Molecular Identification of the Viruses Associated with Sweetpotato Diseases in Côte d’Ivoire
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Sites and Parameters Evaluated
2.2. Assessment of Incidence, Severity, and Vector Abundance
2.3. Collection of Sweetpotato Leaf Samples
2.4. Nucleic Acid Extraction and PCR Amplification of DNA Viruses
2.5. Nucleic Acid Extraction and RT-PCR Amplification of RNA Viruses
| Type of Virus | Virus | Primers | Sequences (5′-3′) | Size (pb) | References |
|---|---|---|---|---|---|
| DNA Viruses | Sweepovirus (SPLCV) | SPG1 | CCCCKGTGCGWRAATCCAT | 912 | [21] |
| SPG2 | ATCCVAAYWTYCAGGGAGCTAA | ||||
| Badna SPPV-B | SPBadna1 3150 F | CTACAACTCTCAACCATATGTCCCTC | 1050 | [22] | |
| SPBadna2 3550 R | TGGAACCAAGATCAAGGAAGAA | 500 | |||
| RNA viruses | Potyvirus (SPFMV) | CP1S | AGTGGGAAGGCACCATACATAGC | 945 | [23] |
| CP1A | GCAGAGGATGTCCTATTGCACACC | ||||
| Crinivirus (SPCSV) | CP-F | ATGGCTGATAGCACTAAAGTCGA | 774 | [24] | |
| CP-R | TCAACAGTGAAGACCTGTTCCAG | ||||
| Cucumovirus (CMV) | CMV primer 1 | GCCGTAAGCTGGATGGACAA | 501-subgroupII, 482-487-subgroupI | [25] | |
| CMV primer 2 | TATGATAAGAAGCTTGTTTCGCG |
2.6. Statistical Analysis
2.7. Sequencing and Phylogenetic Analysis
3. Results
3.1. Geographical Distribution of the Sweetpotato Fields Surveyed
3.2. Symptoms Observed in the Fields
3.3. Disease Incidence, Symptom Severity, and Vector Abundance
3.4. Molecular Detection and Distribution of Sweetpotato Viruses in Côte d’Ivoire
3.5. Viral Infection Rates by Cropping System
3.6. Sequencing and Phylogenetic Relationships
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Alula, K.; Zeleke, H.; Manikandan, M. In Vitro Propagation of Sweet Potato (Ipomoea batatas (L.) Lam.) through Apical Meristem Culture. J. Pharmacogn. Phytochem. 2018, 7, 2386–2392. [Google Scholar]
- Bell, A. Les Richesses Du Sol: Les Plantes à Racines et Tubercules En Afrique: Une Contribution Au Développement Des Technologies de Récolte et d’après-Récolte; ZEL: Eschborn, Alemania, 2000. [Google Scholar]
- Tairo, F.; Mneney, E.; Kullaya, A. Morphological and Agronomical Characterization of Sweet Potato [Ipomoea batatas (L.) Lam.] Germplasm Collection from Tanzania. Afr. J. Plant Sci. 2008, 2, 77–85. [Google Scholar]
- FAO FAOSTAT. 2023. Available online: http://www.fao.org/faostat (accessed on 10 November 2025).
