Zika Virus Induces Degradation of the Numb Protein Required through Embryonic Neurogenesis
Abstract
1. Introduction
2. Materials and Methods
2.1. Viruses, Cells, and Chemicals
2.2. Plasmids
2.3. RNA Isolation and Real-Time PCR
2.4. Western Blot (WB) Analysis
2.5. Immunoprecipitation (IP)
2.6. Statistical Analysis
3. Results
3.1. ZIKV Infection Reduces the Numb Protein Level
3.2. ZIKV Reduces the Numb Protein Level in a Temporal and Dose-Dependent Manner
3.3. ZIKV Reduces the Numb Protein via the Ubiquitin–Proteasome Pathway
3.4. ZIKV Capsid Protein Induces the Numb Reduction
3.5. The Numb Knockdown Has a Minimal Effect on ZIKV Replication
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dick, G.W. Zika virus. II. Pathogenicity and physical properties. Trans. R. Soc. Trop. Med. Hyg. 1952, 46, 521–534. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dick, G.W.; Kitchen, S.F.; Haddow, A.J. Zika virus. I. Isolations and serological specificity. Trans. R. Soc. Trop. Med. Hyg. 1952, 46, 509–520. [Google Scholar] [CrossRef] [Scilit]
- Garcez, P.P.; Loiola, E.C.; Madeiro da Costa, R.; Higa, L.M.; Trindade, P.; Delvecchio, R.; Nascimento, J.M.; Brindeiro, R.; Tanuri, A.; Rehen, S.K. Zika virus impairs growth in human neurospheres and brain organoids. Science 2016, 352, 816–818. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shao, Q.; Herrlinger, S.; Yang, S.L.; Lai, F.; Moore, J.M.; Brindley, M.A.; Chen, J.F. Zika virus infection disrupts neurovascular development and results in postnatal microcephaly with brain damage. Development 2016, 143, 4127–4136. [Google Scholar] [CrossRef] [Scilit]
- Souza, B.S.; Sampaio, G.L.; Pereira, C.S.; Campos, G.S.; Sardi, S.I.; Freitas, L.A.; Figueira, C.P.; Paredes, B.D.; Nonaka, C.K.; Azevedo, C.M.; et al. Zika virus infection induces mitosis abnormalities and apoptotic cell death of human neural progenitor cells. Sci. Rep. 2016, 6, 39775. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, E.; Maj, T.; Kryczek, I.; Li, W.; Wu, K.; Zhao, L.; Wei, S.; Crespo, J.; Wan, S.; Vatan, L.; et al. Cancer mediates effector T cell dysfunction by targeting microRNAs and EZH2 via glycolysis restriction. Nat. Immunol. 2016, 17, 95–103. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.C.; Abraham, R.; Shim, B.S.; Choe, H.; Page, D.T. Zika virus infection during the period of maximal brain growth causes microcephaly and corticospinal neuron apoptosis in wild type mice. Sci. Rep. 2016, 6, 34793. [Google Scholar] [CrossRef] [Scilit]
- Duffy, M.R.; Chen, T.H.; Hancock, W.T.; Powers, A.M.; Kool, J.L.; Lanciotti, R.S.; Pretrick, M.; Marfel, M.; Holzbauer, S.; Dubray, C.; et al. Zika virus outbreak on Yap Island, Federated States of Micronesia. N. Engl. J. Med. 2009, 360, 2536–2543. [Google Scholar] [CrossRef] [Scilit]
- Campos, G.S.; Bandeira, A.C.; Sardi, S.I. Zika Virus Outbreak, Bahia, Brazil. Emerg. Infect. Dis. 2015, 21, 1885–1886. [Google Scholar] [CrossRef] [Scilit]
- Brooks, T.; Roy-Burman, A.; Tuholske, C.; Busch, M.P.; Bakkour, S.; Stone, M.; Linnen, J.M.; Gao, K.; Coleman, J.; Bloch, E.M. Real-Time Evolution of Zika Virus Disease Outbreak, Roatan, Honduras. Emerg. Infect. Dis. 2017, 23, 1360–1363. [Google Scholar] [CrossRef] [Scilit]
- Bonilla-Soto, L.A. Zika Virus in the Americas: An Environmental Health Perspective. P. R. Health Sci. J. 2018, 37, S5–S14. [Google Scholar]
