Comparative Pathogenicity of Three Strains of Infectious Bursal Disease Virus Closely Related to Poultry Industry
Abstract
1. Introduction
2. Materials and Methods
2.1. Viruses
2.2. Experimental Animals
2.3. Experimental Animals Grouping and Infections
2.4. Mean Symptomatic Index (MSI) and Fatality
2.5. Autopsy
2.6. Organ-to-Body Weight Ratio
2.7. Microscopic Histopathological Observations
2.8. EM Observation
2.9. Detection of Viral RNA in the Tissues
2.10. Detection of the Expression Level of Inflammation-Related Genes
2.11. Serum Antibody Detection
2.12. Statistical Analysis
3. Results
3.1. Clinical Symptoms of IBD
3.2. Gross Lesions of the Bursa
3.3. Histopathological Lesions of the Bursa
3.4. Lesions of Other Organs
3.5. EM Observation of the Viruses
3.6. Viral RNA Detection in Different Tissues
3.7. Antibody Titers
3.8. Comparison of Expression Levels of Inflammation-Related Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Trapp, J.; Rautenschlein, S. Infectious Bursal Disease Virus’ Interferences with Host Immune Cells: What Do We Know? Avian Pathol. 2022, 51, 303–316. [Google Scholar] [CrossRef] [PubMed]
- Graziosi, G.; Catelli, E.; Fanelli, A.; Lupini, C. Infectious Bursal Disease Virus in Free-Living Wild Birds: A Systematic Review and Meta-Analysis of Its Sero-Viroprevalence on a Global Scale. Transbound. Emerg. Dis. 2022, 69, 2800–2815. [Google Scholar] [CrossRef]
- Wang, X.M.; Zeng, X.W.; Gao, H.L.; Fu, C.Y.; Wei, P. Changes in VP2 Gene during the Attenuation of Very Virulent Infectious Bursal Disease Virus Strain Gx Isolated in China. Avian Dis. 2004, 48, 77–83. [Google Scholar] [CrossRef]
- Fan, L.; Wu, T.; Hussain, A.; Gao, Y.; Zeng, X.; Wang, Y.; Gao, L.; Li, K.; Wang, Y.; Liu, C.; et al. Novel Variant Strains of Infectious Bursal Disease Virus Isolated in China. Vet. Microbiol. 2019, 230, 212–220. [Google Scholar] [CrossRef] [PubMed]
- Myint, O.; Suwanruengsri, M.; Araki, K.; Izzati, U.Z.; Pornthummawat, A.; Nueangphuet, P.; Fuke, N.; Hirai, T.; Jackwood, D.J.; Yamaguchi, R. Bursa Atrophy at 28 Days Old Caused by Variant Infectious Bursal Disease Virus Has a Negative Economic Impact on Broiler Farms in Japan. Avian Pathol. 2021, 50, 6–17. [Google Scholar] [CrossRef]
- Thai, T.N.; Jang, I.; Kim, H.-A.; Kim, H.-S.; Kwon, Y.-K.; Kim, H.-R. Characterization of Antigenic Variant Infectious Bursal Disease Virus Strains Identified in South Korea. Avian Pathol. 2021, 50, 174–181. [Google Scholar] [CrossRef] [PubMed]
- Aliyu, H.B.; Hair-Bejo, M.; Omar, A.R.; Ideris, A. Genetic Diversity of Recent Infectious Bursal Disease Viruses Isolated From Vaccinated Poultry Flocks in Malaysia. Front. Vet. Sci. 2021, 8, 643976. [Google Scholar] [CrossRef]
- Wang, Y.; Jiang, N.; Fan, L.; Niu, X.; Zhang, W.; Huang, M.; Gao, L.; Li, K.; Gao, Y.; Liu, C.; et al. Identification and Pathogenicity Evaluation of a Novel Reassortant Infectious Bursal Disease Virus (Genotype A2dB3). Viruses 2021, 13, 1682. [Google Scholar] [CrossRef] [PubMed]
