Dysregulation of microRNAs in the Brains of Mice Infected with Powassan Virus
Abstract
1. Introduction
2. Materials and Methods
2.1. In Vivo Mouse Experiments
2.2. RNA Extraction
2.3. Viral Burden Quantification
2.4. NanoString nCounter® Gene Expression
2.5. Ingenuity Pathway Analysis (IPA)
2.6. Multiplex Immunoassay
2.7. Statistical Analysis
3. Results
3.1. Dysregulation of miRNAs in the Brain Following POWV Infection
3.2. Network Analysis of Dysregulated miRNAs in POWV-Infected Brain
3.3. Pathway Analysis of POWV-Modulated miRNAs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hassett, E.M.; Thangamani, S. Ecology of Powassan Virus in the United States. Microorganisms 2021, 9, 2317. [Google Scholar] [CrossRef]
- Fatmi, S.S.; Zehra, R.; Carpenter, D.O. Powassan Virus-A New Reemerging Tick-Borne Disease. Front. Public Health 2017, 5, 342. [Google Scholar] [CrossRef]
- Campbell, O.; Krause, P.J. The emergence of human Powassan virus infection in North America. Ticks Tick. Borne Dis. 2020, 11, 101540. [Google Scholar] [CrossRef]
- Mclean, D.M.; Donohue, W.L. Powassan virus: Isolation of virus from a fatal case of encephalitis. Can. Med. Assoc. J. 1959, 80, 708–711. [Google Scholar]
- Femminella, G.D.; Ferrara, N.; Rengo, G. The emerging role of microRNAs in Alzheimer’s disease. Front. Physiol. 2015, 6, 40. [Google Scholar] [CrossRef] [PubMed]
- Leggio, L.; Vivarelli, S.; L’Episcopo, F.; Tirolo, C.; Caniglia, S.; Testa, N.; Marchetti, B.; Iraci, N. microRNAs in Parkinson’s Disease: From Pathogenesis to Novel Diagnostic and Therapeutic Approaches. Int. J. Mol. Sci. 2017, 18, 2698. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Nerurkar, V.R. Integrated analysis of microRNAs and their disease related targets in the brain of mice infected with West Nile virus. Virology 2014, 452–453, 143–151. [Google Scholar] [CrossRef] [PubMed]
- Azouz, F.; Arora, K.; Krause, K.; Nerurkar, V.R.; Kumar, M. Integrated MicroRNA and mRNA Profiling in Zika Virus-Infected Neurons. Viruses 2019, 11, 162. [Google Scholar] [CrossRef]
- Liu, Q.; Deng, W.; Guo, X.; Li, K. High-throughput sequencing-based Detection of Japanese encephalitis virus and its effect on micro ribonucleic acid. Microb. Pathog. 2023, 182, 106267. [Google Scholar] [CrossRef]
- Zhu, B.; Ye, J.; Ashraf, U.; Li, Y.; Chen, H.; Song, Y.; Cao, S. Transcriptional regulation of miR-15b by c-Rel and CREB in Japanese encephalitis virus infection. Sci. Rep. 2016, 6, 22581. [Google Scholar] [CrossRef]
- Wu, S.; He, L.; Li, Y.; Wang, T.; Feng, L.; Jiang, L.; Zhang, P.; Huang, X. miR-146a facilitates replication of dengue virus by dampening interferon induction by targeting TRAF6. J. Infect. 2013, 67, 329–341. [Google Scholar] [CrossRef]
- Wong, R.R.; Abd-Aziz, N.; Affendi, S.; Poh, C.L. Role of microRNAs in antiviral responses to dengue infection. J. Biomed. Sci. 2020, 27, 4. [Google Scholar] [CrossRef] [PubMed]
