Next Article in Journal
The Key Importance of Screening Underprivileged People in Order to Achieve Global Hepatitis Virus Elimination Targets
Next Article in Special Issue
First Isolation and Characterization of Three Strains of Porcine Sapelovirus in Yunnan Province, China
Previous Article in Journal
The Effects of Pangenotypic Direct-Acting Antiviral Therapy on Lipid Profiles and Insulin Resistance in Chronic Hepatitis C Patients
Previous Article in Special Issue
Multiple Co-Infecting Caliciviruses in Oral Fluid and Enteric Samples of Swine Detected by a Novel RT-qPCR Assay and a 3′RACE-PCR-NGS Method
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Epidemiological Study and Genetic Diversity Assessment of Porcine Epidemic Diarrhea Virus (PEDV) in Yunnan Province, China

1
Yunnan Tropical and Subtropical Animal Virus Diseases Laboratory, Yunnan Animal Science and Veterinary Institute, Kunming 650224, China
2
College of Animal Medicine, Yunnan Agricultural University, Kunming 650201, China
3
Menglian County Animal Disease Prevention and Control Center, Menglian 665899, China
4
Gongshan County Animal Disease Prevention and Control Center, Gongshan 673599, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Viruses 2025, 17(2), 264; https://doi.org/10.3390/v17020264
Submission received: 14 January 2025 / Revised: 8 February 2025 / Accepted: 9 February 2025 / Published: 14 February 2025
(This article belongs to the Special Issue Porcine Viruses 2024)

Abstract

Porcine epidemic diarrhea virus (PEDV) is a highly contagious pathogen responsible for devastating enteric disease and lethal watery diarrhea, leading to significant economic losses in the global swine industry. Understanding the epidemiology and genetic diversity of PEDV over the past decade is crucial for the effective prevention and treatment of porcine epidemic diarrhea. In this study, 1851 fecal samples were collected from pigs exhibiting diarrhea symptoms across 11 cities in Yunnan Province between 2013 and 2022. The prevalence of PEDV, along with other common swine diarrhea viruses, including porcine transmissible gastroenteritis virus (TGEV), porcine rotavirus (PoRV), porcine Sapporo virus (PoSaV), porcine stellate virus (PaStV), and porcine delta coronavirus (PDCoV) was assessed using a polymerase chain reaction (PCR) assay. The results revealed a total detection rate of 52.94% (980/1851) for the six viruses, with PEDV accounting for 25.93% (480/1851) of cases. Further analysis showed that weaned piglets were more susceptible to PEDV than fattening pigs, with the highest prevalence observed in spring (61.52%, 275/447) and the lowest in summer (12.68%, 97/765). Dual infections were also identified, with PEDV + PoSaV being the most common combination (2.81%, 52/1851), followed by PEDV + PoRV, with a detection rate of 1.67% (31/1851). Phylogenetic analysis of the PEDV S genes revealed that the 28 epidemic strains in Yunnan Province shared a nucleotide sequence homology from 91.4% to 98.4% and an amino acid sequence homology ranging from 85.6% to 99.3%. All strains were classified as GII variant strains. This study provides a comprehensive overview of the epidemiology of PEDV and its co-infection patterns with other common diarrhea-causing viruses in the swine herds of Yunnan Province over the past decade. These findings offer valuable insights for the development of effective prevention and control strategies to mitigate the impact of PEDV and other enteroviruses on the swine industry in Yunnan Province.

1. Introduction

Porcine epidemic diarrhea (PED) is a highly contagious and acute intestinal disease caused by the porcine epidemic diarrhea virus (PEDV). Characterized by enteritis and severe watery diarrhea, PED affects pigs of all ages, with mortality rates reaching up to 100% in suckling piglets [1,2]. This disease poses significant threats to swine populations, leading to widespread epidemics and substantial economic losses [1]. PEDV belongs to the genus Alphacoronavirus within the family Coronaviridae and the order Nidovirales. It is classified into two major genotypes: GI (classical) and GII (variant). These genotypes have further diverged into five subgroups: GIa, GIb, GIIa, GIIb, and GIIc, with the GIIc subgroup also referred to as the S-INDEL strain [3,4]. Classical PEDV strains, such as CV777 and DR13, are representative of the GI genotype [4].
The PEDV genome is approximately 28 kb in length and comprises seven open reading frames: ORF1a, ORF1b, and ORF2-6. Four structural proteins are encoded by ORF2 and ORF4-6: the spike (S) protein, the membrane (M) protein, the envelope (E) protein, and the nucleocapsid (N) protein. Additionally, the ORF3 gene encodes a single accessory protein known as ORF3 [3,4]. The S protein, consisting of 1383 amino acids, is a key surface immunogenic protein of PEDV. It plays a critical role in cell fusion, viral virulence, and the induction of neutralizing antibodies [5]. Due to its high variability, the S protein is widely used for the phylogenetic analysis of PEDV isolates, making it an important target for understanding the evolution and diversity of the virus [6].
PEDV was first reported in England in 1977 [7] and subsequently isolated in China in 1984 [8]. Since 2010, GII genotype strains have become predominant worldwide [1]. In China, the emergence of highly virulent PEDV strains in 2010 resulted in piglet mortality rates of 100%, causing devastating economic losses [9]. Similarly, a PED outbreak in the United States and neighboring countries (Canada and Mexico) in April 2013 led to the death of over eight million piglets in the US alone [10,11]. Shortly thereafter, highly virulent PEDV strains were reported in Japan, South Korea, Vietnam, and Thailand [1]. Taiwan and China’s mainland experienced a PED outbreak in late 2013 [12]. Meanwhile, the PEDV S-INDEL strain (GIIc) appeared in Germany in 2014 and has since become endemic in many European countries [1]. Yunnan Province is one of the major pig-raising regions in China. However, despite its importance in swine production, there have been relatively few studies on the epidemiological situation of PEDV in this area [13,14]. Additionally, the existing studies are limited by small sample sizes and short observation periods, which restrict the comprehensiveness of the findings.
In addition to PEDV, swine enteric coronaviruses (SECoVs) include porcine transmissible gastroenteritis virus (TGEV) and porcine delta coronavirus (PDCoV). Other porcine diarrhea viruses, such as porcine rotavirus (PoRV), porcine sapovirus (PoSaV), and porcine astrovirus (PAstV), have also been reported as prevalent in Yunnan Province [3,15]. The similarity of clinical symptoms and pathological findings among these viral infections complicates clinical diagnosis [16]. Furthermore, co-infections and secondary infections are also frequently observed. For instance, a survey of swine diarrhea samples in Jiangxi Province from 2012 to 2015 revealed an infection rate of 33.71% for PDCoV, with a PDCoV/PEDV co-infection rate of 19.66% [17]. In the United States, the PDCoV/PoRV co-infection rate in swine herds was reported to be 30% [18]. Triple infections involving PEDV, PoRV, and PDCoV are also common [19]. Similarly, between 2021 and 2022, 77 out of 306 diarrhea samples collected from 54 farms in India showed mixed infections with PAstV and PoRV [20]. However, few studies have yet reported on the co-infection status of these porcine diarrhea viruses in the Yunnan region.
Hence, to investigate the epidemiology of porcine diarrhea viruses in Yunnan Province, we collected fecal samples from pigs exhibiting diarrhea symptoms across the region, and the presence of six porcine diarrhea viruses (PEDV, TGEV, PoRV, PoSaV, PaStV, and PDCoV) was detected using a polymerase chain reaction (PCR) assay. Additionally, a phylogenetic analysis of PEDV S genes was performed to further explore the epidemiology and genetic diversity of PEDV genotypes. This study provides valuable insights that can inform the development of effective prevention and control strategies to mitigate the impact of PEDV and other enteric viruses on the swine industry in Yunnan Province.