- Abidin, P.E.; Akansake, D.A.; Asare, K.B.; Acheremu, K.; Carey, E.E. Effect of Sources of Sweetpotato Planting Material for Quality Vine and Root Yield. Open Agric. 2017, 2, 244–249. [Google Scholar] [CrossRef] [Scilit]
- Villalba, A.; Martínez-Ispizua, E.; Morard, M.; Crespo-Sempere, A.; Albiach-Marti, M.R.; Calatayud, A.; Penella, C. Optimizing Sweet Potato Production: Insights into the Interplay of Plant Sanitation, Virus Influence, and Cooking Techniques for Enhanced Crop Quality and Food Security. Front. Plant Sci. 2024, 15, 1357611. [Google Scholar] [CrossRef] [Scilit]
- Cuellar, W.J.; Galvez, M.; Fuentes, S.; Tugume, J.; Kreuze, J. Synergistic Interactions of Begomoviruses with Sweet potato chlorotic stunt virus (Genus Crinivirus) in sweet potato (Ipomoea batatas L.). Mol. Plant Pathol. 2015, 16, 459–471. [Google Scholar] [CrossRef] [Scilit]
- Souto, E.R.; Sim, J.; Chen, J.; Valverde, R.A.; Clark, C.A. Properties of Strains of Sweet potato feathery mottle virus and Two Newly Recognized Potyviruses Infecting Sweet Potato in the United States. Plant Dis. 2003, 87, 1226–1232. [Google Scholar] [CrossRef] [Scilit]
- Ateka, E.M.; Njeru, R.W.; Kibaru, A.G.; Kimenju, J.W.; Barg, E.; Gibson, R.W.; Vetten, H.J. Identification and Distribution of Viruses Infecting Sweet Potato in Kenya. Ann. Appl. Biol. 2004, 144, 371–379. [Google Scholar] [CrossRef] [Scilit]
- Loebenstein, G. Control of Sweet Potato Virus Diseases. In Advances in Virus Research; Elsevier: Amsterdam, The Netherlands, 2015; Volume 91, pp. 33–45. [Google Scholar]
- Mukasa, S.B.; Rubaihayo, P.R.; Valkonen, J.P.T. Interactions between a Crinivirus, an Ipomovirus and a Potyvirus in Coinfected Sweetpotato Plants. Plant Pathol. 2006, 55, 458–467. [Google Scholar] [CrossRef] [Scilit]
- Fauquet, C.; Thouvenel, J.-C. Maladies Virales des Plantes en Côte d’Ivoire/Plant Viral Diseases in the Ivory Coast, 2nd ed.; ORSTOM: Paris, France, 1987. [Google Scholar]
- Tibiri, E.B.; Tiendrébéogo, F.; Pita, J.S.; Somé, K.; Bangratz, M.; Néya, J.B.; Brugidou, C.; Barro, N. Molecular and Biological Features of Sweet Potato Leaf Curl Virus in Burkina Faso. Acta Sci. Microbiol. 2019, 2, 170–177. [Google Scholar]
- Chabi, N.K.A.; Name, P.E.; Tibiri, E.B.; Moumouni-Moussa, I.; Sikirou, R.; Desoignies, N.; Zinsou, V.A.; Tiendrebeogo, F.; Afouda, C.L.A. Identification of Viruses Infecting Sweetpotato ( Ipomoea batatas Lam.) in Benin. Open Agric. 2024, 9, 20220403. [Google Scholar] [CrossRef] [Scilit]
- Halle, B.; Bruzon, V. Environmental Profile of Ivoiry Coast; Final Report; Consort. AFC; AGRIFOR Consult: Sydney, Australia, 2006; Volume 133. [Google Scholar]
- Kouakou, B.S.M.; Yoboué, A.A.N.; Pita, J.S.; Mutuku, J.M.; Otron, D.H.; Kouassi, N.K.; Kouassi, K.M.; Vanié-Léabo, L.P.L.; Ndougonna, C.; Zouzou, M.; et al. Gradual Emergence of East African Cassava Mosaic Cameroon Virus in Cassava Farms in Côte d’Ivoire. Agronomy 2024, 14, 418. [Google Scholar] [CrossRef] [Scilit]
- Kouassi, D.E.O.; N’Zué, B.; Bonny, B.S.; Dibi, K.E.B.; Essis, B.S.; Koné, T.; Kouakou, A.M.; Koné, M. Diversity and Relationships among Morphological Characters in the Sweet Potato Collection of Cote D’Ivoire. Afr. Crop Sci. J. 2019, 27, 375–394. [Google Scholar] [CrossRef] [Scilit]
