Iron Metabolism Genes Shape the Course of Liver Fibrosis in Chronic Hepatitis C: From Disease Progression to Reversal After Direct-Acting Antivirals Treatment
Abstract
1. Introduction
2. Materials and Methods
2.1. Populations
2.2. Liver Fibrosis Evaluation:
2.3. HCV-RNA
2.4. Metabolic Evaluation
2.5. DNA Extraction
2.6. Genetic Polymorphisms Identification
3. Results
3.1. Association of Metabolic Parameters of Iron Metabolism with Fibrosis Stage Before DAAs Treatment
3.2. Association of Genetic Polymorphisms Related to Iron Metabolism with Liver Fibrosis Stage
3.3. Association of Genetic Polymorphisms Related to Iron Metabolism with the Improvement of Liver Fibrosis After HCV Clearance with DAAs
3.4. Association of Genetic Polymorphisms with Metabolic Parameters of Iron Metabolism Associated with Severe Liver Fibrosis After HCV Clearance with DAAs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gupta, S.; Read, S.A.; Shackel, N.A.; Hebbard, L.; George, J.; Ahlenstiel, G. The role of micronutrients in the Infection and Subsequent Response to Hepatitis C Virus. Cells 2019, 8, 603. [Google Scholar] [CrossRef]
- Grotto, H.Z.W. Anaemia of cancer: An overview of mechanisms involved in its pathogenesis. Med. Oncol. 2007, 25, 12–21. [Google Scholar] [CrossRef] [PubMed]
- Emerit, J.; Beaumont, C.; Trivin, F. Iron metabolism, free radicals, and oxidative injury. Biomed. Pharmacother. 2001, 55, 333–339. [Google Scholar] [CrossRef] [PubMed]
- Pietrangelo, A. Iron, oxidative stress and liver fibrogenesis. J. Hepatol. 1998, 28, 8–13. [Google Scholar] [CrossRef]
- Silva, B.; Faustino, P. An overview of molecular basis of iron metabolism regulation and the associated pathologies. Biochim. Biophys. Acta (BBA) Mol. Basis Dis. 2015, 1852, 1347–1359. [Google Scholar] [CrossRef]
- Ruta, S.; Vagu, C.; Sultana, C. Serum iron markers in patients with chronic hepatitis C Infection. Hepat. Mon. 2013, 13, e13136. [Google Scholar] [CrossRef]
- Nemeth, E.; Ganz, T. Hepcidin and iron in health and disease. Annu. Rev. Med. 2023, 74, 261–277. [Google Scholar] [CrossRef]
- Guyader, D.; Thirouard, A.-S.; Erdtmann, L.; Rakba, N.; Jacquelinet, S.; Danielou, H.; Perrin, M.; Jouanolle, A.-M.; Brissot, P.; Deugnier, Y. Liver iron is a surrogate marker of severe fibrosis in chronic hepatitis C. J. Hepatol. 2007, 46, 587–595. [Google Scholar] [CrossRef]
- Pirisi, M.; Scott, C.A.; Avellini, C.; Toniutto, P.; Fabris, C.; Soardo, G.; Beltrami, C.A.; Bartoli, E. Iron deposition and progression of disease in chronic hepatitis C: Role of interface hepatitis, portal inflammation, and HFE missense mutations. Am. J. Clin. Pathol. 2000, 113, 546–554. [Google Scholar] [CrossRef]
- Cherayil, B.J. Pathophysiology of Iron Homeostasis during Inflammatory States. J. Pediatr. 2015, 167, S15–S19. [Google Scholar] [CrossRef] [PubMed]
- Fargion, S.; Valenti, L.; Fracanzani, A.L. Beyond hereditary hemochromatosis: New insights into the relationship between iron overload and chronic liver diseases. Dig. Liver Dis. 2011, 43, 89–95. [Google Scholar] [CrossRef]
- Hasan, Y.; Brown, K. Viral eradication restores normal iron status in chronic hepatitis C patients with abnormal iron studies. Ann. Hepatol. 2020, 19, 422–426. [Google Scholar] [CrossRef]
- Sebastiani, G.; Wilkinson, N.; Pantopoulos, K. Pharmacological targeting of the Hepcidin/Ferroportin axis. Front. Pharmacol. 2016, 7, 160. [Google Scholar] [CrossRef]
- Fleming, R.E.; Sly, W.S. Mechanisms of Iron Accumulation in Hereditary Hemochromatosis. Annu. Rev. Physiol. 2002, 64, 663–680. [Google Scholar] [CrossRef]
- Fleming, R.E. Iron Sensing as a Partnership: HFE and Transferrin Receptor 2. Cell Metab. 2009, 9, 211–212. [Google Scholar] [CrossRef][Green Version]