2. Materials and Methods

2.1. Sample Collection

Fecal samples were collected from pigs exhibiting diarrhea symptoms using a sterile swab. The samples were immediately placed in sterile containers and transported to the Yunnan Tropical and Subtropical Animal Virus Diseases Laboratory in an ice box. Upon arrival at the laboratory, the samples were mixed with phosphate-buffered saline (Gibco, Beijing, China) at a 1:10 ratio. The mixtures were then centrifuged at 10,000× g for 15 min at 4 °C to separate the supernatants, which were subsequently stored at −80 °C for further laboratory analysis.

2.2. RNA Extraction and RT-PCR Analysis

The viral RNA genome was extracted from the supernatants using the MiniBEST Viral RNA/DNA Extraction Kit Ver. 5.0 (Takara Bio, Dalian, China), following the manufacturer’s protocol. Specific primers for TGEV-S, PoRV-VP6, PoSaV-VP1, PaStV-0RF2, and PDCoV-N were designed using NCBI Blast according to reference sequences (GenBank Nos. AJ271965.2, FJ617209, KX688107, JX556690, and MN942260, respectively) (Table 1). The extracted RNA was reverse-transcribed into complementary DNA (cDNA) using the PrimeScriptTM One-Step RT-PCR Kit (Takara Bio, Dalian, China), whose system included 2 μL of the mix, 25 μL of a step buffer, 1 μL of the forward primer at a 0.4 μM concentration, 1 μL of the reverse primer at a 0.4 μM concentration, 1 μL of the template, and 19 μL of dH2O. The RT-PCR procedure was conducted under the following conditions: 50 °C for 30 min and 94 °C for 2 min, followed by 35 cycles of 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 60 s, with a final extension step at 72 °C for 7 min. After amplification, the reaction mixtures were analyzed using 1% agarose gel electrophoresis, and the expected DNA products were sequenced by Shanghai Shenggong Bioengineering Co., Ltd. (Shanghai, China).

2.3. PCR Amplification and Sequencing of S Genes of PEDV

The RNA of PEDV was extracted from supernatants using a Viral RNA Mini Kit (Takara Inc.), and cDNA was obtained using a TaKaRa One-Step RT-PCR Kit with random primers. Five primers (Table 1) with amplification regions covering the entire PEDV S gene were designed based on the PEDV whole-gene sequence (GenBank No. AF353511) to obtain the S gene sequence of the PEDV strains. The PCR procedure was carried out under the following conditions: pre-denaturation at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 120 s, with a final extension step at 72 °C for 10 min. The reaction mixtures were analyzed using agarose gel electrophoresis following amplification. Positive products were purified using a MiniBEST Agarose Gel DNA Extraction Kit (TaKaRa Bio, Dalian, China) according to the manufacturer’s instructions. The purified DNA fragments were then ligated into the T-vector pMD18 (TaKaRa Bio, Dalian, China) and used to transform competent Escherichia coli DH5a cells. Transformed colonies were screened using the respective fragment amplification primers. For each fragment, two positive clones were selected and sent for sequencing at Shanghai Shenggong Bioengineering Co., Ltd.