- Shin, O.S.; Kumar, M.; Yanagihara, R.; Song, J.-W. Hantaviruses induce cell type- and viral species-specific host microRNA expression signatures. Virology 2013, 446, 217–224. [Google Scholar] [CrossRef] [PubMed]
- Simonson, B.; Das, S. MicroRNA Therapeutics: The Next Magic Bullet? Mini Rev. Med. Chem. 2015, 15, 467–474. [Google Scholar] [CrossRef]
- Auroni, T.T.; Arora, K.; Natekar, J.P.; Pathak, H.; Elsharkawy, A.; Kumar, M. The critical role of interleukin-6 in protection against neurotropic flavivirus infection. Front. Cell Infect. Microbiol. 2023, 13, 1275823. [Google Scholar] [CrossRef] [PubMed]
- Jahantigh, H.R.; Elsharkawy, A.; Guglani, A.; Arora, K.; Patterson, L.D.; Kumar, M. Neurobiological Alterations Induced by SARS-CoV-2: Insights from Variant-Specific Host Gene Expression Patterns in hACE2-Expressing Mice. Viruses 2025, 17, 329. [Google Scholar] [CrossRef]
- Elsharkawy, A.; Stone, S.; Guglani, A.; Patterson, L.D.; Ge, C.; Dim, C.; Miano, J.M.; Kumar, M. Omicron XBB.1.5 subvariant causes severe pulmonary disease in K18-hACE-2 mice. Front. Microbiol. 2024, 15, 1466980. [Google Scholar] [CrossRef]
- Elsharkawy, A.; Dim, C.; Ge, C.; Patterson, L.D.; Nabi, Z.; Kumar, M. SARS-CoV-2 XBB.1.5 infects wild-type C57BL/6 mice and induces a protective CD4+ T cell response required for viral clearance. Front. Cell Infect. Microbiol. 2025, 15, 1621226. [Google Scholar] [CrossRef]
- Elsharkawy, A.; Jahantigh, H.R.; Guglani, A.; Stone, S.; Arora, K.; Kumar, M. Virus-specific host responses and gene signatures following infection with major SARS-CoV-2 variants of concern: Role of ZBP1 in viral clearance and lung inflammation. Front. Immunol. 2025, 16, 1557535. [Google Scholar] [CrossRef]
- Oh, S.-J.; Kumari, P.; Auroni, T.T.; Stone, S.; Pathak, H.; Elsharkawy, A.; Natekar, J.P.; Shin, O.S.; Kumar, M. Upregulation of Neuroinflammation-Associated Genes in the Brain of SARS-CoV-2-Infected Mice. Pathogens 2024, 13, 528. [Google Scholar] [CrossRef]
- Browne, A.S.; Fang, J.; Elsharkawy, A.; Jia, T.; Reboli, E.; Luo, Y.; Sheng, X.; Kumar, M.; Iyer, S.S. Multilayer Fluorescent Immunoassay for Early and Sensitive Dengue Virus Detection Using Host and Viral Biomarkers. Bioconjug. Chem. 2025, 36, 1474–1482. [Google Scholar] [CrossRef] [PubMed]
- Marchand, A.; Atassi, F.; Mougenot, N.; Clergue, M.; Codoni, V.; Berthuin, J.; Proust, C.; Trégouët, D.-A.; Hulot, J.-S.; Lompré, A.-M. miR-322 regulates insulin signaling pathway and protects against metabolic syndrome-induced cardiac dysfunction in mice. Biochim. Biophys. Acta (BBA)-Mol. Basis Dis. 2016, 1862, 611–621. [Google Scholar] [CrossRef] [PubMed]