- Sseruwagi, P.; Sserubombwe, W.S.; Legg, J.P.; Ndunguru, J.; Thresh, J.M. Methods of Surveying the Incidence and Severity of Cassava Mosaic Disease and Whitefly Vector Populations on Cassava in Africa: A Review. Virus Res. 2004, 100, 129–142. [Google Scholar] [CrossRef] [Scilit]
- McEwan, M.; Almekinders, C.; Abidin, P.E.; Andrade, M.; Carey, E.E.; Gibson, R.W.; Naico, A.; Namanda, S.; Schulz, S. Can Small Still Be Beautiful? Moving Local Sweetpotato Seed Systems to Scale in Sub-Saharan Africa. In Potato and Sweetpotato in Africa: Transforming the Value Chains for Food and Nutrition Security; Low, J., Nyongesa, M., Quinn, S., Parker, M., Eds.; CABI: Oxford, UK, 2015; pp. 289–310. ISBN 978-1-78064-420-2. [Google Scholar]
- Doyle, J.J.; Doyle, J.L. A Rapid DNA Isolation Procedure for Small Quantities of Fresh Leaf Tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
- Li, R.; Salih, S.; Hurtt, S. Detection of Geminiviruses in Sweetpotato by Polymerase Chain Reaction. Plant Dis. 2004, 88, 1347–1351. [Google Scholar] [CrossRef] [Scilit]
- Kreuze, J.F.; Perez, A.; Gargurevich, M.G.; Cuellar, W.J. Badnaviruses of Sweet Potato: Symptomless Coinhabitants on a Global Scale. Front. Plant Sci. 2020, 11, 313. [Google Scholar] [CrossRef] [Scilit]
- Prasanth, G.; Hegde, V. Occurrence of Sweet potato feathery mottle virus and Sweet potato leaf curl Georgia virus on Sweet Potato in India. Plant Dis. 2008, 92, 311. [Google Scholar] [CrossRef] [Scilit]
- Qin, Y.; Wang, L.; Zhang, Z.; Qiao, Q.; Zhang, D.; Tian, Y.; Wang, S.; Wang, Y.; Yan, Z. Complete Genomic Sequence and Comparative Analysis of the Genome Segments of Sweet Potato Chlorotic Stunt Virus in China. PLoS ONE 2014, 9, e106323. [Google Scholar] [CrossRef] [Scilit]
- Wylie, S.; Wilson, C.R.; Jones, R.A.C.; Jones, M.G.K. A Polymerase Chain Reaction Assay for Cucumber Mosaic Virus in Lupin Seeds. Aust. J. Agric. Res. 1993, 44, 41–51. [Google Scholar] [CrossRef] [Scilit]
- Bao, Y.; Chetvernin, V.; Tatusova, T. Improvements to Pairwise Sequence Comparison (PASC): A Genome-Based Web Tool for Virus Classification. Arch. Virol. 2014, 159, 3293–3304. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit]
- Afzal, N.; Afionis, S.; Stringer, L.C.; Favretto, N.; Sakai, M.; Sakai, P. Benefits and Trade-Offs of Smallholder Sweet Potato Cultivation as a Pathway toward Achieving the Sustainable Development Goals. Sustainability 2021, 13, 552. [Google Scholar] [CrossRef] [Scilit]
- Mutegi, R.W. Molecular Characterization of Transgenic Sweet Potatoes (Ipomoea batatas (L.) Lam.) Following Genetic Transformation with Viral Coat Proteins and Gus Genes. Ph.D. Thesis, Kenyatta University, Nairobi, Kenya, 2005. [Google Scholar]
- Untiveros, M.; Fuentes, S.; Salazar, L.F. Synergistic Interaction of Sweet potato chlorotic stunt virus (Crinivirus ) with Carla-, Cucumo-, Ipomo-, and Potyviruses Infecting Sweet Potato. Plant Dis. 2007, 91, 669–676. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gibson, R.W.; Mpembe, I.; Alicai, T.; Carey, E.E.; Mwanga, R.O.M.; Seal, S.E.; Vetten, H.J. Symptoms, Aetiology and Serological Analysis of Sweet Potato Virus Disease in Uganda. Plant Pathol. 1998, 47, 95–102. [Google Scholar] [CrossRef] [Scilit]