- Brissot, P.; Pietrangelo, P.; Adams, B.; De Graaff, B.; McLaren, C.E.; Loréal, O. Haemochromatosis. Nat Rev. 2018, 4, 1–15. [Google Scholar]
- Le Gac, G.; Férec, C. The molecular genetics of hemochromatosis. Eur. J. Hum. Genet. 2005, 13, 1172–1185. [Google Scholar]
- Smith, B.C.; Grove, J.; Guzail, M.A.; Day, C.P.; Daly, A.K.; Burt, A.D.; Bassendine, M.F. Heterozygosity for hereditary hemochromatosis is associated with more fibrosis in chronic hepatitis C. Hepatology 1998, 27, 1695–1699. [Google Scholar] [CrossRef] [PubMed]
- Geier, A.; Reugels, M.; Weiskirchen, R.; Wasmuth, H.E.; Dietrich, C.G.; Siewert, E.; Gartung, C.; Lorenzen, J.; Bosserhoff, A.K.; Brügmann, M.; et al. Common heterozygous hemochromatosis gene mutations are risk factors for inflammation and fibrosis in chronic hepatitis C. Liver Int. 2004, 24, 285–294. [Google Scholar] [CrossRef] [PubMed]
- Juzėnas, S.; Kupčinskas, J.; Valantienė, I.; Šumskienė, J.; Petrenkienė, V.; Kondrackienė, J.; Kučinskas, L.; Kiudelis, G.; Skiecevičienė, J.; Kupčinskas, L. Association of HFE gene C282Y and H63D mutations with liver cirrhosis in the Lithuanian population. Medicina 2016, 52, 269–275. [Google Scholar] [CrossRef] [PubMed]
- Kouroumalis, E.; Tsomidis, I.; Voumvouraki, A. Iron as a therapeutic target in chronic liver disease. World J. Gastroenterol. 2023, 29, 616–655. [Google Scholar] [CrossRef] [PubMed]
- Thorburn, D.; Curry, G.; Spooner, R.; Spence, E.; Oien, K.; Halls, D.; Fox, R.; McCruden, E.A.B.; MacSween, R.N.M.; Mills, P.R. The role of iron and haemochromatosis gene mutations in the progression of liver disease in chronic hepatitis C. Gut 2002, 50, 248–252. [Google Scholar] [CrossRef] [PubMed]
- Muñoz, M.; García-Erce, J.A.; Remacha, Á.F. Disorders of iron metabolism. Part 1: Molecular basis of iron homoeostasis. J. Clin. Pathol. 2011, 64, 281–286. [Google Scholar] [CrossRef]
- Mayle, K.M.; Le, A.M.; Kamei, D.T. The intracellular trafficking pathway of transferrin. Biochim. Biophys. Acta (BBA) Gen. Subj. 2012, 1820, 264–281. [Google Scholar] [CrossRef]
- Kawabata, H. Transferrin and transferrin receptors update. Free Radic. Biol. Med. 2019, 133, 46–54. [Google Scholar] [CrossRef]
- Blanco–Rojo, R.; Bayele, H.; Srai, S.; Vaquero, M. Intronic SNP rs3811647 of the human transferrin gene modulates its expression in hepatoma cells. Nutr. Hosp. 2012, 27, 2142–2145. [Google Scholar]
- Cho, H.J.; Kim, S.S.; Ahn, S.J.; Park, J.H.; Kim, D.J.; Kim, Y.B.; Cho, S.W.; Cheong, J.Y. Serum transferrin as a liver fibrosis biomarker in patients with chronic hepatitis B. Clin. Mol. Hepatol. 2014, 20, 347–354. [Google Scholar] [CrossRef]
- Yu, Y.; Jiang, L.; Wang, H.; Shen, Z.; Cheng, Q.; Zhang, P.; Wang, J.; Wu, Q.; Fang, X.; Duan, L.; et al. Hepatic transferrin plays a role in systemic iron homeostasis and liver ferroptosis. Blood 2020, 136, 726–739. [Google Scholar] [CrossRef]
- Parajes, S.; González-Quintela, A.; Campos, J.; Quinteiro, C.; Domínguez, F.; Loidi, L. Genetic study of the hepcidin gene (HAMP) promoter and functional analysis of the c.-582A > G variant. BMC Genet. 2010, 11, 110. [Google Scholar] [CrossRef]
- Vela, D. Low hepcidin in liver fibrosis and cirrhosis; a tale of progressive disorder and a case for a new biochemical marker. Mol. Med. 2018, 24, 5. [Google Scholar] [CrossRef] [PubMed]
- Wrighting, D.M.; Andrews, N.C. Interleukin-6 induces hepcidin expression through STAT3. Blood 2006, 108, 3204–3209. [Google Scholar] [CrossRef]
- De lima Santos, P.C.J.; Dinardo, C.L.; Cançado, R.D.; Schettert, I.T.; Krieger, J.E.; Pereira, A.C. Non–HFE hemochromatosis. Rev. Bras. Hematol. Hemoter. 2012, 34, 311–316. [Google Scholar] [CrossRef]