2.4. Sequence Characterization and Phylogenetic Analysis of PEDV S Genes

The PEDV S gene sequences of representative Yunnan epidemic strains were obtained and assembled using DNAMAN (v6.0). The amino acid sequences were predicted using the ORF analysis software from the NCBI (https://www.ncbi.nlm.nih.gov/ accessed on 1 February 2025). The sequence characteristics were analyzed based on the size of the complete gene, untranslated regions, and open reading frames and their coding amino acids. Comparative analyses of the full-length sequences of the PEDV S gene and their encoded amino acids were conducted to investigate the phylogenetic relationships between the representative Yunnan PEDV strains and other PEDV strains. The full-length sequences of the PEDV S gene and the corresponding amino acid sequences of reference PEDV strains were downloaded from GenBank. Detailed information about the downloaded full-length sequences is listed in Table 2.
The nucleotide and predicted amino acid sequences were aligned using MAFFT software(version 7). Nucleotide and amino sequence similarities were calculated using BioEdit (v 7.1.3.0). A phylogenetic tree based on the nucleotide sequences of the PEDV S gene was constructed using the neighbor-joining (NJ) method with 1000 bootstrap replicates in MEGA 7.0.
Recombination analysis was conducted using 7 methods provided by the recombination detection software RDP (version 4.1.3), including RDP, GENECONV, BootScan, Max-Chi, Chimaera, SiScan, and 3Seq. The threshold p-value for detecting recombination was set to 0.01. The S gene sequences of the representative strains were compared with sequences downloaded from GenBank (Table 2). When more than 5 methods detected recombination signals, further analysis was performed using Simplot software (version 3.5.1).

3. Results

3.1. Detection and Analysis of Diarrhea Viruses in Fecal Samples from Yunnan Province

A total of 1851 fecal samples were collected over the past decade from 11 cities in Yunnan Province, including Yuxi, Dali, Kunming, Qujing, Honghe, Wenshan, Lijiang, Lincang, Chuxiong, Baoshan, and Zhaotong. Detailed information about the collected samples is provided in Table 3. The overall detection rate for the six diarrhea virus in these samples was 52.95% (980/1851). The detection rates for individual viruses were as follows: PEDV: 25.93%, 480/1851; TGEV: 0.16%, 3/1851; PoRV: 10.8%, 200/1851; PoSaV: 8.15%, 151/1851; PaStV: 1.13%, 21/1851; and PDCoV: 0.11%, 2/1851. Among the positive samples, 46.30% (857/1851) were identified as mono-infections, while 6.65% (123/1851) were classified as mixed infections. The majority of mixed infections involved dual or triple infections, with no quadruple infections detected. The most prevalent dual infection was PEDV + PoSaV, with a detection rate of 2.81% (52/1851), followed by PEDV + PoRV at 1.67% (31/1851). Triple infections were dominated by PEDV + PoSaV + PaStV (0.32%, 6/1851), PDCoV + PoSaV + PaStV (0.11%, 2/1851), and PoRV + PoSaV + PaStV (0.22%, 4/1851) (Figure 1).

3.2. Distribution of PEDV in Yunnan Province

The PCR results revealed that PEDV was prevalent in pig herds across 11 regions in Yunnan Province. The highest detection rates were observed in Kunming (41.2%, 94/228) and Qujing (40.4%, 118/292), while Zhaotong had the lowest detection rate at 9.6% (62/643). Among the other regions, the prevalence rates ranged from 13.3% (2/15) in Baoshan to 38.1% (48/126) in Dali (Figure 2).
The detection rate of PEDV infection in fattening pigs was 8.64% (93/1076), which was significantly lower than that in weaned piglets (62.3%, 321/515) and suckling sows (52.3%, 136/260). Seasonal analysis indicated that PEDV infections were most prevalent in spring, with a detection rate of 61.5% (275/447). This was followed by winter with 33.1% (129/390), fall with 23.7% (59/249), and summer with 12.7% (97/765). Detailed information about the population and seasonal distributions of PEDV is provided in Table 4.

3.3. Sequencing and Phylogenetic Analysis of PEDV S Gene

A representative sample of 28 PEDV-positive strains was selected from different regions and time points. These strains were amplified, cloned, and sequenced, resulting in the complete S gene sequences of all 28 strains Figure 3. Evolutionary analysis revealed that the nucleotide sequence homology of the S gene among the 28 Yunnan epidemic strains ranged from 91.4% to 98.4%, while the amino acid sequence homology ranged from 85.6% to 99.3% when compared with the domestic and international reference strains from GenBank shown in Table 2.
When compared with the classical strain CV777 from the PEDV subgroup GIa, the S gene and its corresponding amino acid sequences showed homology ranges of 86.2% to 89.8%. In contrast, the homology ranged from 90.1% to 96.2% when compared with the non-S-INDEL strain AJ1102 from subgroup GIIb. Phylogenetic analysis placed 20 of the 28 Yunnan strains within the same evolutionary branch, closely related to Group GII strains (including AJ1102, GD-A, and OH851) and more distantly related to Group GI strains (including CV777 and DR13). Notably, YN-KM-1404 and YN-KM-1503 were genetically similar to the KNU-1305 and USA/Colorado/2013 strains within subgroup GIIa. Additionally, the strains YN-LJ-2112 and YN-LJ-2203 were more closely related to the strain OH851, belonging to subgroup GIIc. The remaining 24 strains showed closer genetic relationships to AJ1102 and CHGD-1, classifying them within subtype GIIb (Figure 4).
Compared with the classical vaccine strain CV777, the S gene of the 28 Yunnan strains exhibited 73 amino acid changes, including 69 mutations, 2 insertions, and 2 deletions. For instance, the amino acid changes included PS→LF at positions 462–463, SL→LF at positions 1313–1314, the deletion of Q at positions 721 and 1285, and the insertion of L and I at positions 945 and 1284 (Table 5). When compared with the variant vaccine strain AJ1102, the 28 Yunnan strains displayed 11 amino acid mutations but no insertion or deletion (Table 6). However, some prevalent Yunnan strains also exhibited amino acid insertions and deletions in several regions when compared with both the classical vaccine strain CV777 and the variant vaccine strain AJ1102.

3.4. Recombinant Analysis of PEDV S Gene Sequences

YN-LC-1803 exhibited a recombination signal detected by the seven different methods. The predicted genetic recombination fragments were located between positions 1007 and 2132, indicating that YN-LC-1803 may be a recombinant strain. The major parental strain was identified as “YN-YX-1903”, while the minor parental strain was “SC-ZY-2-KR732652” (Figure 5). Simplot software confirmed the similarity results and aligned with the findings from RDP4 (Figure 6).
Phylogenetic analysis of the S gene of the 28 Yunnan PEDV strains revealed that all strains belonged to the GII type. Among these, twenty-four strains were classified as the GIIb subtype, two as the GIIa subtype, and two as the S-INDEL subtype. Additionally, a recombination event was detected in YN-LC-1803.