- Olive, V.; Bennett, M.J.; Walker, J.C.; Ma, C.; Jiang, I.; Cordon-Cardo, C.; Li, Q.-J.; Lowe, S.W.; Hannon, G.J.; He, L. miR-19 is a key oncogenic component of mir-17-92. Genes Dev. 2009, 23, 2839–2849. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Wu, J.; Guan, H.; Cai, J.; Fang, L.; Li, J.; Li, M. miR-136 promotes apoptosis of glioma cells by targeting AEG-1 and Bcl-2. FEBS Lett. 2012, 586, 3608–3612. [Google Scholar] [CrossRef]
- Lee, E.K.; Lee, M.J.; Abdelmohsen, K.; Kim, W.; Kim, M.M.; Srikantan, S.; Martindale, J.L.; Hutchison, E.R.; Kim, H.H.; Marasa, B.S.; et al. miR-130 suppresses adipogenesis by inhibiting peroxisome proliferator-activated receptor gamma expression. Mol. Cell Biol. 2011, 31, 626–638. [Google Scholar] [CrossRef]
- Greither, T.; Wenzel, C.; Jansen, J.; Kraus, M.; Wabitsch, M.; Behre, H.M. MiR-130a in the adipogenesis of human SGBS preadipocytes and its susceptibility to androgen regulation. Adipocyte 2020, 9, 197–205. [Google Scholar] [CrossRef]
- Gaudet, A.D.; Fonken, L.K.; Watkins, L.R.; Nelson, R.J.; Popovich, P.G. MicroRNAs: Roles in Regulating Neuroinflammation. Neuroscientist 2018, 24, 221–245. [Google Scholar] [CrossRef]
- Harraz, M.M.; Xu, J.-C.; Guiberson, N.; Dawson, T.M.; Dawson, V.L. MiR-223 regulates the differentiation of immature neurons. Mol. Cell Ther. 2014, 2, 18. [Google Scholar] [CrossRef]
- Nomoto, M.; Takeda, Y.; Uchida, S.; Mitsuda, K.; Enomoto, H.; Saito, K.; Choi, T.; Watabe, A.M.; Kobayashi, S.; Masushige, S.; et al. Dysfunction of the RAR/RXR signaling pathway in the forebrain impairs hippocampal memory and synaptic plasticity. Mol. Brain 2012, 5, 8. [Google Scholar] [CrossRef]
- Sharma, S.; Shen, T.; Chitranshi, N.; Gupta, V.; Basavarajappa, D.; Sarkar, S.; Mirzaei, M.; You, Y.; Krezel, W.; Graham, S.L.; et al. Retinoid X Receptor: Cellular and Biochemical Roles of Nuclear Receptor with a Focus on Neuropathological Involvement. Mol. Neurobiol. 2022, 59, 2027–2050. [Google Scholar] [CrossRef]
- Szanto, A.; Narkar, V.; Shen, Q.; Uray, I.P.; Davies, P.J.A.; Nagy, L. Retinoid X receptors: X-ploring their (patho)physiological functions. Cell Death Differ. 2004, 11, S126–S143. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.; Wu, Q.; Wang, Z.; Che, Y.; Zheng, S.; Chen, Y.; Zhong, X.; Shi, F. miR-223: An Immune Regulator in Infectious Disorders. Front. Immunol. 2021, 12, 781815. [Google Scholar] [CrossRef] [PubMed]
- Gilicze, A.B.; Wiener, Z.; Tóth, S.; Buzás, E.; Pállinger, É.; Falcone, F.H.; Falus, A. Myeloid-derived microRNAs, miR-223, miR27a, and miR-652, are dominant players in myeloid regulation. Biomed. Res. Int. 2014, 2014, 870267. [Google Scholar] [CrossRef] [PubMed]
- Yuan, X.; Berg, N.; Lee, J.W.; Le, T.-T.; Neudecker, V.; Jing, N.; Eltzschig, H. MicroRNA miR-223 as regulator of innate immunity. J. Leukoc. Biol. 2018, 104, 515–524. [Google Scholar] [CrossRef]
- Li, B.; Wang, X.; Choi, I.Y.; Wang, Y.-C.; Liu, S.; Pham, A.T.; Moon, H.; Smith, D.J.; Rao, D.S.; Boldin, M.P.; et al. miR-146a modulates autoreactive Th17 cell differentiation and regulates organ-specific autoimmunity. J. Clin. Investig. 2017, 127, 3702–3716. [Google Scholar] [CrossRef]