- Valverde, R.A.; Clark, C.A.; Valkonen, J.P. Viruses and Virus Disease Complexes of Sweetpotato. Plant Viruses 2007, 1, 116–126. [Google Scholar]
- Karyeija, R.F.; Gibson, R.W.; Valkonen, J.P.T. Resistance to Sweet Potato Virus Disease (SPVD) in Wild East African Ipomoea. Ann. Appl. Biol. 1998, 133, 39–44. [Google Scholar] [CrossRef] [Scilit]
- Thresh, J.M.; Cooter, R.J. Strategies for Controlling Cassava Mosaic Virus Disease in Africa. Plant Pathol. 2005, 54, 587–614. [Google Scholar] [CrossRef] [Scilit]
- Clark, C.A.; Davis, J.A.; Abad, J.A.; Cuellar, W.J.; Fuentes, S.; Kreuze, J.F.; Gibson, R.W.; Mukasa, S.B.; Tugume, A.K.; Tairo, F.D. Sweetpotato Viruses: 15 Years of Progress on Understanding and Managing Complex Diseases. Plant Dis. 2012, 96, 168–185. [Google Scholar] [CrossRef] [Scilit]
- Omondi, A.B.; Obeng-Ofori, D.; Kyerematen, R.A.; Danquah, E.Y. Host Preference and Suitability of Some Selected Crops for Two Biotypes of Bemisia tabaci in Ghana. Entomol. Exp. Appl. 2005, 115, 393–400. [Google Scholar] [CrossRef] [Scilit]
- Thresh, J.M. The Ecology of Tropical Plant Viruses. Plant Pathol. 1991, 40, 324. [Google Scholar] [CrossRef] [Scilit]
- Kouadio, K.T.; Agneroh, T.A.; Kesse, T.F.; Soro, K. Contribution à l’inventaire Des Plantes Hôtes Du Virus de La Mosaïque Du Concombre Dans La Commune de Yamoussoukro, Côte d’Ivoire. Int. J. Biol. Chem. Sci. 2015, 9, 1950–1961. [Google Scholar] [CrossRef] [Scilit]
- Sossah, F.L.; Appiah, A.S.; Oduro, V.; Amoatey, H.M.; Owusu, G.K.; Oppong, A.; Lamptey, J.N.L.; Carey, E.E.; Fuentes, S. Incidence of Sweet Potato Viruses in the Coastal Savannah Agro-Ecological Zone of Ghana. J. Plant Pathol. 2015, 97, 109–117. [Google Scholar]
- Ng, J.C.K.; Falk, B.W. Virus-Vector Interactions Mediating Nonpersistent and Semipersistent Transmission of Plant Viruses. Annu. Rev. Phytopathol. 2006, 44, 183–212. [Google Scholar] [CrossRef] [Scilit]
- Eigenbrode, S.D.; Bosque-Pérez, N.A.; Davis, T.S. Insect-Borne Plant Pathogens and Their Vectors: Ecology, Evolution, and Complex Interactions. Annu. Rev. Entomol. 2018, 63, 169–191. [Google Scholar] [CrossRef] [Scilit]
- Naveed, H.; Islam, W.; Jafir, M.; Andoh, V.; Chen, L.; Chen, K. A Review of Interactions between Plants and Whitefly-Transmitted Begomoviruses. Plants 2023, 12, 3677. [Google Scholar] [CrossRef] [Scilit]
- Whitfield, A.E.; Falk, B.W.; Rotenberg, D. Insect Vector-Mediated Transmission of Plant Viruses. Virology 2015, 479–480, 278–289. [Google Scholar] [CrossRef] [Scilit]
- Yoon, J.-Y.; Palukaitis, P. Cucumber Mosaic Virus 1a Protein Interacts with the Tobacco SHE1 Transcription Factor and Partitions between the Nucleus and the Tonoplast Membrane. Plant Pathol. J. 2021, 37, 182. [Google Scholar] [CrossRef] [Scilit]
- Mochizuki, T.; Ohki, S.T. Cucumber mosaic virus: Viral Genes as Virulence Determinants. Mol. Plant Pathol. 2012, 13, 217–225. [Google Scholar] [CrossRef] [Scilit]
- Tairo, F.; Mukasa, S.B.; Jones, R.A.C.; Kullaya, A.; Rubaihayo, P.R.; Valkonen, J.P.T. Unravelling the Genetic Diversity of the Three Main Viruses Involved in Sweet Potato Virus Disease (SPVD), and Its Practical Implications. Mol. Plant Pathol. 2005, 6, 199–211. [Google Scholar] [CrossRef] [Scilit]
