, H. Biological relevance of a stable biochemical interaction between the tombusvirus-encoded P19 and short interfering RNAs. J. Virol. 2006, 80, 3000–3008. [Google Scholar] [CrossRef] [PubMed]
- Stork, J.; Kovalev, N.; Sasvári, Z.; Nagy, P. RNA chaperone activity of the tombusviral p33 replication protein facilitates initiation of RNA synthesis by the viral RdRp in vitro. Virology 2010, 409, 338–347. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Rajendran, K.; Nagy, P. Characterization of the RNA-binding domains in the replicase proteins of tomato bushy stunt virus. J. Virol. 2003, 77, 9244–9258. [Google Scholar] [CrossRef] [PubMed]
- Gibson, T.; Argos, P. Protruding domain of tomato bushy stunt virus coat protein is a hitherto unrecognized class of jellyroll conformation. J. Mol. Biol. 1990, 212, 7–9. [Google Scholar] [CrossRef]
- Scholthof, H.B.; Scholthof, K.B.; Jackson, A.O. Identification of tomato bushy stunt virus host-specific symptom determinants by expression of individual genes from a potato virus X vector. Plant Cell 1995, 7, 1157–1172. [Google Scholar] [CrossRef][Green Version]
- Lubkowska APluta, W.; Strońska, A.; Lalko, A. Role of heat shock proteins (HSP70 and HSP90) in viral infection. Int. J. Mol. Sci. 2021, 22, 9366. [Google Scholar] [CrossRef]
- Sadura, I.; Libik-Konieczny, M.; Jurczyk, B.; Gruszka, D.; Janeczko, A. HSP transcript and protein accumulation in Brassinosteroid barley mutants acclimated to low and high temperatures. Int. J. Mol. Sci. 2020, 21, 1889. [Google Scholar] [CrossRef]
- Murthy, V.; Ravishankar, K. Molecular mechanisms of heat shock proteins and thermotolerance in plants. In Abiotic Stress Physiology of Horticultural Crops; Springer: New Delhi, India, 2016; pp. 71–83. [Google Scholar] [CrossRef]
- Andrási, N.; Pettkó-Szandtner, A.; Szabados, L. Diversity of plant heat shock factors: Regulation, interactions, and functions. J. Exp. Bot. 2021, 72, 1558–1575. [Google Scholar] [CrossRef]
- Baxter, A.; Mittler, R.; Suzuki, N. ROS as key players in plant stress signalling. J. Exp. Bot. 2014, 65, 1229–1240. [Google Scholar] [CrossRef]
- Scheel, D. Oxidative Burst and The Role of Reactive Oxygen Species in Plant-Pathogen Interactions. In Oxidative Stress in Plants; Inze, D., Van Montagu, M., Eds.; Taylor and Francis: New York, NY, USA, 2002; pp. 137–153. [Google Scholar]
- Roudaire, T.; Héloir, M.C.; Wendehenne, D.; Zadoroznyj, A.; Dubrez, L.; Poinssot, B. Cross kingdom immunity: The role of immune receptors and downstream signaling in animal and plant cell death. Front. Immunol. 2021, 11, 612452. [Google Scholar] [CrossRef]
- Danilova, N. The evolution of immune mechanisms. J. Exp. Zool. Part B Mol. Dev. Evol. 2006, 306, 496–520. [Google Scholar] [CrossRef]
- Chelikani, P.; Fita, I.; Loewen, P.C. Diversity of structures and properties among catalases. Cell. Mol. Life Sci. 2004, 61, 192–208. [Google Scholar] [CrossRef] [PubMed]
- Del Rio, D.; Stewart, A.J.; Pellegrini, N. A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress. Nutr. Metab. Cardiovasc. Dis. 2005, 15, 316–328. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Chen, D.; Grin, I.R.; Zharkov, D.O.; Yu, B. Developing plant-derived DNA repair enzyme resources through studying the involvement of base excision repair DNA glycosylases in stress responses of plants. Physiol. Plant. 2025, 177, e70162. [Google Scholar] [CrossRef] [PubMed]
- Akbar, S.; Wei, Y.; Yuan, Y.; Khan, M.T.; Qin, L.; Powell, C.A.; Chen, B.; Zhang, M. Gene expression profiling of reactive oxygen species (ROS) and antioxidant defense system following Sugarcane mosaic virus (SCMV) infection. BMC Plant Biol. 2020, 20, 532. [Google Scholar] [CrossRef]
- Zhanassova, K.; Satkanov, M.; Samat, A.; Iksat, N.; Bekturova, A.; Zhamanbayeva, M.; Kurmanbayeva, A.; Masalimov, Z. Short-term high temperature stress in plants: Stress markers and cell signaling. Casp. J. Environ. Sci. 2025, 23, 805–844. [Google Scholar] [CrossRef]
- Chellappan, P.; Vanitharani, R.; Ogbe, F.; Fauquet, C.M. Effect of Temperature on Geminivirus-Induced RNA Silencing in Plants. Plant Physiol. 2005, 138, 1828–1841. [Google Scholar] [CrossRef]
- Qu, F.; Morris, T.J. Suppressors of RNA silencing encoded by plant viruses and their role in viral infections. FEBS Lett. 2005, 579, 5958–5964. [Google Scholar] [CrossRef]