- Liang, L.; Liu, H.; Yue, J.; Liu, L.-r.; Han, M.; Luo, L.-l.; Zhao, Y.-l.; Xiao, H. Association of Single-Nucleotide Polymorphism in the Hepcidin Promoter Gene with Susceptibility to Extrapulmonary Tuberculosis. Genet. Test. Mol. Biomark. 2017, 21, 351–356. [Google Scholar] [CrossRef] [PubMed]
- Silva, B.; Pita, L.; Gomes, S.; Gonçalves, J.; Faustino, P. The hepcidin gene promoter nc.-1010C > T; −582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene. Ann. Hematol. 2014, 93, 2063–2066. [Google Scholar] [CrossRef]
- Suh, J.-S.; Hahn, W.-H.; Lee, J.S.; Park, H.J.; Kim, M.-J.; Kang, S.W.; Chung, J.-H.; Cho, B.-S. Coding polymorphisms of bone morphogenetic protein 2 contribute to the development of childhood IgA nephropathy. Exp. Ther. Med. 2011, 2, 337–341. [Google Scholar] [CrossRef]
- Andrews, N.; Schmidt, P. Iron Homeostasis. Annu. Rev. Physiol. 2007, 69, 69–85. [Google Scholar] [CrossRef]
- Chung, Y.-H.; Huang, Y.-H.; Chu, T.-H.; Chen, C.-L.; Lin, P.-R.; Huang, S.-C.; Wu, D.-C.; Huang, C.-C.; Hu, T.-H.; Kao, Y.-H.; et al. BMP-2 restoration aids in recovery from liver fibrosis by attenuating TGF-β1 signaling. Mod. Pathol. 2018, 98, 999–1013. [Google Scholar] [CrossRef]
- Lamoril, J.; Theou-Anton, N.; Tchernitchko, D. A coding polymorphism in the BMP2 gene is associated with iron overload in non-HFE haemochromatosis patients. Blood Cells Mol. Dis. 2015, 55, 318–319. [Google Scholar] [CrossRef]
- Rogers, M.B.; Shah, T.A.; Shaikh, N.N. Turning bone morphogenetic protein 2 (BMP2) on and off in mesenchymal Cells. J. Cell. Biochem. 2015, 116, 2127–2138. [Google Scholar] [CrossRef] [PubMed]
- Bardou-Jacquet, E.; Ben Ali, Z.; Beaumont-Epinette, M.-P.; Loreal, O.; Jouanolle, A.-M.; Brissot, P. Non-HFE hemochromatosis: Pathophysiological and diagnostic aspects. Clin. Res. Hepatol. Gastroenterol. 2014, 38, 143–154. [Google Scholar] [CrossRef] [PubMed]
- Pantopoulos, K. Inherited Disorders of Iron Overload. Front. Nutr. 2018, 5, 103. [Google Scholar] [CrossRef]
- Pietrangelo, A. Ferroportin disease: Pathogenesis, diagnosis and treatment. Haematologica 2017, 102, 1972–1984. [Google Scholar] [CrossRef]
- EASL recommendations on treatment of hepatitis C: Final update of the series. European Association for the Study of the Liver. J. Hepatol. 2020, 73, 1170–1218. [CrossRef]
- World Medical Association (WMA). Declaration of Helsinki. Ethical principles for medical research involving human subjects. Jahrb. Wiss. Ethik 2009, 14, 233–238. [Google Scholar] [CrossRef]
- Serejo, F.; Marinho, R.; Velosa, J.; Costa, A.; Carneiro de Moura, M. Transient hepatic elastography, a non-invasive method for assessing fibrosis in patients with chronic hepatitis C. GE J. Port. Gastroenterol. 2007, 14, 8–14. [Google Scholar]
- Lahiri, D.; Nurnberger, J. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 1991, 19, 5444. [Google Scholar] [CrossRef] [PubMed]
- Baty, D.; Kwiatkowski, A.T.; Mechan, D.; Harris, A.; Pippard, M.J.; Goudie, D. Development of a multiplex ARMS test for mutations in the HFE gene associated with hereditary haemochromatosis. J. Clin. Pathol. 1998, 51, 73–74. [Google Scholar] [CrossRef] [PubMed]
- Radicheva, M.P.; Andonova, N.A.; Milcheva, H.T.; Ivanova, N.G.; Kyuchukova, S.G.; Nikolova, M.S.; Platikanova, A.S. Serum Markers of Iron Metabolism in Chronic Liver Diseases. Open Access Maced. J. Med. Sci. 2018, 6, 1010. [Google Scholar] [CrossRef] [PubMed]
- Beinker, N.K.; Voigt, M.D.; Arendse, M.; Smit, J.; Stander, I.A.; Kirsch, R.E. Threshold effect of liver iron content on hepatic inflammation and fibrosis in hepatitis B and C. J. Hepatol. 1996, 25, 633–638. [Google Scholar] [CrossRef]
- Milic, S.; Mikolasevic, I.; Orlic, L.; Devcic, E.; Starcevic-Cizmarevic, N.; Stimac, D.; Kapovic, M.; Ristic, S. The Role of Iron and Iron Overload in Chronic Liver Disease. Med. Sci. Monit. 2016, 22, 2144–2151. [Google Scholar] [CrossRef]