4. Discussion

PEDV has been endemic across most continents since its emergence in the 1970s and remains a critical cause of piglet mortality, particularly in suckling piglets, where mortality rates can reach up to 100% [4]. Wang et al. reported a PEDV positivity rate of 83.03% (137/165) in samples collected from 41 PEDV-positive farms across 18 provinces in China [21]. Similarly, Zhang et al. analyzed 149,869 clinical samples from diarrheic pigs in eight provinces of China between 2011 and 2021. Their findings revealed that PEDV was the dominant pathogen, with an infection rate exceeding 40% over 11 years. However, the pathogenesis of porcine diarrhea in China is complex, with frequent co-infections and multiple infections, and mixed infections involving TGEV, PoRV, and PDCoV were also widely observed [1], and the similarity in the clinical symptoms and pathological anatomy among these viral infections complicates clinical diagnosis, necessitating laboratory testing to identify the causative agent.
PEDV is frequently co-infected with other diarrhea-causing viruses in pigs. For example, Qi et al. analyzed 217 PEDV-positive diarrhea samples from 17 US states between 2015 and 2016 using second-generation sequencing and identified nine additional RNA viruses co-infecting with PEDV [22]. In 2020, Liu et al. tested 202 acute diarrhea samples from piglets in Yunnan Province and found that 56 of the 71 PoSaV-positive samples (78.9%) were co-infected with other diarrhea viruses [23]. In our study, 1851 samples from 11 cities in Yunnan Province were tested for six porcine diarrhea viruses, including PEDV, TGEV, PoRV, PoSaV, PaStV, and PDCoV, using RT-PCR. Of these, 980 samples (52.95%) tested positive for at least one virus. PEDV was the most dominant pathogen, with a detection rate of 25.93% (480/1851). The detection rates for PoRV, PoSaV, PaStV, TGEV, and PDCoV were 10.8% (200/1851), 8.15% (151/1851), 1.13% (21/1851), 0.16% (3/1851), and 0.11% (2/1851), respectively. Double and triple infections were observed, with PEDV + PoSaV being the most common mixed infection, detected in 2.81% (52/1851) of samples (Figure 1). These findings confirm that PEDV is the primary pathogen causing diarrhea in pigs in Yunnan Province.
From 2019 to 2021, Yang et al. analyzed 2319 porcine serum samples from 284 large-scale pig farms in eight regions of Yunnan Province and found an average PEDV antibody positivity rate of 31.65% [24], aligning with the results of our study. However, in Liu’s study, PoSaV was the leading cause of acute diarrhea outbreaks in Yunnan piglets in 2020, with an infection rate of 35.2% (71/202) [23]. This discrepancy may be attributed to differences in feeding management and epidemiology factors. Overall, Yunnan Province should strengthen the monitoring and control of PEDV, PoSaV, TGEV, PaStV, PoRV, and PDCoV. These six porcine diarrhea viruses occur year-round, with outbreaks peaking in winter and spring. PEDV is particularly infectious during these seasons, with infection rates of 61.5% (275/447) in spring and 33.1% (129/390) in winter. The virus predominantly infects suckling piglets and lactating sows, with infection rates of 62.3% (321/515) and 52.3% (136/260), respectively (Table 4), consistent with previous reports [25,26,27].
The S gene is the primary virulence gene of PEDV, and mutations in this gene significantly impact PEDV genotyping and virulence [28]. The continuous emergence of new, highly virulent PEDV strains has caused substantial economic losses worldwide. Successive mutations in the S gene have led to significant genetic differences between the current predominant strain (PEDV GII) and the classical GI strain, as well as the vaccine strain CV777. Neither the CV777-inactivated vaccine nor the attenuated live vaccine provides effective protection against these new strains [6,25]. In this study, all 28 representative PEDV strains from Yunnan Province belonged to the type GII genotype, indicating that the GII variant has been dominant in the region in recent years. Amino acid homology analysis revealed low similarity between the GII strains and the GI type represented by the CV777 strain but high similarity to the GII variant vaccine strain AJ1102 (Figure 4). This suggests that classical vaccines may not provide adequate protection against PEDV, underscoring the need for updated vaccines.
One strain, YN-LC-1803, was identified as a recombinant strain, with YN-YX-1903 as the major parent and SC-ZY-2 as the minor parent, both belonging to the PEDV GIIb subtype. This finding suggests that recombination and mutation events occur between PEDV in Yunnan and other regions of China. The development of novel, protective vaccines remains a top priority for controlling PED. Since the emergence of highly virulent PEDV variants in China in 2010 [9], the GIIb subtype has been the dominant strain. A GIIb-targeted vaccine, represented by the AJ1102 strain, has been developed and marketed. However, recent epidemiological data indicate a decline in GIIb subtype strains and a rise in GIIa subtype strains over the past two years [29,30], likely due to the widespread use of GIIb-targeted vaccines. The evolutionary pattern of the GII viruses also shows geographic variation. For example, they evolve steadily in South Korea but undergo frequent recombination in China [1].
Two of the twenty-eight Yunnan epidemic strains in this study belonged to the S-INDEL subtype. Lee et al. analyzed the genome of S-INDEL PEDV and found that it likely arose from recombination events between classical and mutant strains [27,31]. The S protein of S-INDEL PEDV closely resembles that of the classical strain, resulting in lower virulence and pathogenicity compared to non-S-INDEL PEDV strains.