- Velázquez, K.; Renovell, A.; Comellas, M.; Serra, P.; García, M.L.; Pina, J.A.; Navarro, L.; Moreno, P.; Guerri, J. Effect of temperature on RNA silencing of a negative-stranded RNA plant virus: Citrus psorosis virus. Plant Pathol. 2010, 59, 982–990. [Google Scholar] [CrossRef]
- Zhang, X.; Zhang, X.; Singh, J.; Li, D.; Qu, F. Temperature-dependent survival of turnip crinkle virus-infected Arabidopsis plants relies on an rna silencing-based defense that requires DCL2, AGO2, and HEN1. J. Virol. 2012, 86, 6847–6854. [Google Scholar] [CrossRef]
- Makarova, S.; Makhotenko, A.; Spechenkova, N.; Love, A.J.; Kalinina, N.O.; Taliansky, M. Interactive responses of potato (Solanum tuberosum L.) Plants to heat stress and infection with potato virus Y. Front. Microbiol. 2018, 9, 2582. [Google Scholar] [CrossRef]
- Ebrahimi, M.; Habashi, A.A.; Emadpour, M.; Kazemi, N. Recovery of virus-free almond (Prunus dulcis) cultivars by somatic embryogenesis from meristem undergone thermotherapy. Sci. Rep. 2022, 12, 14948. [Google Scholar] [CrossRef]
- Knapp, B.D.; Huang, K.C. The Effects of temperature on cellular physiology. Annu. Rev. Biophys. 2022, 51, 499–526. [Google Scholar] [CrossRef]
- Turechek, W.W.; Peres, N.A. Heat treatment effects on strawberry plant survival and angular leaf spot, caused by Xanthomonas fragariae, in nursery production. Plant Dis. 2009, 93, 299–308. [Google Scholar] [CrossRef]
- Pérez-Caselles, C.; Burgos, L.; Yelo, E.; Faize, L.; Alburquerque, N. Production of HSVd- and PPV-free apricot cultivars by in vitro thermotherapy followed by meristem culture. Plant Methods 2025, 21, 23. [Google Scholar] [CrossRef] [PubMed]
- Bettoni, J.C.; Fazio, G.; Carvalho Costa, L.; Hurtado-Gonzales, O.P.; Rwahnih, M.A.; Nedrow, A.; Volk, G.M. Thermotherapy followed by shoot tip cryotherapy eradicates latent viruses and apple hammerhead viroid from in vitro apple rootstocks. Plants 2022, 11, 582. [Google Scholar] [CrossRef] [PubMed]
- Koubouris, G.C.; Maliogka, V.I.; Efthimiou, K.; Katis, N.I.; Vasilakakis, M.D. Elimination of plum pox virus through in vitro thermotherapy and shoot tip culture compared to conventional heat treatment in apricot cultivar Bebecou. J. Gen. Plant Pathol. 2007, 73, 370–373. [Google Scholar] [CrossRef]
- Nagy, P.D.; Lin, W. Taking over cellular energy-metabolism for TBSV replication: The high ATP Requirement of an RNA virus within the viral replication organelle. Viruses 2020, 12, 56. [Google Scholar] [CrossRef]
- Jones, R.W.; Jackson, A.O.; Morris, T.J. Defective-interfering RNAs and elevated temperatures inhibit replication of tomato bushy stunt virus in inoculated protoplasts. Virology 1990, 176, 539–545. [Google Scholar] [CrossRef]
- Pantaleo, V.; Burgyán, J. Cymbidium ringspot virus harnesses rna silencing to control the accumulation of virus parasite satellite RNA. J. Virol. 2008, 82, 11851–11858. [Google Scholar] [CrossRef]
- Tsai, W.A.; Shafiei-Peters, J.R.; Mitter, N.; Dietzgen, R.G. Effects of elevated temperature on the susceptibility of Capsicum plants to capsicum chlorosis virus infection. Pathogens 2022, 11, 200. [Google Scholar] [CrossRef]
- Balachandran, S.; Hurry, V.M.; Kelley, S.E.; Osmond, C.B.; Robinson, S.A.; Rohozinski, J.; Seaton, G.G.R.; Sims, D.A. Concepts of plant biotic stress. Some insights into the stress physiology of virus-infected plants, from the perspective of photosynthesis. Physiol. Plant. 1997, 100, 203–213. [Google Scholar] [CrossRef]
- Ihsan, M.; Khaliq, A.; Siddiqui, M.H.; Ali, L.; Kumar, R.; Ali, H.; Matloob, A.; Fahad, S. The Response of Triticum aestivum treated with plant growth regulators to acute day/night temperature rise. J. Plant Growth Regul. 2022, 41, 2020–2033. [Google Scholar] [CrossRef]
- Obrępalska-Stęplowska, A.; Renaut, J.; Planchon, S.; Przybylska, A.; Wieczorek, P.; Barylski, J.; Palukaitis, P. Effect of temperature on the pathogenesis, accumulation of viral and satellite RNAs and on plant proteome in peanut stunt virus and satellite RNA-infected plants. Front. Plant Sci. 2015, 6, 903. [Google Scholar] [CrossRef] [PubMed]
- Dasgan, H.Y.; Dere, S.; Akhoundnejad, Y.; Arpaci, B.B. Effects of High-Temperature Stress during Plant Cultivation on Tomato (Solanum lycopersicum L.) Fruit Nutrient Content. J. Food Qual. 2021, 2021, 7994417. [Google Scholar] [CrossRef]