- Hui, J.M.; Sud, A.; Farrell, G.C.; Bandara, P.; Byth, K.; Kench, J.G.; McCaughan, G.W.; George, J. Insulin resistance is associated with chronic hepatitis C and virus infection fibrosis progression. Gastroenterology 2003, 125, 1695–1704. [Google Scholar] [CrossRef]
- Mehta, K.J.; Farnaud, S.J.; Sharp, P.A. Iron and liver fibrosis: Mechanistic and clinical aspects. World J. Gastroenterol. 2019, 25, 521–538. [Google Scholar] [CrossRef]
- Allameh, A.; Niayesh-Mehr, R.; Aliarab, A.; Sebastiani, G.; Pantopoulos, K. Oxidative stress in liver pathophysiology and disease. Antioxidants 2023, 12, 1653. [Google Scholar] [CrossRef]
- Schank, M.; Zhao, J.; Wang, L.; Nguyen, L.N.T.; Cao, D.; Dang, X.; Khanal, S.; Zhang, J.; Zhang, Y.; Wu, X.Y.; et al. Oxidative stress induces mitochondrial compromise in CD4 T Cells from chronically HCV-infected individuals. Front. Immunol. 2021, 12, 760707. [Google Scholar] [CrossRef]
- Korenaga, M.; Okuda, M.; Otani, K.; Wang, T.; Li, Y.; Weinman, S.A. Mitochondrial dysfunction in hepatitis C. J. Clin. Gastroenterol. 2005, 39 (Suppl. 2), S162–S166. [Google Scholar] [CrossRef]
- Ciccaglione, A.R.; Costantino, A.; Tritarelli, E.; Marcantonio, C.; Equestre, M.; Marziliano, N.; Rapicetta, M. Activation of endoplasmic reticulum stress response by hepatitis C virus proteins. Arch. Virol. 2005, 150, 1339–1356. [Google Scholar] [CrossRef]
- Osna, N.A.; White, R.L.; Krutik, V.M.; Wang, T.; Weinman, S.A.; Donohue, T.M. Proteasome activation by hepatitis C core protein is reversed by ethanol-induced oxidative stress. Gastroenterology 2008, 134, 2144–2152. [Google Scholar] [CrossRef]
- Jiang, X.; Kanda, T.; Wu, S.; Nakamoto, S.; Wakita, T.; Shirasawa, H.; Yokosuka, O. Hepatitis C virus nonstructural protein 5A inhibits thapsigargin-induced apoptosis. PLoS ONE 2014, 9, e113499. [Google Scholar] [CrossRef]
- Liu, L.; Ito, M.; Sakai, S.; Liu, J.; Ohta, K.; Saito, K.; Nakashima, K.; Satoh, S.; Konno, A.; Suzuki, T.; et al. FGF21 upregulation by hepatitis C virus via the eIF2α-ATF4 pathway: Implications for interferon signaling suppression and TRIM31-mediated TSC degradation. Front. Microbiol. 2024, 15, 1456108. [Google Scholar] [CrossRef]
- Ward, D.M.; Kaplan, J. Ferroportin-mediated iron transport: Expression and regulation. Biochim. Biophys. Acta (BBA) Mol. Cell Res. 2012, 1823, 1426–1433. [Google Scholar] [CrossRef]
- Billesbølle, C.B.; Azumaya, C.M.; Kretsch, R.C.; Powers, A.S.; Gonen, S.; Schneider, S.; Arvedson, T.; Dror, R.O.; Cheng, Y.; Manglik, A. Structure of hepcidin-bound ferroportin reveals iron homeostatic mechanisms. Nature 2020, 586, 807–811. [Google Scholar] [CrossRef]
- Cai, C.; Zeng, D.; Gao, Q.; Ma, L.; Zeng, B.; Zhou, Y.; Wang, H. Decreased ferroportin in hepatocytes promotes macrophages polarize towards an M2-like phenotype and liver fibrosis. Sci. Rep. 2021, 11, 13386. [Google Scholar] [CrossRef]
- Harada, N.; Kanayama, M.; Maruyama, A.; Yoshida, A.; Tazumi, K.; Hosoya, T.; Mimura, J.; Toki, T.; Maher, J.M.; Yamamoto, M.; et al. Nrf2 regulates ferroportin 1-mediated iron efflux and counteracts lipopolysaccharide-induced ferroportin 1 mRNA suppression in macrophages. Arch. Biochem. Biophys. 2011, 508, 101–109. [Google Scholar] [CrossRef]
- Radio, F.C.; Majore, S.; Aurizi, C.; Sorge, F.; Biolcati, G.; Bernabini, S.; Giotti, I.; Torricelli, F.; Giannarelli, D.; De Bernardo, C.; et al. Hereditary hemochromatosis type 1 phenotype modifiers in Italian patients. The controversial role of variants in HAMP, BMP2, FTL and SLC40A1 genes. Blood Cells Mol. Dis. 2015, 55, 71–75. [Google Scholar] [CrossRef] [PubMed]
- Ha, S.Y.; Kim, J.-Y.; Choi, J.H. Transcriptional regulation of genetic variants in the SLC40A1 promoter. Korean J. Physiol. Pharmacol. 2024, 28, 113–120. [Google Scholar] [CrossRef] [PubMed]