- Möhnle, P.; Schütz, S.V.; van der Heide, V.; Hübner, M.; Luchting, B.; Sedlbauer, J.; Limbeck, E.; Hinske, L.C.; Briegel, J.; Kreth, S. MicroRNA-146a controls Th1-cell differentiation of human CD4 + T lymphocytes by targeting PRKCε. Eur. J. Immunol. 2015, 45, 260–272. [Google Scholar] [CrossRef]
- Simpson, L.J.; Patel, S.; Bhakta, N.R.; Choy, D.F.; Brightbill, H.D.; Ren, X.; Wang, Y.; Pua, H.H.; Baumjohann, D.; Montoya, M.M.; et al. A microRNA upregulated in asthma airway T cells promotes TH2 cytokine production. Nat. Immunol. 2014, 15, 1162–1170. [Google Scholar] [CrossRef]
- Sahebdel, F.; Zia, A.; Quinta, H.R.; Morse, L.R.; Olson, J.K.; Battaglino, R.A. Transcriptomic Profiling of Primary Microglia: Effects of miR-19a-3p and miR-19b-3p on Microglia Activation. Int. J. Mol. Sci. 2024, 25, 10601. [Google Scholar] [CrossRef]
- Luo, X.-Q.; Shao, J.-B.; Xie, R.-D.; Zeng, L.; Li, X.-X.; Qiu, S.-Q.; Geng, X.-R.; Yang, L.-T.; Li, L.-J.; Liu, D.-B.; et al. Micro RNA-19a interferes with IL-10 expression in peripheral dendritic cells of patients with nasal polyposis. Oncotarget 2017, 8, 48915–48921. [Google Scholar] [CrossRef]
- Scroggs, S.L.P.; Offerdahl, D.K.; Stewart, P.E.; Shaia, C.; Griffin, A.J.; Bloom, M.E. Of Murines and Humans: Modeling Persistent Powassan Disease in C57BL/6 Mice. mBio 2023, 14, e0360622. [Google Scholar] [CrossRef]
- Reynolds, E.S.; Hart, C.E.; Nelson, J.T.; Marzullo, B.J.; Esterly, A.T.; Paine, D.N.; Crooker, J.; Massa, P.T.; Thangamani, S. Comparative Pathogenesis of Two Lineages of Powassan Virus Reveals Distinct Clinical Outcome, Neuropathology, and Inflammation. Viruses 2024, 16, 820. [Google Scholar] [CrossRef]
- Santos, R.I.; Hermance, M.E.; Gelman, B.B.; Thangamani, S. Spinal Cord Ventral Horns and Lymphoid Organ Involvement in Powassan Virus Infection in a Mouse Model. Viruses 2016, 8, 220. [Google Scholar] [CrossRef] [PubMed]
- Stone, E.T.; Hassert, M.; Geerling, E.; Wagner, C.; Brien, J.D.; Ebel, G.D.; Hirsch, A.J.; German, C.; Smith, J.L.; Pinto, A.K. Balanced T and B cell responses are required for immune protection against Powassan virus in virus-like particle vaccination. Cell Rep. 2022, 38, 110388. [Google Scholar] [CrossRef]
- Mladinich, M.C.; Himmler, G.E.; Conde, J.N.; Gorbunova, E.E.; Schutt, W.R.; Sarkar, S.; Tsirka, S.-A.E.; Kim, H.K.; Mackow, E.R. Age-dependent Powassan virus lethality is linked to glial cell activation and divergent neuroinflammatory cytokine responses in a murine model. J. Virol. 2024, 98, e0056024. [Google Scholar] [CrossRef]
- Wu, Y.; Yue, Y.; Xiong, S. Cardiac miR-19a/19b was induced and hijacked by CVB3 to facilitate virus replication via targeting viral genomic RdRp-encoding region. Antivir. Res. 2023, 217, 105702. [Google Scholar] [CrossRef]