- Mlakar, J.; Korva, M.; Tul, N.; Popovic, M.; Poljsak-Prijatelj, M.; Mraz, J.; Kolenc, M.; Resman Rus, K.; Vesnaver Vipotnik, T.; Fabjan Vodusek, V.; et al. Zika Virus Associated with Microcephaly. N. Engl. J. Med. 2016, 374, 951–958. [Google Scholar] [CrossRef] [Scilit]
- Panchaud, A.; Stojanov, M.; Ammerdorffer, A.; Vouga, M.; Baud, D. Emerging Role of Zika Virus in Adverse Fetal and Neonatal Outcomes. Clin. Microbiol. Rev. 2016, 29, 659–694. [Google Scholar] [CrossRef] [Scilit]
- Plourde, A.R.; Bloch, E.M. A Literature Review of Zika Virus. Emerg. Infect. Dis. 2016, 22, 1185–1192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raposo-Amaral, C.E. Microcephaly: Consequence of the Zika Virus Global Outbreak. J. Craniofac. Surg. 2016, 27, 1383–1384. [Google Scholar] [CrossRef] [Scilit]
- Crisanto-Lopez, I.E.; Jesus, P.L.; Lopez-Quecho, J.; Flores-Alonso, J.C. Congenital Zika syndrome. Bol. Med. Hosp. Infant. Mex. 2023, 80, 3–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Ling, L.; Zhang, Z.; Marin-Lopez, A. Current Advances in Zika Vaccine Development. Vaccines 2022, 10, 1816. [Google Scholar] [CrossRef] [Scilit]
- King, E.L.; Irigoyen, N. Zika Virus and Neuropathogenesis: The Unanswered Question of Which Strain Is More Prone to Causing Microcephaly and Other Neurological Defects. Front. Cell. Neurosci. 2021, 15, 695106. [Google Scholar] [CrossRef] [Scilit]
- Komarasamy, T.V.; Adnan, N.A.A.; James, W.; Balasubramaniam, V. Zika Virus Neuropathogenesis: The Different Brain Cells, Host Factors and Mechanisms Involved. Front. Immunol. 2022, 13, 773191. [Google Scholar] [CrossRef] [Scilit]
- Uemura, T.; Shepherd, S.; Ackerman, L.; Jan, L.Y.; Jan, Y.N. numb, a gene required in determination of cell fate during sensory organ formation in Drosophila embryos. Cell 1989, 58, 349–360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flores, A.N.; McDermott, N.; Meunier, A.; Marignol, L. NUMB inhibition of NOTCH signalling as a therapeutic target in prostate cancer. Nat. Rev. Urol. 2014, 11, 499–507. [Google Scholar] [CrossRef] [Scilit]
- Zilian, O.; Saner, C.; Hagedorn, L.; Lee, H.Y.; Sauberli, E.; Suter, U.; Sommer, L.; Aguet, M. Multiple roles of mouse Numb in tuning developmental cell fates. Curr. Biol. 2001, 11, 494–501. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.J.; Stein, D.A.; Fan, S.M.; Wang, K.Y.; Kroeker, A.D.; Meng, X.J.; Iversen, P.L.; Matson, D.O. Suppression of porcine reproductive and respiratory syndrome virus replication by morpholino antisense oligomers. Vet. Microbiol. 2006, 117, 117–129. [Google Scholar] [CrossRef] [Scilit]
- He, J.; Yang, L.; Chang, P.; Yang, S.; Lin, S.; Tang, Q.; Wang, X.; Zhang, Y.J. Zika virus NS2A protein induces the degradation of KPNA2 (karyopherin subunit alpha 2) via chaperone-mediated autophagy. Autophagy 2020, 16, 2238–2251. [Google Scholar] [CrossRef] [Scilit]
- Gee, P.; Lung, M.S.Y.; Okuzaki, Y.; Sasakawa, N.; Iguchi, T.; Makita, Y.; Hozumi, H.; Miura, Y.; Yang, L.F.; Iwasaki, M.; et al. Extracellular nanovesicles for packaging of CRISPR-Cas9 protein and sgRNA to induce therapeutic exon skipping. Nat. Commun. 2020, 11, 1334. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Wang, R.; Ma, Z.; Xiao, Y.; Nan, Y.; Wang, Y.; Lin, S.; Zhang, Y.J. Porcine Reproductive and Respiratory Syndrome Virus Antagonizes JAK/STAT3 Signaling via nsp5, Which Induces STAT3 Degradation. J. Virol. 2017, 91, e02087-16. [Google Scholar] [CrossRef] [Scilit]