5. Conclusions

Collectively, this study demonstrated that PEDV was the primary pathogen causing diarrhea in pigs in Yunnan Province from 2013 to 2022. Other viruses, including PoRV, PoSaV, TGEV, PaStV, and PDCoV, were also prevalent and often co-infected with PEDV. The GII genotype remains dominant according to the phylogenetic analysis of 28 representative Yunnan PEDV strains, with the GIIb subtype prevailing, though the GIIa and S-INDEL subtypes are also present. By analyzing 1851 diarrhea samples collected over a broad time frame and geographic area, this study provides a comprehensive overview of porcine diarrhea epidemiology in Yunnan Province. These findings clarify the role of PEDV and co-infections in swine populations over the past decade and lay a foundation for future epidemiological studies and vaccine development.

Author Contributions

Conceptualization, P.Z., H.Y., C.S. and J.Y.; P.Z., H.Y., X.L. and Y.C. performed the experiments; sample collection, X.S., L.G., R.Y. and T.Y.; P.Z., H.Y. and X.S. analyzed the data; writing—original draft preparation, P.Z. and H.Y.; writing—review and editing, P.Z., H.Y. and J.Y.; funding acquisition, J.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Key Research and Development Plan of Yunnan Province Science and Technology Department (202303AK140031); the Innovation Guidance and Technology-Based Enterprise Cultivation Program of Yunnan Province Science and Technology Department (202304BI090003); and the Major Science and Technology Project of Yunnan Province (202202AE090027).

Institutional Review Board Statement

The animal study protocol was approved by the Yunnan Animal Science and Veterinary Institute with the approval number YNASVI01-2024008.