- Haque, M.S.; Kjaer, K.H.; Rosenqvist, E.; Sharma, D.K.; Ottosen, C.-O. Heat stress and recovery of photosystem II efficiency in wheat (Triticum aestivum L.) cultivars acclimated to different growth temperatures. Environ. Exp. Bot. 2014, 99, 1–8. [Google Scholar] [CrossRef]
- Lal, M.K.; Tiwari, R.K.; Kumar, A.; Dey, A.; Kumar, R.; Kumar, D.; Jaiswal, A.; Changan, S.S.; Raigond, P.; Dutt, S.; et al. Mechanistic concept of physiological, biochemical, and molecular responses of the potato crop to heat and drought stress. Plants 2022, 11, 2857. [Google Scholar] [CrossRef]
- Salgotra, R.K.; Chauhan, B.S. Ecophysiological responses of rice (Oryza sativa L.) to drought and high temperature. Agronomy 2023, 13, 1877. [Google Scholar] [CrossRef]
- Shin, Y.K.; Bhandari, S.R.; Lee, J.G. Monitoring of salinity, temperature, and drought stress in grafted watermelon seedlings using chlorophyll fluorescence. Front. Plant Sci. 2021, 12, 786309. [Google Scholar] [CrossRef]
- Nievola, C.C.; Carvalho, C.P.; Carvalho, V.; Rodrigues, E. Rapid responses of plants to temperature changes. Temperature 2017, 4, 371–405. [Google Scholar] [CrossRef]
- Cancé, C.; Martin-Arevalillo, R.; Boubekeur, K.; Dumas, R. Auxin response factors are keys to the many auxin doors. New Phytol. 2022, 235, 402–419. [Google Scholar] [CrossRef] [PubMed]
- Li, S.-B.; Xie, Z.-Z.; Hu, C.-G.; Zhang, J.-Z. A Review of auxin response factors (ARFs) in plants. Front. Plant Sci. 2016, 7, 47. [Google Scholar] [CrossRef] [PubMed]
- Lin, Z.; Li, Y.; Wang, Y.; Liu, X.; Ma, L.; Zhang, Z.; Mu, C.; Zhang, Y.; Peng, L.; Xie, S.; et al. Initiation and amplification of SnRK2 activation in abscisic acid signaling. Nat. Commun. 2021, 12, 2456. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Liu, X.; Zhao, S.; Guo, Y. The PYR-PP2C-CKL2 module regulates ABA-mediated actin reorganization during stomatal closure. New Phytol. 2022, 233, 2168–2184. [Google Scholar] [CrossRef]
- Binder, B.M. Ethylene signaling in plants. J. Biol. Chem. 2020, 295, 7710–7725. [Google Scholar] [CrossRef]
- Carvalhais, L.C.; Schenk, P.M.; Dennis, P.G. Jasmonic acid signalling and the plant holobiont. Curr. Opin. Microbiol. 2017, 37, 42–47. [Google Scholar] [CrossRef]
- Kuai, X.; MacLeod, B.J.; Després, C. Integrating data on the Arabidopsis NPR1/NPR3/NPR4 salicylic acid receptors; a differentiating argument. Front. Plant Sci. 2015, 6, 235. [Google Scholar] [CrossRef]
- Moles, T.M.; Mariotti, L.; De Pedro, L.F.; Guglielminetti, L.; Picciarelli, P.; Scartazza, A. Drought induced changes of leaf-to-root relationships in two tomato genotypes. Plant Physiol. Biochem. 2018, 128, 24–31. [Google Scholar] [CrossRef]
- Lei, R.; Jiang, H.; Hu, F.; Yan, J.; Zhu, S. Chlorophyll fluorescence lifetime imaging provides new insight into the chlorosis induced by plant virus infection. Plant Cell Rep. 2017, 36, 327–341. [Google Scholar] [CrossRef]
- Huseynova, I.M.; Mirzayeva, S.M.; Sultanova, N.F.; Aliyeva, D.R.; Mustafayev, N.S.; Aliyev, J.A. Virus-induced changes in photosynthetic parameters and peroxidase isoenzyme contents in tomato (Solanum lycopersicum L.) plants. Photosynthetica 2018, 56, 841–850. [Google Scholar] [CrossRef]
- Roca, M.; Mínguez-Mosquera, M.I. Involvement of chlorophyllase in chlorophyll metabolism in olive varieties with high and low chlorophyll content. Physiol. Plant. 2003, 117, 459–466. [Google Scholar] [CrossRef]
- Lucas, J.A. Plant Pathology and Plant Pathogens, 4th ed.; Wiley-Blackwell: Oxford, UK, 2020; p. 1260. [Google Scholar]
- Wang, B.; Hajano, J.-U.-D.; Ren, Y.; Lu, C.; Wang, X. iTRAQ-based quantitative proteomics analysis of rice leaves infected by rice stripe virus reveals several proteins involved in symptom formation. Virol. J. 2005, 12, 99. [Google Scholar] [CrossRef]
- Shimura, H.; Pantaleo, V.; Ishihara, T.; Myojo, N.; Inaba, J.; Sueda, K.; Burgyán, J.; Masuta, C. A Viral satellite RNA induces yellow symptoms on tobacco by targeting a gene involved in chlorophyll biosynthesis using the RNA silencing machinery. PLoS Pathog. 2011, 7, e1002021. [Google Scholar] [CrossRef]
- Devireddy, A.R.; Tschaplinski, T.J.; Tuskan, G.A.; Muchero, W.; Chen, J.-G. Role of reactive oxygen species and hormones in plant responses to temperature changes. Int. J. Mol. Sci. 2011, 22, 8843. [Google Scholar] [CrossRef]