- Patel, D.; Opriessnig, T.; Stein, D.A.; Halbur, P.G.; Meng, X.J.; Iversen, P.L.; Zhang, Y.J. Peptide-conjugated morpholino oligomers inhibit porcine reproductive and respiratory syndrome virus replication. Antiviral. Res. 2008, 77, 95–107. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Wang, R.; Yang, S.; Ma, Z.; Lin, S.; Nan, Y.; Li, Q.; Tang, Q.; Zhang, Y.J. Karyopherin Alpha 6 Is Required for Replication of Porcine Reproductive and Respiratory Syndrome Virus and Zika Virus. J. Virol. 2018, 92, e00072-18. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.J.; Wang, K.Y.; Stein, D.A.; Patel, D.; Watkins, R.; Moulton, H.M.; Iversen, P.L.; Matson, D.O. Inhibition of replication and transcription activator and latency-associated nuclear antigen of Kaposi’s sarcoma-associated herpesvirus by morpholino oligomers. Antiviral. Res. 2007, 73, 12–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ciechanover, A. Proteolysis: From the lysosome to ubiquitin and the proteasome. Nat. Rev. Mol. Cell Biol. 2005, 6, 79–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jackson, M.P.; Hewitt, E.W. Cellular proteostasis: Degradation of misfolded proteins by lysosomes. Essays. Biochem. 2016, 60, 173–180. [Google Scholar] [CrossRef] [Scilit]
- Klionsky, D.J.; Abdelmohsen, K.; Abe, A.; Abedin, M.J.; Abeliovich, H.; Acevedo Arozena, A.; Adachi, H.; Adams, C.M.; Adams, P.D.; Adeli, K.; et al. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy 2016, 12, 1–222. [Google Scholar] [CrossRef] [Scilit]
- Lazear, H.M.; Diamond, M.S. Zika Virus: New Clinical Syndromes and Its Emergence in the Western Hemisphere. J. Virol. 2016, 90, 4864–4875. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.H.; Yao, S.; Levine, A.C.; Kirschenbaum, A.; Pan, J.; Wu, Y.; Qin, W.; Collier, L.; Bauman, W.A.; Cardozo, C.P. Nandrolone, an anabolic steroid, stabilizes Numb protein through inhibition of mdm2 in C2C12 myoblasts. J. Androl. 2012, 33, 1216–1223. [Google Scholar] [CrossRef] [Scilit]
- Tan, T.Y.; Fibriansah, G.; Kostyuchenko, V.A.; Ng, T.S.; Lim, X.X.; Zhang, S.; Lim, X.N.; Wang, J.; Shi, J.; Morais, M.C.; et al. Capsid protein structure in Zika virus reveals the flavivirus assembly process. Nat. Commun. 2020, 11, 895. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farelo, M.A.; Korrou-Karava, D.; Brooks, K.F.; Russell, T.A.; Maringer, K.; Mayerhofer, P.U. Dengue and Zika Virus Capsid Proteins Contain a Common PEX19-Binding Motif. Viruses 2022, 14, 253. [Google Scholar] [CrossRef] [Scilit]
- Fontaine, K.A.; Leon, K.E.; Khalid, M.M.; Tomar, S.; Jimenez-Morales, D.; Dunlap, M.; Kaye, J.A.; Shah, P.S.; Finkbeiner, S.; Krogan, N.J.; et al. The Cellular NMD Pathway Restricts Zika Virus Infection and Is Targeted by the Viral Capsid Protein. MBio 2018, 9, e02126-18. [Google Scholar] [CrossRef] [Scilit]
- Gestuveo, R.J.; Royle, J.; Donald, C.L.; Lamont, D.J.; Hutchinson, E.C.; Merits, A.; Kohl, A.; Varjak, M. Analysis of Zika virus capsid-Aedes aegypti mosquito interactome reveals pro-viral host factors critical for establishing infection. Nat. Commun. 2021, 12, 2766. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hou, S.; Kumar, A.; Xu, Z.; Airo, A.M.; Stryapunina, I.; Wong, C.P.; Branton, W.; Tchesnokov, E.; Gotte, M.; Power, C.; et al. Zika Virus Hijacks Stress Granule Proteins and Modulates the Host Stress Response. J. Virol. 