- Mao, L.; Chen, Y.; Gu, J.; Zhao, Y.; Chen, Q. Roles and mechanisms of exosomal microRNAs in viral infections. Arch. Virol. 2023, 168, 121. [Google Scholar] [CrossRef] [PubMed]
- Chalmers, J.A.; Dalvi, P.S.; Loganathan, N.; McIlwraith, E.K.; Wellhauser, L.; Nazarians-Armavil, A.; Eversley, J.A.; Mohan, H.; Stahel, P.; Dash, S.; et al. Hypothalamic miR-1983 Targets Insulin Receptor β and the Insulin-mediated miR-1983 Increase Is Blocked by Metformin. Endocrinology 2022, 163, bqab241. [Google Scholar] [CrossRef]
- Huang, Z.-Z.; Wei, J.-Y.; Ou-Yang, H.-D.; Li, D.; Xu, T.; Wu, S.-L.; Zhang, X.-L.; Liu, C.-C.; Ma, C.; Xin, W.-J. mir-500-Mediated GAD67 Downregulation Contributes to Neuropathic Pain. J. Neurosci. 2016, 36, 6321–6331. [Google Scholar] [CrossRef] [PubMed]
- Guo, Q.; Tan, L.; Pan, J.; Wu, S.; Huang, J.; Yu, F.; Wang, J. Coronaviruses RNA interacts with host miR-500a-5p and miR-501-5p to regulate multiple pathways. Genes Dis. 2023, 10, 385–388. [Google Scholar] [CrossRef]
- Shah, D.; Comba, A.; Faisal, S.M.; Kadiyala, P.; Baker, G.J.; Alghamri, M.S.; Doherty, R.; Zamler, D.; Nuñez, G.; Castro, M.G.; et al. A novel miR1983-TLR7-IFNβ circuit licenses NK cells to kill glioma cells, and is under the control of galectin-1. Oncoimmunology 2021, 10, 1939601. [Google Scholar] [CrossRef]
- Xing, Y.; Chen, L.; Hu, B.; Li, Y.; Mai, H.; Li, G.; Han, S.; Wang, Y.; Huang, Y.; Tian, Y.; et al. Therapeutic role of miR-19a/b protection from influenza virus infection in patients with coronary heart disease. Mol. Ther. Nucleic Acids 2024, 35, 102149. [Google Scholar] [CrossRef] [PubMed]
- Ye, L.; Morse, L.R.; Falci, S.P.; Olson, J.K.; Shrivastava, M.; Nguyen, N.; Linnman, C.; Troy, K.L.; Battaglino, R.A. hsa-MiR-19a-3p and hsa-MiR-19b-3p Are Associated with Spinal Cord Injury-Induced Neuropathic Pain: Findings from a Genome-Wide MicroRNA Expression Profiling Screen. Neurotrauma Rep. 2021, 2, 424–439. [Google Scholar] [CrossRef] [PubMed]
- Buggele, W.A.; Johnson, K.E.; Horvath, C.M. Influenza A virus infection of human respiratory cells induces primary microRNA expression. J. Biol. Chem. 2012, 287, 31027–31040. [Google Scholar] [CrossRef]
- Chiang, K.; Liu, H.; Rice, A.P. miR-132 enhances HIV-1 replication. Virology 2013, 438, 1–4. [Google Scholar] [CrossRef]
- Mulik, S.; Xu, J.; Reddy, P.B.J.; Rajasagi, N.K.; Gimenez, F.; Sharma, S.; Lu, P.Y.; Rouse, B.T. Role of miR-132 in angiogenesis after ocular infection with herpes simplex virus. Am. J. Pathol. 2012, 181, 525–534. [Google Scholar] [CrossRef]
- Trobaugh, D.W.; Gardner, C.L.; Sun, C.; Haddow, A.D.; Wang, E.; Chapnik, E.; Mildner, A.; Weaver, S.C.; Ryman, K.D.; Klimstra, W.B. RNA viruses can hijack vertebrate microRNAs to suppress innate immunity. Nature 2014, 506, 245–248. [Google Scholar] [CrossRef]