- Medina, E.; Kim, S.-H.; Yun, M.; Choi, W.-G. recapitulation of the function and role of ROS generated in response to heat stress in plants. Plants 2021, 10, 371. [Google Scholar] [CrossRef]
- Shin, Y.K.; Bhandari, S.R.; Cho, M.C.; Lee, J.G. Evaluation of chlorophyll fluorescence parameters and proline content in tomato seedlings grown under different salt stress conditions. Hortic. Environ. Biotechnol. 2020, 61, 433–443. [Google Scholar] [CrossRef]
- Xu, Y.; Zhang, S.; Zhang, M.; Jiao, S.; Guo, Y.; Jiang, T. The role of reactive oxygen species in plant-virus interactions. Plant Cell Rep. 2024, 43, 197. [Google Scholar] [CrossRef] [PubMed]
- Zhanassova, K.; Kurmanbayeva, A.; Gadilgereyeva, B.; Yermukhambetova, R.; Iksat, N.; Amanbayeva, U.; Bekturova, A.; Tleukulova, Z.; Omarov, R.; Masalimov, Z. ROS status and antioxidant enzyme activities in response to combined temperature and drought stresses in barley. Acta Physiol. Plant. 2021, 43, 114. [Google Scholar] [CrossRef]
- Pellinen, R.I.; Korhonen, M.-S.; Tauriainen, A.A.; Palva, E.T.; Kangasjärvi, J. Hydrogen peroxide activates cell death and defense gene expression in birch. Plant Physiol. 2002, 130, 549–560. [Google Scholar] [CrossRef] [PubMed]
- Sewelam, N.; Jaspert, N.; Van Der Kelen, K.; Tognetti, V.B.; Schmitz, J.; Frerigmann, H.; Stahl, E.; Zeier, J.; Van Breusegem, F.; Maurino, V.G. Spatial H2O2 signaling specificity: H2O2 from chloroplasts and peroxisomes modulates the plant transcriptome differentially. Mol. Plant 2014, 7, 1191–1210. [Google Scholar] [CrossRef]
- Zhao, Y.; Yang, J.; Liu, Y.; Hu, X.; Wang, X.; Yang, J.; Liu, J. Wheat yellow mosaic virus P1 Inhibits ROS accumulation to facilitate viral infection. Int. J. Mol. Sci. 2025, 26, 1455. [Google Scholar] [CrossRef]
- Al-Mokadem, A.Z.; Alnaggar, A.E.-A.M.; Mancy, A.G.; Sofy, A.R.; Sofy, M.R.; Mohamed, A.K.S.H.; Ghazala, M.M.A.A.; El-Zabalawy, K.M.; Salem, N.F.G.; Elnosary, M.E.; et al. Foliar application of chitosan and phosphorus alleviate the potato virus Y-Induced resistance by modulation of the reactive oxygen species, antioxidant defense system activity and gene expression in potato. Agronomy 2022, 12, 3064. [Google Scholar] [CrossRef]
- Balassa, K.; Balassa, G.; Rudnóy, S. Alteration of stress-physiological mechanisms in sRNA-treated sweet corn plants during MDMV infection. Biol. Futur. 2024, 75, 507–515. [Google Scholar] [CrossRef] [PubMed]
- Hakmaoui, A.; Pérez-Bueno, M.L.; García-Fontana, B.; Camejo, D.; Jiménez, A.; Sevilla, F.; Barón, M. Analysis of the antioxidant response of Nicotiana benthamiana to infection with two strains of Pepper mild mottle virus. J. Exp. Bot. 2012, 63, 5487–5496. [Google Scholar] [CrossRef] [PubMed]
- Janicka, M.; Reda, M.; Czyżewska, K.; Kabała, K. Involvement of signalling molecules NO, H2O2 and H2S in modification of plasma membrane proton pump in cucumber roots subjected to salt or low temperature stress. Funct. Plant Biol. 2017, 45, 428–439. [Google Scholar] [CrossRef]
- Radwan, D.E.M.; Fayez, K.A.; Younis Mahmoud, S.; Lu, G. Modifications of antioxidant activity and protein composition of bean leaf due to Bean yellow mosaic virus infection and salicylic acid treatments. Acta Physiol. Plant. 2010, 32, 891–904. [Google Scholar] [CrossRef]
- Dat, J.F.; Lopez-Delgado, H.; Foyer, C.H.; Scott, I.M. Parallel changes in H2O2 and catalase during thermotolerance induced by salicylic acid or heat acclimation in mustard seedlings. Plant Physiol. 1998, 116, 1351–1357. [Google Scholar] [CrossRef]
- Li, Y.; Zhang, S.; Jiang, W.; Liu, D. Cadmium accumulation, activities of antioxidant enzymes, and malondialdehyde (MDA) content in Pistia stratiotes L. Environ. Sci. Pollut. Res. 2013, 20, 1117–1123. [Google Scholar] [CrossRef]
- Naz, R.; Gul, F.; Zahoor, S.; Nosheen, A.; Yasmin, H.; Keyani, R.; Shahid, M.; Hassan, M.N.; Siddiqui, M.H.; Batool, S.; et al. Interactive effects of hydrogen sulphide and silicon enhance drought and heat tolerance by modulating hormones, antioxidant defence enzymes and redox status in barley (Hordeum vulgare L.). Plant Biol. 2022, 24, 684–696. [Google Scholar] [CrossRef]