- Moyer, J.W.; Salazar, L.F. Viruses and Virus-like Diseases of Sweet Potato. Plant Dis. 1989, 73, 451–455. [Google Scholar] [CrossRef] [Scilit]
- Rännäli, M.; Czekaj, V.; Jones, R.A.C.; Fletcher, J.D.; Davis, R.I.; Mu, L.; Valkonen, J.P.T. Molecular Characterization of Sweet potato feathery mottle virus (SPFMV) Isolates from Easter Island, French Polynesia, New Zealand, and Southern Africa. Plant Dis. 2009, 93, 933–939. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kashif, M.; Pietilä, S.; Artola, K.; Jones, R.A.C.; Tugume, A.K.; Mäkinen, V.; Valkonen, J.P.T. Detection of Viruses in Sweetpotato from Honduras and Guatemala Augmented by Deep-Sequencing of Small-RNAs. Plant Dis. 2012, 96, 1430–1437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trenado, H.P.; Orílio, A.F.; Márquez-Martín, B.; Moriones, E.; Navas-Castillo, J. Sweepoviruses Cause Disease in Sweet Potato and Related Ipomoea Spp.: Fulfilling Koch’s Postulates for a Divergent Group in the Genus Begomovirus. PLoS ONE 2011, 6, e27329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rey, M.E.; Ndunguru, J.; Berrie, L.C.; Paximadis, M.; Berry, S.; Cossa, N.; Nuaila, V.N.; Mabasa, K.G.; Abraham, N.; Rybicki, E.P. Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands. Viruses 2012, 4, 1753–1791. [Google Scholar] [CrossRef] [Scilit]
- Name, P.E.; Tibiri, E.B.; Tiendrébéogo, F.; Sawadogo, S.; Djigma, F.; Traoré, L.; Eni, A.O.; Pita, J.S. Insights into Novel Viral Threats in Sweetpotato from Burkina Faso: Characterisation of Unexplored Pathogens. Viruses 2025, 17, 1222. [Google Scholar] [CrossRef] [Scilit]
- Boonham, N.; Kreuze, J.; Winter, S.; van der Vlugt, R.; Bergervoet, J.; Tomlinson, J.; Mumford, R. Methods in Virus Diagnostics: From ELISA to next Generation Sequencing. Virus Res. 2014, 186, 20–31. [Google Scholar] [CrossRef] [Scilit]
- Devi, P.; Dwivedi, R.; Sankar, R.; Jain, A.; Gupta, S.; Gupta, S. Unraveling the Genetic Web: H-Ras Expression and Mutation in Oral Squamous Cell Carcinoma—A Systematic Review. Head Neck Pathol. 2024, 18, 21. [Google Scholar] [CrossRef] [Scilit]
- Stathers, T.; Namanda, S.; Mwanga, R.O.M.; Khisa, G.; Kapinga, R. Manual for Sweetpotato Integrated Production and Pest Management Farmer Field Schools in Sub-Saharan Africa; Food and Agriculture Organization: Rome, Italy, 2005. [Google Scholar]
- Ishwara Bhat, A.; Selvarajan, R.; Balasubramanian, V. Emerging and Re-Emerging Diseases Caused by Badnaviruses. Pathogens 2023, 12, 245. [Google Scholar] [CrossRef] [Scilit]
- Hull, R. Plant Virology; Academic Press: Cambridge, MA, USA, 2013. [Google Scholar]
- Tumwegamire, S.; Kapinga, R.; Rubaihayo, P.R.; LaBonte, D.R.; Grüneberg, W.J.; Burgos, G.; Zum Felde, T.; Carpio, R.; Pawelzik, E.; Mwanga, R.O. Evaluation of Dry Matter, Protein, Starch, Sucrose, β-Carotene, Iron, Zinc, Calcium, and Magnesium in East African Sweetpotato [Ipomoea batatas (L.) Lam] Germplasm. HortScience 2011, 46, 348–357. [Google Scholar] [CrossRef] [Scilit]







| Score | Description |
|---|---|
| 1 | No symptoms |
| 2 | Very mild symptoms (mosaic, chlorosis) |
| 3 | Symptoms visible on less than 5% of the plant’s leaves |
| 4 | Symptoms visible on 6 to 15% of the plant’s leaves |