2017, 91, e00474-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, J.; Dong, S.; Luo, Z.; Xie, X.; Fu, B.; Li, P.; Liu, C.; Yang, X.; Chen, Y.; Wang, X.; et al. The Zika Virus Capsid Disrupts Corticogenesis by Suppressing Dicer Activity and miRNA Biogenesis. Cell Stem Cell 2020, 27, 618–632.e619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neveu, G.; Ziv-Av, A.; Barouch-Bentov, R.; Berkerman, E.; Mulholland, J.; Einav, S. AP-2-associated protein kinase 1 and cyclin G-associated kinase regulate hepatitis C virus entry and are potential drug targets. J. Virol. 2015, 89, 4387–4404. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Kawaguchi, K.; Honda, M.; Hashimoto, S.; Shirasaki, T.; Okada, H.; Orita, N.; Shimakami, T.; Yamashita, T.; Sakai, Y.; et al. Notch signaling facilitates hepatitis B virus covalently closed circular DNA transcription via cAMP response element-binding protein with E3 ubiquitin ligase-modulation. Sci. Rep. 2019, 9, 1621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frise, E.; Knoblich, J.A.; Younger-Shepherd, S.; Jan, L.Y.; Jan, Y.N. The Drosophila Numb protein inhibits signaling of the Notch receptor during cell-cell interaction in sensory organ lineage. Proc. Natl. Acad. Sci. USA 1996, 93, 11925–11932. [Google Scholar] [CrossRef] [Scilit]
- Zhong, W.; Feder, J.N.; Jiang, M.M.; Jan, L.Y.; Jan, Y.N. Asymmetric localization of a mammalian numb homolog during mouse cortical neurogenesis. Neuron 1996, 17, 43–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bray, S.J. Notch signalling in context. Nat. Rev. Mol. Cell Biol. 2016, 17, 722–735. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McGill, M.A.; McGlade, C.J. Mammalian numb proteins promote Notch1 receptor ubiquitination and degradation of the Notch1 intracellular domain. J. Biol. Chem. 2003, 278, 23196–23203. [Google Scholar] [CrossRef] [Scilit]
- Jiang, J.; Hui, C.C. Hedgehog signaling in development and cancer. Dev. Cell 2008, 15, 801–812. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Marcotullio, L.; Ferretti, E.; Greco, A.; De Smaele, E.; Po, A.; Sico, M.A.; Alimandi, M.; Giannini, G.; Maroder, M.; Screpanti, I.; et al. Numb is a suppressor of Hedgehog signalling and targets Gli1 for Itch-dependent ubiquitination. Nat. Cell. Biol. 2006, 8, 1415–1423. [Google Scholar] [CrossRef] [Scilit]
- Hwang, W.L.; Jiang, J.K.; Yang, S.H.; Huang, T.S.; Lan, H.Y.; Teng, H.W.; Yang, C.Y.; Tsai, Y.P.; Lin, C.H.; Wang, H.W.; et al. MicroRNA-146a directs the symmetric division of Snail-dominant colorectal cancer stem cells. Nat. Cell. Biol. 2014, 16, 268–280. [Google Scholar] [CrossRef] [Scilit]
- Colaluca, I.N.; Tosoni, D.; Nuciforo, P.; Senic-Matuglia, F.; Galimberti, V.; Viale, G.; Pece, S.; Di Fiore, P.P. NUMB controls p53 tumour suppressor activity. Nature 2008, 451, 76–80. [Google Scholar] [CrossRef] [Scilit]
- Juven-Gershon, T.; Shifman, O.; Unger, T.; Elkeles, A.; Haupt, Y.; Oren, M. The Mdm2 oncoprotein interacts with the cell fate regulator Numb. Mol. Cell Biol. 1998, 18, 3974–3982. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pece, S.; Serresi, M.; Santolini, E.; Capra, M.; Hulleman, E.; Galimberti, V.; Zurrida, S.; Maisonneuve, P.; Viale, G.; Di Fiore, P.P. Loss of negative regulation by Numb over Notch is relevant to human breast carcinogenesis. J. Cell Biol. 2004, 167, 215–221. [Google Scholar] [CrossRef] [Scilit]
- Sheng, W.; Dong, M.; Chen, C.; Li, Y.; Liu, Q.; Dong, Q. Musashi2 promotes the development and progression of pancreatic cancer by down-regulating Numb protein. Oncotarget 2017, 8, 14359–14373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, H.Y.; Seok, J.; Kang, G.H.; Lim, K.M.; Cho, S.G. The role of NUMB/NUMB isoforms in cancer stem cells. BMB Rep. 2021, 54, 335–343. [Google Scholar] [CrossRef] [Scilit]