Data Availability Statement

The gene sequences of the PEDV S gene obtained in this study have been deposited in GenBank under the accession numbers YN-KM-1404 PP923928; YN-QJ-1412 PP923929; YN-SM-1508 PP923930; YN-KM-1503 PP923931; YN-QJ-1507 PP923932; YN-HH-1602 PP923933; YN-WS-1603 PP923934; YN-LN-1603 PP923935; YN-KM-1705 PP923936; YN-KM-1706 PP923937; YN-LC-1803 PP923938; YN-BS-1807 PP923939; YN-BS-1912 PP923940; YN-YX-1903 PP923941; YN-YX-2003 PP923942; YN-YM-2003 PP923943; YN-DL-2107 PP923944; YN-LJ-2112 PP923945; YN-LJ-2203 PP923946; YN-WD-2206 PP923947; YN-WD-22061 PP923948; YN-WD-22062 PP923949; YN-YM-2206 PP923950; YN-YM-22061 PP923951; YN-DL-2207 PP923952; YN-YX-2203 PP923953; YN-QJ-2210 PP923954; and YN-QJ-22101 PP923955.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zhang, H.; Zou, C.; Peng, O.; Ashraf, U.; Xu, Q.; Gong, L.; Fan, B.; Zhang, Y.; Xu, Z.; Xue, C.; et al. Global Dynamics of Porcine Enteric Coronavirus PEDV Epidemiology, Evolution, and Transmission. Mol. Biol. Evol. 2023, 40, msad052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Chen, J.; Wang, C.; Shi, H.; Qiu, H.-J.; Liu, S.; Shi, D.; Zhang, X.; Feng, L. Complete Genome Sequence of a Chinese Virulent Porcine Epidemic Diarrhea Virus Strain. J. Virol. 2011, 85, 11538–11539. [Google Scholar] [CrossRef] [Scilit]
  3. Jung, K.; Saif, L.J.; Wang, Q. Porcine epidemic diarrhea virus (PEDV): An update on etiology, transmission, pathogenesis, and prevention and control. Virus Res. 2020, 286, 198045. [Google Scholar] [CrossRef] [Scilit]
  4. Lin, F.; Zhang, H.; Li, L.; Yang, Y.; Zou, X.; Chen, J.; Tang, X. PEDV: Insights and Advances into Types, Function, Structure, and Receptor Recognition. Viruses 2022, 14, 1744. [Google Scholar] [CrossRef] [Scilit]
  5. Thavorasak, T.; Chulanetra, M.; Glab-Ampai, K.; Teeranitayatarn, K.; Songserm, T.; Yodsheewan, R.; Sae-Lim, N.; Lekcharoensuk, P.; Sookrung, N.; Chaicumpa, W. Novel Neutralizing Epitope of PEDV S1 Protein Identified by IgM Monoclonal Antibody. Viruses 2022, 14, 125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Zhao, Y.; Fan, B.; Song, X.; Gao, J.; Guo, R.; Yi, C.; He, Z.; Hu, H.; Jiang, J.; Zhao, L.; et al. PEDV-spike-protein-expressing mRNA vaccine protects piglets against PEDV challenge. mBio 2024, 15, e02958-23. [Google Scholar] [CrossRef] [Scilit]
  7. Wood, E. An apparently new syndrome of porcine epidemic diarrhoea. Vet. Rec. 1977, 100, 243–244. [Google Scholar] [CrossRef] [Scilit]
  8. Xuan, H.; Xing, D.-K.; Wang, D.-Y.; Zhu, W.; Zhao, F.; Gong, H.; Fei, S. Study on the culture of porcine epidemic diarrhea virus adapted to fetal porcine intestine primary cell monolayer. Chin. J. Vet. Sci. 1984, 4, 202–208. [Google Scholar]
  9. Wang, J.; Zhao, P.; Guo, L.; Liu, Y.; Du, Y.; Ren, S.; Li, J.; Zhang, Y.; Fan, Y.; Huang, B.; et al. Porcine Epidemic Diarrhea Virus Variants with High Pathogenicity, China. Emerg. Infect. Dis. 2013, 19, 2048–2049. [Google Scholar] [CrossRef] [Scilit]
  10. Vlasova, A.N.; Marthaler, D.; Wang, Q.; Culhane, M.R.; Rossow, K.D.; Rovira, A.; Collins, J.; Saif, L.J. Distinct Characteristics and Complex Evolution of PEDV Strains, North America, May 2013–February 2014. Emerg. Infect. Dis. 2014, 20, 1620–1628. [Google Scholar] [CrossRef] [Scilit]
  11. Ojkic, D.; Hazlett, M.; Fairles, J.; Marom, A.; Slavic, D.; Maxie, G.; Alexandersen, S.; Pasick, J.; Alsop, J.; Burlatschenko, S. The first case of porcine epidemic diarrhea in Canada. Can. Vet. J. 2015, 56, 149–152. [Google Scholar] [PubMed]
  12. Sung, M.-H.; Lin, C.-N.; Chiou, M.-T.; Cheng, I.J.; Thanh, Q.-H.; Chao, D.-Y.; Lan, Y.-C. Phylogeographic investigation of 2014 porcine epidemic diarrhea virus (PEDV) transmission in Taiwan. PLoS ONE 2019, 14, e0213153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Zuo, Q.; Zhao, R.; Liu, J.; Zhao, Q.; Zhu, L.; Zhang, B.; Bi, J.; Yang, G.; Liu, J.; Yin, G. Epidemiology and phylogeny of spike gene of porcine epidemic diarrhea virus from Yunnan, China. Virus Res. 2018, 249, 45–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Zhang, R.; Yin, G.; Wang, Y.; Li, Y.; Wang, X.; Bi, J.; Yang, G.; Qu, K.; Gao, L. Whole-Genome Analysis of Porcine Epidemic Diarrhea Virus from Yunnan, China. Vet. Sci. 2024, 11, 548. [Google Scholar] [CrossRef] [Scilit]
  15. Koonpaew, S.; Teeravechyan, S.; Frantz, P.N.; Chailangkarn, T.; Jongkaewwattana, A. PEDV and PDCoV Pathogenesis: The Interplay Between Host Innate Immune Responses and Porcine Enteric Coronaviruses. Front. Vet. Sci. 2019, 6, 00034. [Google Scholar] [CrossRef] [Scilit]
  16. Su, M.; Li, C.; Qi, S.; Yang, D.; Jiang, N.; Yin, B.; Guo, D.; Kong, F.; Yuan, D.; Feng, L.; et al. A molecular epidemiological investigation of PEDV in China: Characterization of co-infection and genetic diversity of S1-based genes. Transbound. Emerg. Dis. 2020, 67, 1129–1140. [Google Scholar] [CrossRef] [Scilit]
  17. Song, D.; Zhou, X.; Peng, Q.; Chen, Y.; Zhang, F.; Huang, T.; Zhang, T.; Li, A.; Huang, D.; Wu, Q.; et al. Newly Emerged Porcine Delta coronavirus Associated With Diarrhoea in Swine in China: Identification, Prevalence and Full-Length Genome Sequence Analysis. Transbound. Emerg. Dis. 2015, 62, 575–580. [Google Scholar] [CrossRef] [Scilit]
  18. Marthaler, D.; Jiang, Y.; Collins, J.; Rossow, K. Complete Genome Sequence of Strain SDCV/USA/Illinois121/2014, a Porcine Deltacoronavirus from the United States. Genome Announc. 2014, 2, e00218-14. [Google Scholar] [CrossRef] [Scilit]