| 5 | Symptoms visible on 16 to 33% of the plant’s leaves (less than 1/3) |
| 6 | Symptoms visible on 34 to 66% of the plant’s leaves (less than 2/3) |
| 7 | Symptoms visible on 67 to 99% of the plant’s leaves (more than 2/3) |
| 8 | Symptoms visible on 100% of the plant’s leaves (no stunting) |
| 9 | Symptoms visible on 100% of the plant’s leaves (with stunting or plant death) |
| AEZs | Number of Samples | Number of Healthy Plant | Single Infection (%) | Mixed Infections (%) | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| SPLCV | SPFMV | SPCSV | CMV | SPFMV + CMV | SPLCV + CMV | SPFMV + SPCSV + CMV | SPLCV + SPFMV + CMV | |||
| I | 74 (100%) | 10 (13.51%) | 2 (2.70%) | 0 | 0 | 49 (66.22%) | 1 (1.35%) | 11 (14.87%) | 1 (1.35%) | 0 |
| II | 16 (100%) | 2 (12.5%) | 0 | 0 | 0 | 11 (68.75%) | 1 (6.25%) | 2 (12.5%) | 0 | 0 |
| III | 20 (100%) | 5 (25%) | 1 (5%) | 0 | 0 | 11 (55%) | 0 | 3 (15%) | 0 | 0 |
| IV | 19 (100%) | 10 (52.63%) | 2 (10.52%) | 0 | 0 | 6 (31.58%) | 0 | 1 (5.26%) | 0 | 0 |
| V | 32 (100%) | 19 (59.38%) | 2 (6.25%) | 0 | 0 | 6 (18.75%) | 0 | 4 (12.5%) | 0 | 1 (3.12%) |
| VI | 45 (100%) | 24 (53.33%) | 3 (6.67%) | 0 | 0 | 9 (20.00%) | 0 | 9 (20.00%) | 0 | 0 |
| VII | 15 (100%) | 6 (40%) | 2 (13.33%) | 0 | 0 | 4 (26.67%) | 2 (13.33%) | 1 (6.67%) | 0 | 0 |
| Total | 221 (100%) | 76 (34.39%) | 12 (5.43%) | 0 | 0 | 96 (43.44%) | 4 (1.81%) | 31 (14.03%) | 1 (0.45%) | 1 (0.45%) |
| Virus | Samples Found in Monoculture n (%) | Samples Found in Intercropping n (%) | Total | Correlation Coefficient (r) | p-Value |
|---|---|---|---|---|---|
| CMV | 32 (33.33%) | 64 (66.66%) | 96 (100%) | 0.170 | 0.012 * |
| SPLCV | 5 (41.66%) | 7 (58.33%) | 12 (100%) | −0.111 | 0.87 |
| SPFMV + CMV | 0 (0.00%) | 4 (100%) | 4 (100%) | 0.147 | 0.029 * |
| SPLCV + CMV | 12 (38.71%) | 19 (61.29%) | 31 (100%) | 0.0623 | 0.36 |
| SPFMV + SPCSV + CMV | 0 (0.00%) | 1 (100%) | 1 (100%) | 0.0548 | 0.42 |
| SPLCV + SPFMV + CMV | 0 (0.00%) | 1 (100%) | 1 (100%) | 0.0548 | 0.42 |
| Total | 49 (33.79%) | 96 (66.21%) | 145 (100%) | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tapily, E.H.H.; Pita, J.S.; Amoakon, W.J.-L.; Eni, A.; Kouassi, K.M.; Kouassi, N.K.; Tiendrébéogo, F. Molecular Identification of the Viruses Associated with Sweetpotato Diseases in Côte d’Ivoire. Viruses 2025, 17, 1494. https://doi.org/10.3390/v17111494
Tapily EHH, Pita JS, Amoakon WJ-L, Eni A, Kouassi KM, Kouassi NK, Tiendrébéogo F. Molecular Identification of the Viruses Associated with Sweetpotato Diseases in Côte d’Ivoire. Viruses. 2025; 17(11):1494. https://doi.org/10.3390/v17111494
Chicago/Turabian StyleTapily, El Hadj Hussein, Justin S. Pita, William J.-L. Amoakon, Angela Eni, Kan Modeste Kouassi, Nazaire K. Kouassi, and Fidèle Tiendrébéogo. 2025. "Molecular Identification of the Viruses Associated with Sweetpotato Diseases in Côte d’Ivoire" Viruses 17, no. 11: 1494. https://doi.org/10.3390/v17111494
APA StyleTapily, E. H. H., Pita, J. S., Amoakon, W. J.-L., Eni, A., Kouassi, K. M., Kouassi, N. K., & Tiendrébéogo, F. (2025). Molecular Identification of the Viruses Associated with Sweetpotato Diseases in Côte d’Ivoire. Viruses, 17(11), 1494. https://doi.org/10.3390/v17111494