- Charlebois, E.; Fillebeen, C.; Katsarou, A.; Rabinovich, A.; Wisniewski, K.; Venkataramani, V.; Michalke, B.; Velentza, A.; Pantopoulos, K. A crosstalk between hepcidin and IRE/IRP pathways controls ferroportin expression and determines serum iron levels in mice. eLife 2022, 11, e81332. [Google Scholar] [CrossRef]
- Castiglione, A.; Ciorba, A.; Aimoni, C.; Orioli, E.; Zeri, G.; Vigliano, M.; Gemmati, D. Sudden Sensorineural Hearing Loss and Polymorphisms in Iron Homeostasis Genes: New Insights from a Case-Control Study. BioMed Res. Int. 2015, 2015, 834736. [Google Scholar] [CrossRef]
- Isac, T.; Isac, S.; Rababoc, R.; Cotorogea, M.; Iliescu, L. Epigenetics in inflammatory liver diseases: A clinical perspective (Review). Exp. Ther. Med. 2022, 23, 11293. [Google Scholar] [CrossRef]
- Schmidt, P.J.; Toran, P.T.; Giannetti, A.M.; Bjorkman, P.J.; Andrews, N.C. The transferrin receptor modulates HFE-Dependent Regulation of hepcidin expression. Cell Metab. 2008, 7, 205–214. [Google Scholar] [CrossRef]
- Donovan, A.; Lima, C.A.; Pinkus, J.L.; Pinkus, G.S.; Zon, L.I.; Robine, S.; Andrews, N.C. The iron exporter ferroportin/Slc40a1 is essential for iron homeostasis. Cell Metab. 2005, 1, 191–200. [Google Scholar] [CrossRef] [PubMed]
- Beutler, E.; Felitti, V.J.; Koziol, J.A.; Ho, N.J.; Gelbart, T. Penetrance of 845G→A (C282Y) HFE hereditary haemochromatosis mutation in the USA. Lancet 2002, 359, 211–218. [Google Scholar] [CrossRef] [PubMed]
- Rossi, E.; Bulsara, M.K.; Olynyk, J.K.; Cullen, D.J.; Summerville, L.; Powell, L.W. Effect of hemochromatosis genotype and lifestyle factors on iron and red cell indices in a community population. Clin. Chem. 2001, 47, 202–208. [Google Scholar] [CrossRef]
- Whitfield, J.; Cullen, L.; Jazwinska, E.; Powell, L.; Heath, A.; Zhu, G.; Duffy, D.; Martin, N. Effects of HFE C282Y and H63D polymorphisms and polygenic background on iron stores in a large community sample of twins. Am. J. Hum. Genet. 2000, 66, 1246–1258. [Google Scholar] [CrossRef]
- Adams, P.; Barton, J. Iron overload and cirrhosis in referred HFE p.C282Y homozygotes with normal transferrin saturation and elevated serum ferritin. Cancer Liver J. 2020, 3, 188–193. [Google Scholar] [CrossRef]
- Jallow, M.W.; Campino, S.; Prentice, A.M.; Cerami, C. Association of common TMPRSS6 and TF gene variants with hepcidin and iron status in healthy rural Gambians. Sci. Rep. 2021, 11, 8075. [Google Scholar] [CrossRef]
- Benyamin, B.; McRae, A.F.; Zhu, G.; Gordon, S.; Henders, A.K.; Palotie, A.; Peltonen, L.; Martin, N.G.; Montgomery, G.W.; Whitfield, J.B.; et al. Variants in TF and HFE explain ∼40% of genetic Vvriation in serum-transferrin levels. Am. J. Hum. Genet. 2009, 84, 60–65. [Google Scholar] [CrossRef]
- McLaren, C.E.; Garner, C.P.; Constantine, C.C.; McLachlan, S.; Vulpe, C.D.; Snively, B.M.; Gordeuk, V.R.; Nickerson, D.A.; Cook, J.D.; Leiendecker-Foster, C.; et al. Genome-wide association study identifies genetic loci associated with iron deficiency. PLoS ONE 2011, 6, e17390. [Google Scholar] [CrossRef] [PubMed]
- Nicolas, G.; Bennoun, M.; Porteu, A.; Mativet, S.; Beaumont, C.; Grandchamp, B.; Sirito, M.; Sawadogo, M.; Kahn, A.; Vaulont, S. Severe iron deficiency anemia in transgenic mice expressing liver hepcidin. Proc. Natl. Acad. Sci. USA 2002, 99, 4596–4601. [Google Scholar] [CrossRef]
- Nemeth, E.; Rivera, S.; Gabayan, V.; Keller, C.; Taudorf, S.; Pedersen, B.K.; Ganz, T. IL-6 mediates hypoferremia of inflammation by inducing the synthesis of the iron-regulatory hormone hepcidin. J. Clin. Investig. 2004, 113, 1271–1276. [Google Scholar] [CrossRef] [PubMed]