- Hou, B.; Wang, C.; Luo, Z.; Shao, G. Commercial Vaccines Used in China Do Not Protect against a Novel Infectious Bursal Disease Virus Variant Isolated in Fujian. Vet. Rec. 2022, 191, e1840. [Google Scholar] [CrossRef]
- Fan, L.; Wang, Y.; Jiang, N.; Gao, Y.; Niu, X.; Zhang, W.; Huang, M.; Bao, K.; Liu, A.; Wang, S.; et al. Residues 318 and 323 in Capsid Protein Are Involved in Immune Circumvention of the Atypical Epizootic Infection of Infectious Bursal Disease Virus. Front. Microbiol. 2022, 13, 909252. [Google Scholar] [CrossRef]
- Jiang, N.; Wang, Y.; Zhang, W.; Niu, X.; Huang, M.; Gao, Y.; Liu, A.; Gao, L.; Li, K.; Pan, Q.; et al. Genotyping and Molecular Characterization of Infectious Bursal Disease Virus Identified in Important Poultry-Raising Areas of China During 2019 and 2020. Front.Vet. Sci. 2021, 8, 759861. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Wang, X.; Gao, Y.; Qi, X. The Over-40-Years-Epidemic of Infectious Bursal Disease Virus in China. Viruses 2022, 14, 2253. [Google Scholar] [CrossRef] [PubMed]
- Qi, X.; Gao, L.; Qin, L.; Deng, X.; Wu, G.; Zhang, L.; Yu, F.; Ren, X.; Gao, Y.; Gao, H.; et al. Genomic Sequencing and Molecular Characteristics of a Very Virulent Strain of Infectious Bursal Disease Virus Isolated in China. Agric. Sci. Tech. 2011, 12, 1946–1949. [Google Scholar] [CrossRef]
- Fan, L.; Wang, Y.; Jiang, N.; Gao, L.; Li, K.; Gao, Y.; Cui, H.; Pan, Q.; Liu, C.; Zhang, Y.; et al. A Reassortment Vaccine Candidate of the Novel Variant Infectious Bursal Disease Virus. Vet. Microbiol. 2020, 251, 108905. [Google Scholar] [CrossRef]
- Nouën, C.L.; Toquin, D.; Müller, H.; Raue, R.; Kean, K.M.; Langlois, P.; Cherbonnel, M.; Eterradossi, N. Different Domains of the RNA Polymerase of Infectious Bursal Disease Virus Contribute to Virulence. PLoS ONE 2012, 7, e28064. [Google Scholar] [CrossRef]
- Lupini, C.; Felice, V.; Silveira, F.; Mescolini, G.; Berto, G.; Listorti, V.; Cecchinato, M.; Catelli, E. Comparative in Vivo Pathogenicity Study of an ITA Genotype Isolate (G6) of Infectious Bursal Disease Virus. Transbound. Emerg. Dis. 2020, 67, 1025–1031. [Google Scholar] [CrossRef]
- Liu, A.; Pan, Q.; Li, Y.; Yan, N.; Wang, J.; Yang, B.; Chen, Z.; Qi, X.; Gao, Y.; Gao, L.; et al. Identification of Chicken CD74 as a Novel Cellular Attachment Receptor for Infectious Bursal Disease Virus in Bursa B Lymphocytes. J. Virol. 2020, 94, e01712-19. [Google Scholar] [CrossRef]
- Wang, Y.; Qi, X.; Gao, H.; Gao, Y.; Lin, H.; Song, X.; Pei, L.; Wang, X. Comparative Study of the Replication of Infectious Bursal Disease Virus in DF-1 Cell Line and Chicken Embryo Fibroblasts Evaluated by a New Real-Time RT-PCR. J. Virol. Methods 2009, 157, 205–210. [Google Scholar] [CrossRef]