- O’Connell, R.M.; Taganov, K.D.; Boldin, M.P.; Cheng, G.; Baltimore, D. MicroRNA-155 is induced during the macrophage inflammatory response. Proc. Natl. Acad. Sci. USA 2007, 104, 1604–1609. [Google Scholar] [CrossRef] [PubMed]
- Fulci, V.; Scappucci, G.; Sebastiani, G.D.; Giannitti, C.; Franceschini, D.; Meloni, F.; Colombo, T.; Citarella, F.; Barnaba, V.; Minisola, G.; et al. miR-223 is overexpressed in T-lymphocytes of patients affected by rheumatoid arthritis. Hum. Immunol. 2010, 71, 206–211. [Google Scholar] [CrossRef]
- Zhu, B.; Ye, J.; Nie, Y.; Ashraf, U.; Zohaib, A.; Duan, X.; Fu, Z.F.; Song, Y.; Chen, H.; Cao, S. MicroRNA-15b Modulates Japanese Encephalitis Virus–Mediated Inflammation via Targeting RNF125. J. Immunol. 2015, 195, 2251–2262. [Google Scholar] [CrossRef]






| Forward Primer Sequence (5′->3′) | Reverse Primer Sequence (5′->3′) | |
|---|---|---|
| POWV Probe | 56-FAM/TGGCATCCG/Zen/AGAAAGTGATCCTGC/3IABkFQ | |
| POWV | GGCTGCAAATGAGACCAATTC | CAGCGACACATCTCCATAGTC |
| D3 | Log2FC | p-Value | D6 | Log2FC | p-Value | D9 | Log2FC | p-Value | |
|---|---|---|---|---|---|---|---|---|---|
| Up-regulated | miR-1983 | 1.37 | 0.00010398 | miR-223 | 3.05 | 1.43 × 10−17 | miR-2135 | 2.92 | 1.12 × 10−12 |
| miR-19a | 1.22 | 0.00210552 | miR-142-3p | 2.85 | 2.23 × 10−15 | miR-2132 | 2.90 | 8.49 × 10−13 | |
| miR-216b | 1.14 | 0.00432204 | miR-21 | 1.94 | 1.48 × 10−9 | miR-223 | 2.88 | 9.2 × 10−16 | |
| miR-496 | 1.14 | 0.00045631 | miR-2135 | 1.82 | 0.0000118 | miR-142-3p | 2.71 | 5.13 × 10−14 | |
| miR-1897-3p | 1.12 | 0.00411598 | miR-2132 | 1.66 | 0.000058 | miR-21 | 2.44 | 2.76 × 10−14 | |
| Down-regulated | miR-706 | −0.80 | 0.04311407 | miR-500 | −1.30 | 0.00039231 | miR-23a | −1.29 | 0.0000176 |
| miR-196b | −0.93 | 0.00504502 | miR-196b | −1.32 | 0.0000574 | miR-182 | −1.40 | 0.00022748 | |
| miR-669m | −0.98 | 0.0471283 | miR-182 | −1.45 | 0.00011352 | miR-145 | −1.40 | 0.0000404 | |
| miR-500 | −1.06 | 0.00390904 | miR-200c | −1.47 | 0.00185367 | miR-141 | −1.46 | 0.04859388 | |
| miR-155 | −3.28 | 0.00843883 | miR-92b | −1.62 | 0.000000118 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elsharkawy, A.; Arora, K.; Jahantigh, H.R.; Kumar, M. Dysregulation of microRNAs in the Brains of Mice Infected with Powassan Virus. Viruses 2025, 17, 1288. https://doi.org/10.3390/v17101288
Elsharkawy A, Arora K, Jahantigh HR, Kumar M. Dysregulation of microRNAs in the Brains of Mice Infected with Powassan Virus. Viruses. 2025; 17(10):1288. https://doi.org/10.3390/v17101288
Chicago/Turabian StyleElsharkawy, Amany, Komal Arora, Hamid Reza Jahantigh, and Mukesh Kumar. 2025. "Dysregulation of microRNAs in the Brains of Mice Infected with Powassan Virus" Viruses 17, no. 10: 1288. https://doi.org/10.3390/v17101288
APA StyleElsharkawy, A., Arora, K., Jahantigh, H. R., & Kumar, M. (2025). Dysregulation of microRNAs in the Brains of Mice Infected with Powassan Virus. Viruses, 17(10), 1288. https://doi.org/10.3390/v17101288