- Roetto, A.; Papanikolaou, G.; Politou, M.; Alberti, F.; Girelli, D.; Christakis, J.; Loukopoulos, D.; Camaschella, C. Mutant antimicrobial peptide hepcidin is associated with severe juvenile hemochromatosis. Nat. Genet. 2002, 33, 21–22. [Google Scholar] [CrossRef]
- Andreani, M.; Radio, F.C.; Testi, M.; De Bernardo, C.; Troiano, M.; Majore, S.; Bertucci, P.; Polchi, P.; Rosati, R.; Grammatico, P. Association of hepcidin promoter c.-582 A>G variant and iron overload in thalassemia major. Haematologica 2009, 94, 1293–1296. [Google Scholar] [CrossRef] [PubMed]
- Bruno, F.; Bonalumi, S.; Camaschella, C.; Ferrari, M.; Cremonesi, L. The -582A>G variant of the HAMP promoter is not associated with high serum ferritin levels in normal subjects. Haematologica 2009, 95, 849–850. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Fekri, K.; Rasouli, N.A.; Zavareh, S.A.T.; Jalil, M.; Moradi, F.; Hosseinpour, M.; Teimori, H. Hepcidin and HFE Polymorphisms and Ferritin Level in β-Thalassemia Major. Int. J. Hematol. Stem Cell Res. 2019, 13, 42–48. [Google Scholar] [CrossRef]
- Zarghamian, P.; Azarkeivan, A.; Arabkhazaeli, A.; Mardani, A.; Shahabi, M. Hepcidin gene polymorphisms and iron overload in β-thalassemia major patients refractory to iron chelating therapy. BMC Med. Genet. 2020, 21, 75. [Google Scholar] [CrossRef] [PubMed]

| Before DAAs Treatment (n = 329) | Before DAAs Treatment (n = 134) | After DAAs Treatment (n = 134) | ||||
|---|---|---|---|---|---|---|
| Parameter | Mean | 95% CI | Mean | 95% CI | Mean | 95% CI |
| Age (years) | 48.93 | [47.57–50.28] | 53.42 | [51.47–55.36] | 53.51 | [51.49–55.39] |
| BMI (Kg/m2) | 25.25 | [24.80–25.06] | 25.06 | [20.78–26.10] | ||
| 25.12 | [20.79–25.90] | |||||
| HCV-RNA (IU/mL) | 2.16 × 106 | [1.51 × 106–2.82 × 106] | 2.16 × 106 | [2.03 × 106–4.8 × 106] | 0.00 | - |
| Parameter | n | % | n | % | n | % |
| Gender | ||||||
| Female | 124 | 37.7 | 58 | 43.3 | 58 | 43.3 |
| Male | 205 | 62.3 | 76 | 56.7 | 76 | 56.7 |
| Liver fibrosis | ||||||
| F1 | 84 | 25.6 | 29 | 21.6 | 59 | 44.0 |
| F2 | 130 | 39.5 | 53 | 39.6 | 45 | 33.6 |
| F3 | 35 | 10.6 | 13 | 9.7 | 11 | 8.2 |
| F4 | 80 | 24.3 | 39 | 29.1 | 19 | 14.2 |
| 95% CI—95% confidence interval for mean; n—number of patients; %—percentage of patients; F1—mild fibrisis, F2—moderate fibrosis; F3—severe fibrosis, F4—cirrhosis | ||||||
| Polymorphism | Primers | Amplification Fragments |
|---|---|---|
| HFE C282Y (rs1800562) | Forward_Wt: 5′–GCTGATCCAGGCCTGGGTGCTCCACCTGCC–3′ or Forward_Mut: 5′–GCTGATCCAGGCCTGGGTGCTCCACCTGCT–3′ Reverse: 5’–TGGCAAGGGTAAACAGATCC–3′ | 309 bp |
| HFE H63D (rs1799945) | Forward_Wt: 5′–AGTTCGGGGCTCCACACGGCGACTCTCAAG–3′ or Forward_Mut: 5′–AGTTCGGGGCTCCACACGGCGACTCTCAAC–3′ Reverse: 5’–ACATGGTTAAGGCCTGTTGC–3′ | 177 bp |
| Polymorphism | Amplification Conditions | Reagents | |
|---|---|---|---|
| HFE C282Y (rs1800562) HFE H63D (rs1799945) | 1 cycle Initial denaturation: 94 °C, 4 min 30 cycles Denaturation: 94 °C, 30 s Annealing: 59 °C, 30 s Extension: 72 °C, 30 s 1 cycle Final extension: 72 °C, 5 min | Mix 1 | DNA [25 ng/μL]: 0.5 µL Primer F_C282Y_Wt (25 pmol/μL): 0.5 μL Primer R_C282Y (25 pmol/μL): 0.5 μL Primer F_H63D_Mut (25 pmol/μL): 0.5 μL Primer R_H63D 25 pmol/μL): 0.5 μL dNTP Mixture (2.5 mM each): 0.5 μL * Buffer (10x): 2.5 μL BSA (10 mg/mL): 0.35 μL GoTaq G2 Flexi DNA polymerase (5 U/μL): 0.15 μL H2O: 19 μL |
| HFE C282Y (rs1800562) HFE H63D (rs1799945) | Mix 2 | DNA [25 ng/μL]: 0.5 µL Primer F_C282Y_Mut (25 pmol/μL): 0.5 μL Primer R_C282Y (25 pmol/μL): 0.5 μL Primer F_H63D_Wt (25 pmol/μL): 0.5 μL Primer R_H63D (25 pmol/μL): 0.5 μL dNTP Mixture (2.5 mM each): 0.5 μL * Buffer (10x): 2.5 μL BSA (10 mg/mL): 0.35 μL GoTaq G2 Flexi DNA polymerase (5 U/μL): 0.15 μL H2O: 18.5 μL | |
| * Buffer (10x): 166 mM (NH4)2SO4; 670 mM Tris-HCl pH = 8.8; 67 mM MgCl2; 0.067 mM EDTA; 100 mM β-mercaptoethanol