- Ragland, W.L.; Novak, R.; El-Attrache, J.; Savić, V.; Ester, K. Chicken Anemia Virus and Infectious Bursal Disease Virus Interfere with Transcription of Chicken IFN-Alpha and IFN-Gamma mRNA. J. Interferon Cytokine Res. 2002, 22, 437–441. [Google Scholar] [CrossRef]
- Legnardi, M.; Franzo, G.; Tucciarone, C.M.; Koutoulis, K.; Cecchinato, M. Infectious Bursal Disease Virus in Western Europe: The Rise of Reassortant Strains as the Dominant Field Threat. Avian Pathol. 2023, 52, 25–35. [Google Scholar] [CrossRef]
- Nooruzzaman, M.; Hossain, I.; Rahman, M.M.; Uddin, A.J.; Mustari, A.; Parvin, R.; Chowdhury, E.H.; Islam, M.R. Comparative Pathogenicity of Infectious Bursal Disease Viruses of Three Different Genotypes. Microb. Pathog. 2022, 169, 105641. [Google Scholar] [CrossRef] [PubMed]
- Fan, L.; Wang, Y.; Jiang, N.; Chen, M.; Gao, L.; Li, K.; Gao, Y.; Cui, H.; Pan, Q.; Liu, C.; et al. Novel Variant Infectious Bursal Disease Virus Suppresses Newcastle Disease Vaccination in Broiler and Layer Chickens. Poult. Sci. 2020, 99, 6542–6548. [Google Scholar] [CrossRef]
- Li, K.; Courtillon, C.; Guionie, O.; Allée, C.; Amelot, M.; Qi, X.; Gao, Y.; Wang, X.; Eterradossi, N. Genetic, Antigenic and Pathogenic Characterization of Four Infectious Bursal Disease Virus Isolates from China Suggests Continued Evolution of Very Virulent Viruses. Infec. Genet. Evol. 2015, 30, 120–127. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Qi, X.; Kang, Z.; Yu, F.; Qin, L.; Gao, H.; Gao, Y.; Wang, X. A Single Amino Acid in the C-Terminus of VP3 Protein Influences the Replication of Attenuated Infectious Bursal Disease Virus In Vitro and In Vivo. Antiviral. Res. 2010, 87, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Erickson, K.L.; Gershwin, M.E.; Abplanalp, H.; Ikeda, R.; Benedict, A.A. Inherited 7S Immunoglobulin Deficiency of Chickens Is Associated with Bursal Degeneration Anomalies. Dev. Comp. Immunol. 1982, 6, 105–112. [Google Scholar] [CrossRef]
- Huang, X.; Liu, W.; Zhang, J.; Liu, Z.; Wang, M.; Wang, L.; Zhou, H.; Jiang, Y.; Cui, W.; Qiao, X. Very Virulent Infectious Bursal Disease Virus-Induced Immune Injury Is Involved in Inflammation, Apoptosis, and Inflammatory Cytokines Imbalance in the Bursa of Fabricius. Dev. Comp. Immunol. 2021, 114, 103839. [Google Scholar] [CrossRef]
- Pereira, A.H.; Vasconcelos, A.L.; Silva, V.L.; Nogueira, B.S.; Silva, A.C.; Pacheco, R.C.; Souza, M.A.; Colodel, E.M.; Ubiali, D.G.; Biondo, A.W.; et al. Natural SARS-CoV-2 Infection in a Free-Ranging Black-Tailed Marmoset (Mico Melanurus) from an Urban Area in Mid-West Brazil. J. Comp. Pathol. 2022, 194, 22–27. [Google Scholar] [CrossRef]
- Bassat, Q.; Varo, R.; Hurtado, J.C.; Marimon, L.; Ferrando, M.; Ismail, M.R.; Carrilho, C.; Fernandes, F.; Castro, P.; Maixenchs, M.; et al. Minimally Invasive Tissue Sampling as an Alternative to Complete Diagnostic Autopsies in the Context of Epidemic Outbreaks and Pandemics: The Example of Coronavirus Disease 2019 (COVID-19). Clin. Infec. Dis. 2021, 73, S472–S479. [Google Scholar] [CrossRef]