- Wang, X.; Shi, M.; Zhang, R.; Wang, Y.; Zhang, W.; Qin, S.; Kang, Y. Dynamics of physiological and biochemical effects of heat, drought and combined stress on potato seedlings. Chem. Biol. Technol. Agric. 2024, 11, 109. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; El-Gendi, H.; Al-Askar, A.A.; Maresca, V.; Moawad, H.; Elsharkawy, M.M.; Younes, H.A.; Behiry, S.I. Enhancing systemic resistance in faba bean (Vicia faba L.) to Bean yellow mosaic virus via soil application and foliar spray of nitrogen-fixing Rhizobium leguminosarum bv. viciae strain 33504-Alex1. Front. Plant Sci. 2022, 13, 933498. [Google Scholar] [CrossRef]
- Sh, S.; Mutalov, K.A.; Temirov, A.A.; Shonazarova, N.I.; Suyunova, G.U.; Fayzieva, N.B.; Berdikulova, N.R. Molecular identification of MDMV and its effects on physiological properties of Zea mays L. SABRAO J. Breed. Genet. 2023, 55, 1878–1885. [Google Scholar] [CrossRef]
- Wang, C.; Deng, Y.; Liu, Z.; Liao, W. Hydrogen sulfide in plants: Crosstalk with other signal molecules in response to abiotic stresses. Int. J. Mol. Sci. 2021, 22, 12068. [Google Scholar] [CrossRef] [PubMed]
- Raja, V.; Qadir, S.U.; Alyemeni, M.N.; Ahmad, P. Impact of drought and heat stress individually and in combination on physio-biochemical parameters, antioxidant responses, and gene expression in Solanum lycopersicum. 3 Biotech 2020, 10, 208. [Google Scholar] [CrossRef] [PubMed]
- Zang, Y.; Liu, J.; Tang, X.X.; Zhou, B. Description of a Zostera marina catalase gene involved in responses to temperature stress. PeerJ 2018, 6, e4532. [Google Scholar] [CrossRef]
- Kaur, G.; Sharma, S.; Das, N. Comparison of catalase activity in different organs of the potato (Solanum tuberosum L.) cultivars grown under field condition and purification by three-phase partitioning. Acta Physiol. Plant. 2020, 42, 10. [Google Scholar] [CrossRef]
- Liu, Z.; Wang, D.; Tang, H.; Li, H.; Zhang, X.; Dong, S.; Zhang, L.; Yang, L. Identification and analysis of the catalase gene family response to abiotic stress in Nicotiana tabacum L. Agronomy 2023, 13, 936. [Google Scholar] [CrossRef]
- Singh, B.K.; Sharma, S.R.; Singh, B.J.S.H. Antioxidant enzymes in cabbage: Variability and inheritance of superoxide dismutase, peroxidase and catalase. Sci. Hortic. 2010, 124, 9–13. [Google Scholar] [CrossRef]
- Foyer, C.H.; Noctor, G. Redox homeostasis and antioxidant signaling: A metabolic interface between stress perception and physiological responses. Plant Cell 2005, 17, 1866–1875. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Fujita, M. Exogenous sodium nitroprusside alleviates arsenic-induced oxidative stress in wheat (Triticum aestivum L.) seedlings by enhancing antioxidant defense and glyoxalase system. Ecotoxicology 2013, 22, 584–596. [Google Scholar] [CrossRef]
- Vandenbroucke, K.; Robbens, S.; Vandepoele, K.; Inzé, D.; Van de Peer, Y.; Van Breusegem, F. Hydrogen peroxide–induced gene expression across kingdoms: A comparative analysis. Mol. Biol. Evol. 2008, 25, 507–516. [Google Scholar] [CrossRef]
- Hossain, M.A.; Bhattacharjee, S.; Armin, S.M.; Qian, P.; Xin, W.; Li, H.Y.; Burritt, D.J.; Fujita, M.; Tran, L.S. Hydrogen peroxide priming modulates abiotic oxidative stress tolerance: Insights from ROS detoxification and scavenging. Front. Plant Sci. 2015, 6, 420. [Google Scholar] [CrossRef] [PubMed]
- Ono, M.; Isono, K.; Sakata, Y.; Taji, T. CATALASE2 plays a crucial role in long-term heat tolerance of Arabidopsis thaliana. Biochem. Biophys. Res. Commun. 2021, 534, 747–751. [Google Scholar] [CrossRef] [PubMed]
- Yergaliyev, T.M.; Nurbekova, Z.; Mukiyanova, G.; Akbassova, A.; Sutula, M.; Zhangazin, S.; Bari, A.; Tleukulova, Z.; Shamekova, M.; Masalimov, Z.K.; et al. The involvement of ROS producing aldehyde oxidase in plant response to Tombusvirus infection. Plant Physiol. Biochem. 2016, 109, 36–44. [Google Scholar] [CrossRef] [PubMed]
- Kandukuri, S.S.; Noor, A.; Ranjini, S.S.; Vijayalakshmi, M.A. Purification and characterization of catalase from sprouted black gram (Vigna mungo) seeds. J. Chromatogr. B 2012, 889–890, 50–54. [Google Scholar] [CrossRef]
- Kuchino, Y.; Mori, F.; Kasai, H.; Inoue, H.; Iwai, S.; Miura, K.; Ohtsuka, E.; Nishimura, S. Misreading of DNA templates containing 8-hydroxydeoxyguanosine at the modified base and at adjacent residues. Nature 1987, 327, 77–79. [Google Scholar] [CrossRef]
- Pavlov, Y.I.; Minnick, D.T.; Izuta, S.; Kunkel, T.A. DNA replication fidelity with 8-oxodeoxyguanosine triphosphate. Biochemistry 1994, 33, 4695–4701. [Google Scholar] [CrossRef]
- Shibutani, S.; Takeshita, M.; Grollman, A.P. Insertion of specific bases during DNA synthesis past the oxidation-damaged base 8-oxodG. Nature 1991, 349, 431–434. [Google Scholar] [CrossRef]
- Van de Waterbeemd, M.; Llauró, A.; Snijder, J.; Valbuena, A.; Rodríguez-Huete, A.; Fuertes, M.A.; de Pablo, P.J.; Mateu, M.G.; Heck, A.J.R. Structural analysis of a temperature-induced transition in a viral capsid probed by HDX-MS. Biophys. J. 2017, 112, 1157–1165. [Google Scholar] [CrossRef][Green Version]
- Chung, B.N.; Canto, T.; Tenllado, F.; Choi, K.S.; Joa, J.H.; Ahn, J.J.; Kim, C.H.; Do, K.S. The Effects of High Temperature on Infection by potato virus Y, potato virus A, and potato leafroll virus. Plant Pathol. J. 2016, 32, 321–328. [Google Scholar] [CrossRef]
- Ma, L.; Huang, X.; Yu, R.; Jing, X.L.; Xu, J.; Wu, C.A.; Zhu, C.; Liu, H.M. Elevated ambient temperature differentially affects virus resistance in two tobacco species. Phytopathology 2016, 106, 94–100. [Google Scholar] [CrossRef]
- Liu, J.; Zhang, X.; Yang, Y.; Hong, N.; Wang, G.; Wang, A.; Wang, L. Characterization of virus-derived small interfering RNAs in Apple stem grooving virus-infected in vitro-cultured Pyrus pyrifolia shoot tips in response to high temperature treatment. Virol. J. 2016, 13, 166. [Google Scholar] [CrossRef]
- Yin, Z.; Zieniuk, B.; Pawełkowicz, M. Climate change effects on cucumber viruses and their management. Agriculture 2024, 14, 1999. [Google Scholar] [CrossRef]
- Fei, Y.; Pyott, D.E.; Molnar, A. Temperature modulates virus-induced transcriptional gene silencing via secondary small RNAs. New Phytol. 2021, 232, 356–371. [Google Scholar] [CrossRef] [PubMed]
- Thanuja, K.; Arulmozhiyan, R.; Saraswathi, M.S.; Selvarajan, R.; Jegadeeswari, V.; Rajanbabu, V. A comprehensive review on in vitro therapies for virus elimination and novel methods for virus protection in key horticultural crops. Planta 2025, 262, 15. [Google Scholar] [CrossRef] [PubMed]
- Shamekova, M.; Mendoza, M.R.; Hsieh, Y.; Lindbo, J.; Omarov, R.T.; Scholthof, H.B. Tombusvirus-based vector systems to permit over-expression of genes or that serve as sensors of antiviral RNA silencing in plants. Virology 2014, 452–453, 159–165. [Google Scholar] [CrossRef][Green Version]
- Hearne, P.Q.; Knorr, D.A.; Hillman, B.I.; Morris, T.J. The complete genome structure and synthesis of infectious RNA from clones of tomato bushy stunt virus. Virology 1990, 177, 141–151. [Google Scholar] [CrossRef]
- Iksat, N.; Masalimov, Z.; Omarov, R. Plant virus resistance biotechnological approaches: From genes to the CRISPR/Cas gene editing system. J. Water Land Dev. 2023, 57, 147–158. [Google Scholar] [CrossRef]
- Mandelli, C.; Deluc, L.G. Early activation of RNAi reveals genomic regions of grapevine red blotch virus targeted for silencing in grapevine. Mol. Plant Microbe Interact. 2025. online ahead of print. [Google Scholar] [CrossRef]
- Kim, Y.; Kim, Y.J.; Paek, K.-H. Temperature-specific vsiRNA confers RNAi-mediated viral resistance at elevated temperature in Capsicum annuum. J. Exp. Bot. 2021, 72, 1432–1448. [Google Scholar] [CrossRef]
- Iksat, N.; Massalimov, Z. In planta silensing of tomato bushy stunt virus using the CRISPR/Cas13 system. Phytopathol. Plant Health 2022, 112, 77. [Google Scholar]
- Omarov, R.T.; Ciomperlik, J.J.; Scholthof, H.B. RNAi-associated ssRNA-specific ribonucleases in tombusvirus P19 mutant-infected plants and evidence for a discrete siRNA-containing effector complex. Proc. Natl. Acad. Sci. USA 2007, 104, 1714–1719. [Google Scholar] [CrossRef] [PubMed]
- Nadhan, R.; Patra, D.; Krishnan, N.; Rajan, A.; Gopala, S.; Ravi, D.; Srinivas, P. Perspectives on mechanistic implications of ROS inducers for targeting viral infections. Eur. J. Pharmacol. 2021, 890, 173621. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.; Lu, Y.; Li, K.; Lin, L.; Zheng, H.; Yan, F.; Chen, J. Heat shock protein 70 is necessary for ice stripe virus infection in plants. Mol. Plant Pathol. 2014, 15, 907–917. [Google Scholar] [CrossRef]
- Verchot, J. Cellular chaperones and folding enzymes are vital contributors to membrane bound replication and movement complexes during plant RNA virus infection. Front. Plant Sci. 2012, 3, 36954. [Google Scholar] [CrossRef]