- Imai, T.; Tokunaga, A.; Yoshida, T.; Hashimoto, M.; Mikoshiba, K.; Weinmaster, G.; Nakafuku, M.; Okano, H. The neural RNA-binding protein Musashi1 translationally regulates mammalian numb gene expression by interacting with its mRNA. Mol. Cell Biol. 2001, 21, 3888–3900. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuang, W.; Tan, J.; Duan, Y.; Duan, J.; Wang, W.; Jin, F.; Jin, Z.; Yuan, X.; Liu, Y. Cyclic stretch induced miR-146a upregulation delays C2C12 myogenic differentiation through inhibition of Numb. Biochem. Biophys. Res. Commun. 2009, 378, 259–263. [Google Scholar] [CrossRef] [Scilit]
- Nie, J.; McGill, M.A.; Dermer, M.; Dho, S.E.; Wolting, C.D.; McGlade, C.J. LNX functions as a RING type E3 ubiquitin ligase that targets the cell fate determinant Numb for ubiquitin-dependent degradation. EMBO J. 2002, 21, 93–102. [Google Scholar] [CrossRef] [Scilit]
- Susini, L.; Passer, B.J.; Amzallag-Elbaz, N.; Juven-Gershon, T.; Prieur, S.; Privat, N.; Tuynder, M.; Gendron, M.C.; Israel, A.; Amson, R.; et al. Siah-1 binds and regulates the function of Numb. Proc. Natl. Acad. Sci. USA 2001, 98, 15067–15072. [Google Scholar] [CrossRef] [Scilit]
- Teng, Y.; Liu, S.; Guo, X.; Liu, S.; Jin, Y.; He, T.; Bi, D.; Zhang, P.; Lin, B.; An, X.; et al. An Integrative Analysis Reveals a Central Role of P53 Activation via MDM2 in Zika Virus Infection Induced Cell Death. Front. Cell. Infect. Microbiol. 2017, 7, 327. [Google Scholar] [CrossRef] [Scilit]





| Primer a | Sequences (5′ to 3′) b | Target Gene/Vector |
|---|---|---|
| ZIKV-RR-F | AARTACACATACCARAACAAAGTGGT | NS5 |
| ZIKV-RR-R | TCCRCTCCCYCTYTGGTCTTG | NS5 |
| Numb-F1 | CGAATTCAACAAATTACGGCAAAGTTT | Numb |
| Numb-R1 | GCTCGAGTTAAAGTTCAATTTCAAACG | Numb |
| Numb-RR-F1 | GCTACCACCAGTCCCTTCTT | Numb |
| Numb-RR-F1 | GTGCCTGTAGGAACCTCTGT | Numb |
| shNUMB1-F | GATCCGGAATAAATATTATATATATTCAAGAGATATATATAATATTTATTCCTTTTTTG | shNumb |
| shNUMB1-R | AATTCAAAAAAGGAATAAATATTATATATATCTCTTGAATATATATAATATTTATTCCG | shNumb |
| shNUMB2-F | GATCCGCTCTATAGAGAATATATATTCAAGAGATATATATTCTCTATAGAGCTTTTTTG | shNumb |
| shNUMB2-R | AATTCAAAAAAGCTCTATAGAGAATATATATCTCTTGAATATATATTCTCTATAGAGCG | shNumb |
| shNUMB3-F | GATCCGAATAAATATTATATATAATTCAAGAGATTATATATAATATTTATTCTTTTTTG | shNumb |
| shNUMB3-R | AATTCAAAAAAGAATAAATATTATATATAATCTCTTGAATTATATATAATATTTATTCG | shNumb |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, J.; Yang, L.; Chang, P.; Yang, S.; Wang, Y.; Lin, S.; Tang, Q.; Zhang, Y. Zika Virus Induces Degradation of the Numb Protein Required through Embryonic Neurogenesis. Viruses 2023, 15, 1258. https://doi.org/10.3390/v15061258
He J, Yang L, Chang P, Yang S, Wang Y, Lin S, Tang Q, Zhang Y. Zika Virus Induces Degradation of the Numb Protein Required through Embryonic Neurogenesis. Viruses. 2023; 15(6):1258. https://doi.org/10.3390/v15061258
Chicago/Turabian StyleHe, Jia, Liping Yang, Peixi Chang, Shixing Yang, Yu Wang, Shaoli Lin, Qiyi Tang, and Yanjin Zhang. 2023. "Zika Virus Induces Degradation of the Numb Protein Required through Embryonic Neurogenesis" Viruses 15, no. 6: 1258. https://doi.org/10.3390/v15061258
APA StyleHe, J., Yang, L., Chang, P., Yang, S., Wang, Y., Lin, S., Tang, Q., & Zhang, Y. (2023). Zika Virus Induces Degradation of the Numb Protein Required through Embryonic Neurogenesis. Viruses, 15(6), 1258. https://doi.org/10.3390/v15061258