- Takenaka-Uema, A.; Matsugo, H.; Ohira, K.; Sekine, W.; Murakami, S.; Horimoto, T. Different Organ and Tissue Tropism between Akabane Virus Genogroups in a Mouse Model. Virus Res. 2022, 314, 198752. [Google Scholar] [CrossRef]
- Hamad, M.; Hassanin, O.; Ali, F.A.Z.; Ibrahim, R.S.; Abd-Elghaffar, S.K.; Saif-Edin, M. Comparative Study on Dynamic and Immunopathology of Four Intermediate-plus Infectious Bursal Disease (IBD) Vaccines in Commercial Broiler Chickens. Vet. Res. Commun. 2020, 44, 147–157. [Google Scholar] [CrossRef]
- Baba, T.W.; Giroir, B.P.; Humphries, E.H. Cell Lines Derived from Avian Lymphomas Exhibit Two Distinct Phenotypes. Virology 1985, 144, 139–151. [Google Scholar] [CrossRef] [PubMed]









| Primers | Sequence (5′-3′) | 5′Modification | 3′Modification |
|---|---|---|---|
| 28S-Probe | AGGACCGCTACGGACCTCCACCA | FAM | TAMRA |
| 28S-F | GGCGAAGCCAGAGGAAACT | - | - |
| 28S-R | GACGACCGATTTGCACGTC | - | - |
| IBDV-Probe | CGGCGTCCATTCCGGACGAC | FAM | BHQ-1 |
| IBDV-VP5-F | GAGCCTTCTGATGCCAACAAC | - | - |
| IBDV-VP5-R | CAAATTGTAGGTCGAGGTCTCTGA | - | - |
| IL-6-F | GCCTGGAATTATCAAAGTAACCC | - | - |
| IL-6-R | CCTCTGCTGCCATTCCAC | - | - |
| IL-8-F | AAGATGTGAAGCTGACGCCAA | - | - |
| IL-8-R | TGGCCATAAGTGCCTTTACGA | - | - |
| IL-18-F | CCAGTTGCTTGTGGTTCGTC | - | - |
| IL-18-R | CGCTGAATGCAACAGGCATC | - | - |
| NLRP3-F | TAGAGTACGCGGGTGAAGGA | - | - |
| NLRP3-R | CTGTGAAACTGCCCAACACG | - | - |
| caspase-1-F | GGCAGTTGCCAACACAAGAG | - | - |
| caspase-1-R | CTCCCTGGCAAGAATTCGGT | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, K.; Niu, X.; Jiang, N.; Zhang, W.; Wang, G.; Li, K.; Huang, M.; Gao, Y.; Qi, X.; Wang, X. Comparative Pathogenicity of Three Strains of Infectious Bursal Disease Virus Closely Related to Poultry Industry. Viruses 2023, 15, 1257. https://doi.org/10.3390/v15061257
Li K, Niu X, Jiang N, Zhang W, Wang G, Li K, Huang M, Gao Y, Qi X, Wang X. Comparative Pathogenicity of Three Strains of Infectious Bursal Disease Virus Closely Related to Poultry Industry. Viruses. 2023; 15(6):1257. https://doi.org/10.3390/v15061257
Chicago/Turabian StyleLi, Kailin, Xinxin Niu, Nan Jiang, Wenying Zhang, Guodong Wang, Kai Li, Mengmeng Huang, Yulong Gao, Xiaole Qi, and Xiaomei Wang. 2023. "Comparative Pathogenicity of Three Strains of Infectious Bursal Disease Virus Closely Related to Poultry Industry" Viruses 15, no. 6: 1257. https://doi.org/10.3390/v15061257
APA StyleLi, K., Niu, X., Jiang, N., Zhang, W., Wang, G., Li, K., Huang, M., Gao, Y., Qi, X., & Wang, X. (2023). Comparative Pathogenicity of Three Strains of Infectious Bursal Disease Virus Closely Related to Poultry Industry. Viruses, 15(6), 1257. https://doi.org/10.3390/v15061257