- Wu, S.; Zhao, Y.; Wang, D.; Chen, Z. Mode of action of heat shock protein (HSP) inhibitors against viruses through host HSP and virus interactions. Genes 2023, 14, 792. [Google Scholar] [CrossRef]
- Haq, S.U.; Khan, A.; Ali, M.; Khattak, A.M.; Gai, W.-X.; Zhang, H.-X.; Wei, A.-M.; Gong, Z.-H. Heat shock proteins: Dynamic biomolecules to counter plant biotic and abiotic stresses. Int. J. Mol. Sci. 2019, 20, 5321. [Google Scholar] [CrossRef]
- Alam, S.B.; Rochon, D. Cucumber necrosis virus recruits cellular heat shock protein 70 homologs at several stages of infection. J. Virol. 2016, 90, 3302–3317. [Google Scholar] [CrossRef]
- Chen, Z.; Zhou, T.; Wu, X.; Hong, Y.; Fan, Z.; Li, H. Influence of cytoplasmic heat shock protein 70 on viral infection of Nicotiana benthamiana. Mol. Plant Pathol. 2008, 9, 809–817. [Google Scholar] [CrossRef]
- Gorovits, R.; Moshe, A.; Ghanim, M.; Czosnek, H. Recruitment of the host plant heat shock protein 70 by tomato yellow leaf curl virus coat protein is required for virus infection. PLoS ONE 2013, 8, e70280. [Google Scholar] [CrossRef]
- Gorovits, R.; Czosnek, H. The Involvement of heat shock proteins in the establishment of tomato yellow leaf curl virus infection. Front. Plant Sci. 2017, 8, 355. [Google Scholar] [CrossRef]
- Hýsková, V.; Bělonožníková, K.; Čeřovská, N.; Ryšlavá, H. HSP70 plays an ambiguous role during viral infections in plants. Biol. Plant. 2021, 65, 68–79. [Google Scholar] [CrossRef]
- Mine, A.; Hyodo, K.; Tajima, Y.; Kusumanegara, K.; Taniguchi, T.; Kaido, M.; Mise, K.; Taniguchi, H.; Okuno, T. Differential Roles of Hsp70 and Hsp90 in the assembly of the replicase complex of a positive-strand RNA plant Virus. J. Virol. 2012, 86, 12091–12104. [Google Scholar] [CrossRef] [PubMed]
- Whitham, S.A.; Quan, S.; Chang, H.-S.; Cooper, B.; Estes, B.; Zhu, T.; Wang, X.; Hou, Y.-M. Diverse RNA viruses elicit the expression of common sets of genes in susceptible Arabidopsis thaliana plants. Plant J. 2003, 33, 271–283. [Google Scholar] [CrossRef]
- Mahajan, S.; Choudhary, S.; Kumar, P.; Tomar, S. Antiviral strategies targeting host factors and mechanisms obliging +ssRNA viral pathogens. Bioorg. Med. Chem. 2021, 46, 116356. [Google Scholar] [CrossRef]
- Barajas, D.; Martín, I.F.d.C.; Pogany, J.; Risco, C.; Nagy, P.D. Noncanonical role for the host Vps4 AAA+ ATPase ESCRT protein in the formation of tomato bushy stunt virus replicase. PLOS Pathog. 2014, 10, e1004087. [Google Scholar] [CrossRef]
- Scholthof, K.B.G.; Scholthof, H.B.; Jackson, A.O. The tomato bushy stunt virus replicase proteins are coordinately expressed and membrane associated. Virology 1995, 208, 365–369. [Google Scholar] [CrossRef][Green Version]
- Oster, S.K.; Wu, B.; White, K.A. Uncoupled expression of p33 and p92 permits amplification of tomato bushy stunt virus RNAs. J. Virol. 1998, 72, 5845–5851. [Google Scholar] [CrossRef]
- Pogany, J.; Stork, J.; Li, Z.; Nagy, P.D. In vitro assembly of the tomato bushy stunt virus replicase requires the host heat shock protein 70. Proc. Natl. Acad. Sci. USA 2008, 105, 19956–19961. [Google Scholar] [CrossRef]
- Córdoba-Cañero, D.; Roldán-Arjona, T.; Ariza, R.R. Arabidopsis ZDP DNA 3′-phosphatase and ARP endonuclease function in 8-oxoG repair initiated by FPG and OGG1 DNA glycosylases. Plant J. 2014, 79, 824–834. [Google Scholar] [CrossRef]
- Britt, A.B. DNA damage and repair in plants. Annu. Rev. Plant Biol. 1996, 47, 75–100. [Google Scholar] [CrossRef]
- Grin, I.R.; Petrova, D.V.; Endutkin, A.V.; Ma, C.; Yu, B.; Li, H.; Zharkov, D.O. Base excision dna repair in plants: Arabidopsis and beyond. Int. J. Mol. Sci. 2023, 24, 14746. [Google Scholar] [CrossRef]
- Molinier, J. Genome and epigenome surveillance processes underlying uv exposure in plants. Genes 2017, 8, 316. [Google Scholar] [CrossRef] [PubMed]
- Roldán-Arjona, T.; Ariza, R.R.; Córdoba-Cañero, D. DNA Base excision repair in plants: An unfolding story with familiar and novel characters. Front. Plant Sci. 2019, 10, 1055. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Chu, P.; Zhou, Y.; Li, Y.; Liu, J.; Ding, Y.; Tsang, E.W.T.; Jiang, L.; Wu, K.; Huang, S. Overexpression of AtOGG1, a DNA glycosylase/APlyase, enhances seed longevity and abiotic stress tolerance in Arabidopsis. J. Exp. Bot. 2012, 63, 4107–4121. [Google Scholar] [CrossRef] [PubMed]