  19. Shu, X.; Han, F.; Hu, Y.; Hao, C.; Li, Z.; Wei, Z.; Zhang, H. Co-infection of porcine deltacoronavirus and porcine epidemic diarrhoea virus alters gut microbiota diversity and composition in the colon of piglets. Virus Res. 2022, 322, 198954. [Google Scholar] [CrossRef] [Scilit]
  20. Vaishali; Gupta, R.; Kumar, M.; Bansal, N.; Vivek; Kumar, P.; Kumar, P.; Jindal, N. Coinfection of porcine astrovirus and other porcine viruses in diarrheic pigs in Haryana, India. Arch. Virol. 2023, 168, 246. [Google Scholar] [CrossRef] [Scilit]
  21. Wang, E.; Guo, D.; Li, C.; Wei, S.; Wang, Z.; Liu, Q.; Zhang, B.; Kong, F.; Feng, L.; Sun, D. Molecular Characterization of the ORF3 and S1 Genes of Porcine Epidemic Diarrhea Virus Non S-INDEL Strains in Seven Regions of China, 2015. PLoS ONE 2016, 11, e0160561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Chen, Q.; Wang, L.; Zheng, Y.; Zhang, J.; Guo, B.; Yoon, K.-J.; Gauger, P.C.; Harmon, K.M.; Main, R.G.; Li, G. Metagenomic analysis of the RNA fraction of the fecal virome indicates high diversity in pigs infected by porcine endemic diarrhea virus in the United States. Virol. J. 2018, 15, 95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Liu, X.; Song, C.; Liu, Y.; Qu, K.; Bi, J.; Bi, J.; Wang, Y.; Yang, Y.; Sun, J.; Guo, Z.; et al. High Genetic Diversity of Porcine Sapovirus From Diarrheic Piglets in Yunnan Province, China. Front. Vet. Sci. 2022, 9, 854905. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Yang, Q.; Yang, T.; Yang, J.; Zuo, Y.; Li, J. Seroepidemiological survey of porcine epidemic diarrhea in selected areas of Yunnan Province from 2019 to 2021. Pig Breed. 2022, 5, 117–119. [Google Scholar] [CrossRef]
  25. Chen, P.; Wang, K.; Hou, Y.; Li, H.; Li, X.; Yu, L.; Jiang, Y.; Gao, F.; Tong, W.; Yu, H.; et al. Genetic evolution analysis and pathogenicity assessment of porcine epidemic diarrhea virus strains circulating in part of China during 2011–2017. Infect. Genet. Evol. 2019, 69, 153–165. [Google Scholar] [CrossRef] [Scilit]
  26. Wang, D.; Fang, L.; Xiao, S. Porcine epidemic diarrhea in China. Virus Res. 2016, 226, 7–13. [Google Scholar] [CrossRef] [Scilit]
  27. Lee, C. Porcine epidemic diarrhea virus: An emerging and re-emerging epizootic swine virus. Virol. J. 2015, 12, 193. [Google Scholar] [CrossRef] [Scilit]
  28. Luo, H.; Liang, Z.; Lin, J.; Wang, Y.; Liu, Y.; Mei, K.; Zhao, M.; Huang, S. Research progress of porcine epidemic diarrhea virus S protein. Front. Microbiol. 2024, 15, 1396894. [Google Scholar] [CrossRef] [Scilit]
  29. Peng, Q.; Fu, P.; Zhou, Y.; Lang, Y.; Zhao, S.; Wen, Y.; Wang, Y.; Wu, R.; Zhao, Q.; Du, S.; et al. Phylogenetic Analysis of Porcine Epidemic Diarrhea Virus (PEDV) during 2020–2022 and Isolation of a Variant Recombinant PEDV Strain. Int. J. Mol. Sci. 2024, 25, 10878. [Google Scholar] [CrossRef] [Scilit]
  30. Lu, Y.; Huang, W.; Lu, Z.; Zeng, D.; Yu, K.; Bai, J.; Qin, Q.; Long, M.; Qin, Y.; Chen, Y.; et al. Genetic characteristics associated with the virulence of porcine epidemic diarrhea virus (PEDV) with a naturally occurring truncated ORF3 gene. Vet. Res. 2024, 55, 123. [Google Scholar] [CrossRef] [Scilit]
  31. Guo, J.; Fang, L.; Ye, X.; Chen, J.; Xu, S.; Zhu, X.; Miao, Y.; Wang, D.; Xiao, S. Evolutionary and genotypic analyses of global porcine epidemic diarrhea virus strains. Transbound. Emerg. Dis. 2019, 66, 111–118. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Detection rates of different diarrhea virus infection types in 1851 samples from Yunnan Province.
Figure 1. Detection rates of different diarrhea virus infection types in 1851 samples from Yunnan Province.
Viruses 17 00264 g001
Figure 2. Geographical distribution of detected PEDV in Yunnan Province.
Figure 2. Geographical distribution of detected PEDV in Yunnan Province.
Viruses 17 00264 g002
Figure 3. Gel picture of the PEDV S genes from a representative strain.
Figure 3. Gel picture of the PEDV S genes from a representative strain.
Viruses 17 00264 g003
Figure 4. Phylogenetic tree based on the PEDV S genes of the 28 representative PEDV strains, created using the neighbor-joining (NJ) method. Viruses 17 00264 i001: classical strain GI group; Viruses 17 00264 i002: variant GIIa subgroup; Viruses 17 00264 i003: variant GIIb subgroup; Viruses 17 00264 i004: S-INDEL subgroup; Viruses 17 00264 i005: representative PEDV strains.
Figure 4. Phylogenetic tree based on the PEDV S genes of the 28 representative PEDV strains, created using the neighbor-joining (NJ) method. Viruses 17 00264 i001: classical strain GI group; Viruses 17 00264 i002: variant GIIa subgroup; Viruses 17 00264 i003: variant GIIb subgroup; Viruses 17 00264 i004: S-INDEL subgroup; Viruses 17 00264 i005: representative PEDV strains.
Viruses 17 00264 g004
Figure 5. Recombination plot of RDP 4 genes.
Figure 5. Recombination plot of RDP 4 genes.
Viruses 17 00264 g005
Figure 6. Simplot gene recombination plot.
Figure 6. Simplot gene recombination plot.
Viruses 17 00264 g006
Table 1. Primers used in the polymerase chain reaction amplification reaction.
Table 1. Primers used in the polymerase chain reaction amplification reaction.
Target GenesSequence (5′-3′)Product Size (bp)
PEDV-S1CTTCCAACACTCAGCCTACC1216
CAGCATCCAACAAACCGAGA