Primer F_Wt: Primer Forward Wild Type; Primer F_Mut: Primer Forward Mutated; Primer R: Primer Reverse | |||
| Polymorphism | Primers | Amplification Fragment |
|---|---|---|
| TF IVS 11 G>A (rs3811647) | Forward: 5′–TTGCCATGGCTTGCACACAG–3′ Reverse: 5′–TGCCTGTGTGAGGCTCTCTA–3′ | 280 bp |
| Polymorphism | Amplification Conditions | Reagents |
|---|---|---|
| TF IVS 11 G>A (rs3811647) | 1 cycle Initial denaturation: 94 °C, 4 min 30 cycles Denaturation: 94 °C, 30 s Annealing: 59 °C, 30 s Extension: 72 °C, 30 s 1 cycle Final extension: 72 °C, 5 min | DNA [25 ng/μL]: 0.5 µL Primer Forward (25 pmol): 0.5 μL Primer Reverse (25 pmol): 0.5 μL * B Buffer (10×): 23.4 μL GoTaq G2 Flexi DNA polymerase (5 U/μL): 0.1 μL |
| * B Buffer: 50 mM KCl2; 10 mM Tris-HCl pH = 8.8; 150 μM MgCl2; 0.01%(p/v) gelatine, 4 × 25 mM dNTPs | ||
| Polymorphism | Primers | Amplification Fragment |
|---|---|---|
| HAMP-1010 C>T (rs10414846) HAMP-582 A>G (rs10421768) | Forward: 5′–ACTGAGAAGGCAGCCCCTG–3′ Reverse: 5’–CGTGCCGTCTGTCTGGC–3′ | 1139 bp |
| BMP2 570 A>T (rs235768) | Forward: 5′–ACAGAGAGAAGGGAGGCTCC3–3′ Reverse: 5’–CGACACCCACAACCCTCCAC–3′ | 1031 bp |
| SLC40A1 frag. 1 | Forward: 5′–ACCTGCTGAGCCTCCCAAA–3′ Reverse: 5’–ACAACTGGCTAGAACGAAAGGAAATAAA–3′ | 991 bp |
| SLC40A1 frag. 2 | Forward: 5′–TCCTGAGTACAATAGACTAGAAACGAAAAATA–3′ Reverse: 5′–TTACAGCCTCATTTATCACCACCGATT–3′ | 3747 bp |
| SLC40A1 frag. 3 | Forward: 5′–TGAGGCAAATTTAGTGGGACTTGACC–3′ Reverse: 5′–GGGGAATTCAGTGTTATCATTATAGTCTC–3′ | 4175 bp |
| Polymorphism | Amplification Conditions | Reagents |
|---|---|---|
| HAMP -1010 C>T (rs10414846) HAMP -582 A>G (rs10421768) | 1 cycle Initial denaturation: 95 °C, 10 min 30 cycles Denaturation: 95 °C, 45s Annealing: 67 °C, 45 s Extension: 72 °C, 100 s 1 cycle Final extension: 72 °C, 10 min | DNA [25 ng/μL]: 0.5 µL Primer Forward (25 pmol/μL): 0.5 μL Primer Reverse (25 pmol/μL): 0.5 μL * B Buffer (10x): 23.4 μL GoTaq G2 Flexi DNA polymerase (5 U/ μL): 0.1 μL |
| BMP2 570 A>T (rs235768) | 1 cycle Initial denaturation: 95 °C, 10 min 30 cycles Denaturation: 95 °C, 45 s Annealing: 62 °C, 45s Extension: 72 °C, 80 s 1 cycle Final extension: 72 °C, 10 min | DNA [25 ng/μL]: 0.5 µL Primer Forward (25 pmol/μL): 0.5 μL Primer Reverse (25 pmol/μL): 0.5 μL * B Buffer (10x): 23.4 μL GoTaq G2 Flexi DNA polymerase (5 U/μL): 0.1 μL |
| SLC40A1 frag. 1 | 1 cycle Initial denaturation: 95 °C, 4 min 30 cycles Denaturation: 95 °C, 30 s Annealing: 69 °C, 30s Extension: 72 °C, 1 min 1 cycle Final extension: 72 °C, 10 min | DNA [25 ng/μL]: 2 µL Primer Forward (25 pmol/μL): 0.5 μL Primer Reverse (25 pmol/μL): 0.5 μL Premix Ex Taq Hot Start (Takara): 12.5 μL H2O: 9.5 μL |
| SLC40A1 frag. 2 | 1 cycle Initial denaturation: 95 °C, 4 min 30 cycles Denaturation: 95 °C, 45s Annealing: 62 °C, 45s Extension: 72 °C, 80s 1 cycle Final extension: 72 °C, 10 min | DNA [25 ng/μL]: 1 µL Primer Forward (25 pmol/μL): 0.5 μL Primer Reverse (25 pmol/μL): 0.5 μL Premix Ex Taq Hot Start (Takara): 12.5 μL H2O: 10.5 μL |
| SLC40A1 frag. 3 | 1 cycle Initial denaturation: 95 °C, 4 min 30 cycles Denaturation: 95 °C, 45 s Annealing: 60 °C, 30s Extension: 72 °C, 5 min 1 cycle Final extension: 72 °C, 10 min | DNA [25 ng/μL]: 1 µL Primer Forward (25 pmol/μL): 0.5 μL Primer Reverse (25 pmol/μL): 0.5 μL Premix Ex Taq Hot Start (Takara): 12.5 μL H2O: 10.5 μL |
| * B Buffer: 50 mM KCl2; 10 mM Tris-HCl pH = 8.8; 150 μM MgCl2; 0.01%(p/v) gelatine, 4 × 25 mM dNTPs | ||
| Baseline Parameter | F1/2 (before DAAs treatment) | F3/4 (before DAAs treatment) | p Value * | ||
|---|---|---|---|---|---|
| Mean | 95% CI | Mean | 95% CI | ||
| Fe (μg/dL) | 115.42 | [108.47–122.38] | 135.67 | [123.56–147.78] | 0.006 |
| TS (%) | 39.56 | [34.72–44.40] | 41.66 | [37.27–46.04] | 0.258 |
| TIBC (μg/dL) | 310.79 | [300.40–321.17] | 335.31 | [320.09–350.54] | 0.004 |
| Ft (ng/mL) | 189.89 | [167.58–212.19] | 336.98 | [259.04–414.92] | 0.002 |
| * Mann–Whitney Test; 95% CI—95% confidence interval for mean | |||||
| Polymorphism | Genotype | F1/2 (Before DAAs Treatment) | F3/4 (Before DAAs Treatment) | p Value | OR | CI 95% | ||
|---|---|---|---|---|---|---|---|---|
| n | % | n | % | |||||
| SLC40A1 (rs1439816) | GG | 36 | 53.73 | 32 | 82.05 | |||
| GC | 26 | 38.81 | 5 | 12.82 | 0.011 ** | NA | NA | |
| CC | 5 | 7.46 | 2 | 5.13 | ||||
| SLC40A1 (rs1439816) | GG | 36 | 53.73 | 32 | 82.05 | 0.004 * | 3.937 | [1.525–10.162] |
| GC or CC | 31 | 46.27 | 7 | 17.95 | 1 | - | ||
| * Fisher exact test; ** Pearson chi-square test; OR—odds ratio; CI 95–95% confidence interval; NA—not applicable; For dominant and recessive models, only significant results are shown | ||||||||
| Polymorphism | Genotype | F4 (Before DAAs Treatment) to F1/2/3 (After DAAs Treatment) | F4 (Before DAAs Treatment) to F4 (After DAAs Treatment) | p Value | OR | CI 95% | ||
|---|---|---|---|---|---|---|---|---|
| n | % | n | % | |||||
| SCL40A1 (rs11568351) | GG | 10 | 90.91 | 7 | 46.67 | 0.036 * | 1 | [1.155–113.115] |
| GC | 1 | 9.09 | 8 | 53.33 | 11.429 | |||
| * Fisher exact test; OR—odds ratio; CI 95—95% confidence interval | ||||||||
| Polymorphism | Genotype | Fe (mg/dL) | TIBC (mg/dL) | Ft (ng/mL) | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Mean | 95% CI | p Value | Mean | 95% CI | p Value * | Mean | 95% CI | p Value | ||
| HFE C282Y (rs1800562) | CC | 120.95 | [113.34–128.56] | 0.009 * | 321.27 | [311.57–330.97] | 0.268 * | 229.46 | [189.95–268.98] | 0.005 * |
| CY | 157.18 | [125.46–188.90] | 301.82 | [270.75–332.89] | 502.27 | [260.55–744.00] | ||||
| TF IVS 11 G>A (rs3811647) | GG | 123.04 | [109.98–136.10] | 307.22 | [293.37–321.07] | 240.45 | [186.40–294.50] | |||
| GA | 124.11 | [105.39–142.82] | 0.445 ** | 334.29 | [309.00–359.57] | 0.038 ** | 265.29 | [201.29–329.29] | 0.770 ** | |
| AA | 141.14 | [108.27–174.01] | 329.43 | [277.38–381.48] | 233.14 | [127.73–338.58] | ||||
| GG | - | - | - | 307.22 | [293.37–321.07] | 0.011 * | - | - | - | |
| GA or AA | - | - | 333.48 | [311.53–355.42] | - | - | ||||
| BMP2 570 A>T (rs235768) | AA | - | - | - | - | - | - | 146.80 | [54.86–238.74] | 0.033 * |
| AT or TT | - | - | - | - | 273.46 | [232.73–314.19] | ||||
| * Mann–Whitney Test; ** Kruskal–Wallis Test; 95% CI—95% confidence interval for mean; For dominant and recessive models, only significant results are shown | ||||||||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ferreira, J.; Bicho, M.; Faustino, P.; Serejo, F. Iron Metabolism Genes Shape the Course of Liver Fibrosis in Chronic Hepatitis C: From Disease Progression to Reversal After Direct-Acting Antivirals Treatment. Viruses 2025, 17, 1302. https://doi.org/10.3390/v17101302
Ferreira J, Bicho M, Faustino P, Serejo F. Iron Metabolism Genes Shape the Course of Liver Fibrosis in Chronic Hepatitis C: From Disease Progression to Reversal After Direct-Acting Antivirals Treatment. Viruses. 2025; 17(10):1302. https://doi.org/10.3390/v17101302
Chicago/Turabian StyleFerreira, Joana, Manuel Bicho, Paula Faustino, and Fátima Serejo. 2025. "Iron Metabolism Genes Shape the Course of Liver Fibrosis in Chronic Hepatitis C: From Disease Progression to Reversal After Direct-Acting Antivirals Treatment" Viruses 17, no. 10: 1302. https://doi.org/10.3390/v17101302
APA StyleFerreira, J., Bicho, M., Faustino, P., & Serejo, F. (2025). Iron Metabolism Genes Shape the Course of Liver Fibrosis in Chronic Hepatitis C: From Disease Progression to Reversal After Direct-Acting Antivirals Treatment. Viruses, 17(10), 1302. https://doi.org/10.3390/v17101302