- Macovei, A.; Balestrazzi, A.; Confalonieri, M.; Faé, M.; Carbonera, D. New insights on the barrel medic MtOGG1 and MtFPG functions in relation to oxidative stress response in planta and during seed imbibition. Plant Physiol. Biochem. 2011, 49, 1040–1050. [Google Scholar] [CrossRef]
- Arnon, D.I. Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol. 1949, 24, 1–15. [Google Scholar] [CrossRef]
- Lichtenthaler, H.; Wellburn, A.R. Determination of total carotenoids and chlorophylls a and b of leaf in different solvents. Biochem. Soc. Trans. 1985, 11, 591–592. [Google Scholar] [CrossRef]
- Guo, M.; Li, S.; Tian, S.; Wang, B.; Zhao, X. Transcriptome analysis of genes involved in defense against alkaline stress in roots of wild jujube (Ziziphus acidojujuba). PLoS ONE 2017, 12, e0185732. [Google Scholar] [CrossRef]
- Srivastava, S.; Sinha, P.; Sharma, Y.K. Status of photosynthetic pigments, lipid peroxidation and anti-oxidative enzymes in Vigna mungo in presence of arsenic. J. Plant Nutr. 2017, 40, 298–306. [Google Scholar] [CrossRef]
- López-Hidalgo, C.; Meijón, M.; Lamelas, L.; Valledor, L. The rainbow protocol: A sequential method for quantifying pigments, sugars, free amino acids, phenolics, flavonoids and MDA from a small amount of sample. Plant Cell Environ. 2021, 44, 1977–1986. [Google Scholar] [CrossRef]
- Batyrshina, Z.; Yergaliyev, T.M.; Nurbekova, Z.; Moldakimova, N.A.; Masalimov, Z.K.; Sagi, M.; Omarov, R.T. Differential influence of molybdenum and tungsten on the growth of barley seedlings and the activity of aldehyde oxidase under salinity. J. Plant Physiol. 2018, 228, 189–196. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Tleukulova, Z.; Stamgaliyeva, Z.; Dildabek, A.; Mukiyanova, G.; Omarov, R. Purification of Tomato Bushy Stunt Virus Particles by One-Step Hydroxyapatite Column Chromatography. Eurasian Chem.-Technol. J. 2021, 23, 277–282. [Google Scholar] [CrossRef]
- Omarov, R.; Masalimov, Z.; Shamekova, M.; Ergaliev, T.; Zhangazin, S.; Mukiyanova, G. Method for determining viral infection in plant tissues by express method. Bull. Pat. Util. Model 2019, 8, 3684. [Google Scholar]











| Phase | Time (h) | Control | 1st group | 2nd group |
|---|---|---|---|---|
| Hight temperature | 30 | 25 °C | 30 °C | 37 °C |
| Recovery | 42 | 25 °C | 25 °C | 25 °C |
| Hight temperature | 30 | 25 °C | 30 °C | 37 °C |
| Recovery | 42 | 25 °C | 25 °C | 25 °C |
| Hight temperature | 30 | 25 °C | 30 °C | 37 °C |
| Recovery | 42 | 25 °C | 25 °C | 25 °C |
| Hight temperature | 30 | 25 °C | 30 °C | 37 °C |
| Recovery | 42 | 25 °C | 25 °C | 25 °C |
| Hight temperature | 30 | 25 °C | 30 °C | 37 °C |
| Recovery | 24 | 25 °C | 25 °C | 25 °C |
| Target Name | Sequence | Tm |
|---|---|---|
| GAPDH(At1g12900) | 5′-3′F: agctcaagggaattctcgatg/5′-3′R: aaccttaaccatgtcatctccc | 60 |
| P33 | 5′-3′F: tgatttcgcaaccggagtga/5′-3′R: acccttaagttcccttgccg | 59.7 |
| OGG1 | 5′-3′F: gacctacatctcagccgtcg/5′-3′R: tgctaccttcggaccaacac | 59.9 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Iksat, N.; Madirov, A.; Artykbayeva, D.; Shevchenko, O.; Zhanassova, K.; Baikarayev, Z.; Masalimov, Z. Heat Stress Induces Partial Resistance to Tomato Bushy Stunt Virus in Nicotiana benthamiana Via Combined Stress Pathways. Viruses 2025, 17, 1250. https://doi.org/10.3390/v17091250
Iksat N, Madirov A, Artykbayeva D, Shevchenko O, Zhanassova K, Baikarayev Z, Masalimov Z. Heat Stress Induces Partial Resistance to Tomato Bushy Stunt Virus in Nicotiana benthamiana Via Combined Stress Pathways. Viruses. 2025; 17(9):1250. https://doi.org/10.3390/v17091250
Chicago/Turabian StyleIksat, Nurgul, Almas Madirov, Dana Artykbayeva, Oleksiy Shevchenko, Kuralay Zhanassova, Zhaksat Baikarayev, and Zhaksylyk Masalimov. 2025. "Heat Stress Induces Partial Resistance to Tomato Bushy Stunt Virus in Nicotiana benthamiana Via Combined Stress Pathways" Viruses 17, no. 9: 1250. https://doi.org/10.3390/v17091250
APA StyleIksat, N., Madirov, A., Artykbayeva, D., Shevchenko, O., Zhanassova, K., Baikarayev, Z., & Masalimov, Z. (2025). Heat Stress Induces Partial Resistance to Tomato Bushy Stunt Virus in Nicotiana benthamiana Via Combined Stress Pathways. Viruses, 17(9), 1250. https://doi.org/10.3390/v17091250