PEDV-S2CCTCAGATCCTCATTTAGCC1153
TAGAAGAAACCAGGCAACTC
PEDV-S3GCATTTTGGCAGGTGTTTAT1239
GAACATCGGCTGAAAGAATG
PEDV-S4CAATTGCTTGCTGAGTCTTT1015
CAATGATCAACCAAACCCAC
PEDV-S5TAGCTTCTCTGCCCAATAGA371
AGCTTCGTAAGGTTGAAGTC
PEDV-NCAAACGGGTGCCATTATCTCT901
TTCGACAAATTCCGCATCTCC
TGEV-SGTTTTCACTCGCAAATGCAG571
CACACATACCAAGGCCAT
PoRV-VP6GAACATGTCGTGCCATTG257
GTGGTCGTACTAGCTGAAAT
PoSaV-VP1GTGATGTGGTTGAGAATGTG510
CATAGGTGAAAGTGGTGTCT
PaStV-0RF2AGAAGGAGAAAACAGAGCAAG693
TTTTGTATCTTCGCCCTTGA
PDCoV-NTCGTGTTACTTGGGTTAAGG636
TCTTGTTTGTCAGGCTTCTT
Table 2. Detailed information about the downloaded full-length sequences of the PEDV S gene.
Table 2. Detailed information about the downloaded full-length sequences of the PEDV S gene.
StrainsAccessionCountriesYearStrainsAccessionCountriesYear
CV777AF353511Switzerland1978AJ1102JX188454China2011
CV777JN599150China1994JS2008KC109141China2008
CH/HN2247KX981440China2016PEDV4-S-3KT313038China2015
KNV-1305KJ662670South Korea2014USA/indiana/17835KF452323USA2013
K14JB01KJ623926South Korea2014HBHG1KY775045China2016
LNBX-2018MT294132China2018VN/JFP1013-1KJ960178Vietnam2014
CH/GZJP/2017MH593138China2017GDhz18MN368716China2019
USA/MinnesotaKR265843USA2014CH/SCCZ/2018MH593148China2018
CH/SCNJ-1MW145535China2020USA/Missouri102KJ645693USA2013
CH/SCQL-1MN617866China2018swun-Y1-SCCQMK820041China2019
OH851KJ399978USA2014SM98-5PKJ857455South Korea1998
JS-HZ2012KC210147China2012KNU-1406-1KM403155South Korea2014
CHGD-01JX261936China2011YnP7MG334008China2017
HK2021OL762457China2021SC2021OL411879China2021
SC-ZY-1KR732651China2014SX-TY1/2017MN412571China2017
VN97/HN/2013HX982561China2013GDsg16-1MN368690China2016
FGE-20140427KJ777677China2014CH/JLDH/2016MF346935China2016
DR13JQ023162South Korea2011PC21AKR078299USA2013
KNU-0801GU180142South Korea2009USA/Colorado/2013KF272920USA2013
83P-5AB548618Japan2010
Table 3. Detailed information about the fecal samples over the past decade.
Table 3. Detailed information about the fecal samples over the past decade.
CityYearWeaned PigletNursery PigFattening PigTotalRepresentative Epidemic Strains
Zhaotong2022, 201635100508643
Dali2022, 2018, 2017, 2015, 2014212085126YN-DL-2107, YN-DL-2207
Yuxi2022, 2020, 2021, 20155924083YN-YX-1903, YN-YX-2003, YN-YX-2203
Chuxiong2022, 201745 127172YN-YM-2003, YN-YM-2206, YN-YM-22061, YN-WD-2206, YN-WD-22061, YN-WD-22062
Qujing2022, 2019, 20151747840292YN-QJ-1412, YN-QJ-1507, YN-QJ-2210, YN-QJ-22101, YN-LL-1603
Baoshan2022001515YN-BS-1807, YN-BS-1912
Kunming2022, 2016, 20155725146228YN-KM-1404, YN-KM-1503, YN-KM-1705, YN-KM-1706, YN-SM-1508
Honghe2016, 2013771390180YN-HH-1602
Lincang2022, 2018006565YN-LC-1803
Lijiang2022220022YN-LJ-2112, YN-LJ-2203
Wenshan2022, 2016250025YN-WS-1603
Total2013~202251526010761851
Table 4. Population and seasonal distributions of PEDV in Yunnan Province.
Table 4. Population and seasonal distributions of PEDV in Yunnan Province.
Population/SeasonSample SizePositive CasesDetection Rate
Fattening Pig1076938.64%
Weaned Piglet51532162.3%
Suckling Sow26013652.3%
Spring44727561.5%
Summer7659712.7%
Fall5924923.7%
Winter390 12933.1%
Table 5. Comparison of amino acid difference sites between Yunnan strains and CV777 strain.
Table 5. Comparison of amino acid difference sites between Yunnan strains and CV777 strain.
Mutation SiteAmino Acid MutationMutation SiteAmino Acid MutationMutation SiteAmino Acid Mutation
58S→L123S→L127F→S
166A→V218P→L220I→S
237Y→C240T→I247K→R
290P→H302P→L334S→P
343E→Q389I→T412Q→L
414S→F428R→K462–463PS→LF
471T→M504I→T527L→F
584R→S687N→D719R→W
721Q deletion744S→P772E→G
832P→L852T→I862T→M
906L→Q911R→H922A→V
932T→I941R→C945L insertion
959R→L1026S→A1029N→T
1146L→I1155G→D1214S→R
1259Y→H1265S→F1283H→Y
1284I insertion1285Q deletion1286H→Y
1291C→S1303H→Y1313–1314SL→LF
1339V→A
Table 6. Comparison of amino acid difference sites between Yunnan strains and AJ1102 strains.
Table 6. Comparison of amino acid difference sites between Yunnan strains and AJ1102 strains.
Mutation SiteAmino Acid MutationMutation SiteAmino Acid MutationMutation SiteAmino Acid Mutation
453H→L462P→L579S→F
875S→L902A→V911R→H
947Q→L959R→L983I→T
1259Y→H1280S→P
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhu, P.; Yuan, H.; Shu, X.; Li, X.; Cui, Y.; Gao, L.; Yan, R.; Yu, T.; Song, C.; Yao, J. Epidemiological Study and Genetic Diversity Assessment of Porcine Epidemic Diarrhea Virus (PEDV) in Yunnan Province, China. Viruses 2025, 17, 264. https://doi.org/10.3390/v17020264

AMA Style

Zhu P, Yuan H, Shu X, Li X, Cui Y, Gao L, Yan R, Yu T, Song C, Yao J. Epidemiological Study and Genetic Diversity Assessment of Porcine Epidemic Diarrhea Virus (PEDV) in Yunnan Province, China. Viruses. 2025; 17(2):264. https://doi.org/10.3390/v17020264

Chicago/Turabian Style

Zhu, Pei, Hong Yuan, Xianghua Shu, Xue Li, Yaoxing Cui, Lin Gao, Rui Yan, Taoying Yu, Chunlian Song, and Jun Yao. 2025. "Epidemiological Study and Genetic Diversity Assessment of Porcine Epidemic Diarrhea Virus (PEDV) in Yunnan Province, China" Viruses 17, no. 2: 264. https://doi.org/10.3390/v17020264

APA Style

Zhu, P., Yuan, H., Shu, X., Li, X., Cui, Y., Gao, L., Yan, R., Yu, T., Song, C., & Yao, J. (2025). Epidemiological Study and Genetic Diversity Assessment of Porcine Epidemic Diarrhea Virus (PEDV) in Yunnan Province, China. Viruses, 17(2), 264. https://doi.org/10.3390/v17020264

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop