Genetic Characterization of Raspberry Bushy Dwarf Virus Isolated from Red Raspberry in Kazakhstan
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Detection by RT-PCR
2.2. Amplification of Genomic RNA2 by RT-PCR
2.3. Nanopore Sequencing and Assembly
2.4. Molecular Characterisation and Phylogeny
3. Results and Discussion
3.1. Occurrence of RBDV in Kazakhstan
3.2. Variability of Genomic RNA2
3.3. Protein Sequence Analysis
3.4. Secondary Structure Prediction
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zerbini, F.M.; Siddell, S.G.; Mushegian, A.R.; Walker, P.J.; Lefkowitz, E.J.; Adriaenssens, E.M.; Alfenas-Zerbini, P.; Dutilh, B.E.; García, M.L.; Junglen, S.; et al. Differentiating between Viruses and Virus Species by Writing Their Names Correctly. Arch. Virol. 2022, 167, 1231–1234. [Google Scholar] [CrossRef] [PubMed]
- Barnett, O.W.; Murant, A.F. Host Range, Properties and Purification of Raspberry Bushy Dwarf Virus. Ann. Appl. Biol. 1970, 65, 435–449. [Google Scholar] [CrossRef]
- Jones, A.T.; Murant, A.F.; Jennings, D.L.; Wood, G.A. Association of Raspberry Bushy Dwarf Virus with Raspberry Yellows Disease; Reaction of Rubus Species and Cultivars, and the Inheritance of Resistance. Ann. Appl. Biol. 1982, 100, 135–147. [Google Scholar] [CrossRef]
- Kokko, H.; Lemmetty, A.; Haimi, P.; Kärenlampi, S. New Host for Raspberry Bushy Dwarf Virus: Arctic Bramble (Rubus arcticus). Eur. J. Plant Pathol. 1996, 102, 713–717. [Google Scholar] [CrossRef]
- Strik, B.; Martin, R.R. Impact of Raspberry Bushy Dwarf Virus on “Marion” Blackberry. Plant Dis. 2003, 87, 294–296. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Mavrič, I.; Marn, M.V.; Koron, D.; Žežlina, I. First Report of Raspberry Bushy Dwarf Virus on Red Raspberry and Grapevine in Slovenia. Plant Dis. 2003, 87, 1148. [Google Scholar] [CrossRef] [PubMed]
- Çağlayan, K.; Gazel, M.; Roumi, V.; Lamovsek, J.; Beber, A.; Pleško, I.M. Sweet Cherry, a New Host of Raspberry Bushy Dwarf Virus. J. Plant Pathol. 2023, 105, 307–311. [Google Scholar] [CrossRef]
- Murant, A.F.; Jones, A.T. Comparison of Isolates of Raspberry Bushy Dwarf Virus from Red and Black Raspberries. Acta Hortic. 1976, 66, 47–52. [Google Scholar] [CrossRef]
- Isogai, M.; Yoshida, T.; Nakanowatari, C.; Yoshikawa, N. Penetration of Pollen Tubes with Accumulated Raspberry Bushy Dwarf Virus into Stigmas Is Involved in Initial Infection of Maternal Tissue and Horizontal Transmission. Virology 2014, 452–453, 247–253. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ziegler, A.; Natsuaki, T.; Mayo, M.A.; Jolly, C.A.; Murant, A.F. The Nucleotide Sequence of RNA-1 of Raspberry Bushy Dwarf Virus. J. Gen. Virol. 1992, 73, 3213–3218. [Google Scholar] [CrossRef]
- Natsuaki, T.; Mayo, M.A.; Jolly, C.A.; Murant, A.F. Nucleotide Sequence of Raspberry Bushy Dwarf Virus RNA-2: A Bicistronic Component of a Bipartite Genome. J. Gen. Virol. 1991, 72, 2183–2189. [Google Scholar] [CrossRef] [PubMed]
- Mayo, M.A.; Jolly, C.A.; Murant, A.F.; Raschke, J.H. Nucleotide Sequence of Raspberry Bushy Dwarf Virus RNA-3. J. Gen. Virol. 1991, 72, 469–472. [Google Scholar] [CrossRef] [PubMed]
- Raj, F.; Mallika, J. SRNA Deep Sequencing Aided Plant RNA Virus Detection in Cultivated Raspberries and Molecular Characterization of Raspberry Bushy Dwarf Virus and Black Raspberry Necrosis Virus from Finland, Helsingin Yliopisto. Master’s Thesis, University of Helsinki, Helsinki, Finland, 2018. [Google Scholar]
- MacFarlane, S.A.; McGavin, W.J. Genome Activation by Raspberry Bushy Dwarf Virus Coat Protein. J. Gen. Virol. 2009, 90, 747–753. [Google Scholar] [CrossRef] [PubMed]
- Jones, A.T.; Mcgavin, W.J.; Mayo, M.A.; Angel-Diaz, J.E.; Kärenlampi, S.O.; Kokko, H. Comparisons of Some Properties of Two Laboratory Variants of Raspberry Bushy Dwarf Virus (RBDV) with Those of Three Previously Characterised RBDV Isolates. Eur. J. Plant Pathol. 2000, 106, 623–632. [Google Scholar] [CrossRef]
- Quito-Avila, D.F.; Ibarra, M.A.; Alvarez, R.; Peralta, E.L.; Martin, R.R. A Raspberry Bushy Dwarf Virus Isolate from Ecuadorean Rubus Glaucus Contains an Additional RNA That Is a Rearrangement of RNA-2. Arch. Virol. 2014, 159, 2519–2521. [Google Scholar] [CrossRef]
- Quito-Avila, D.F.; Lightle, D.; Martin, R.R. Effect of Raspberry Bushy Dwarf Virus, Raspberry Leaf Mottle Virus, and Raspberry Latent Virus on Plant Growth and Fruit Crumbliness in “Meeker” Red Raspberry. Plant Dis. 2013, 98, 176–183. [Google Scholar] [CrossRef][Green Version]
- Tzanetakis, I.E. The Gordian Knot of Small Fruit Virology: Emerging Diseases and Their Control. APSnet Feature Artic. 2012. [Google Scholar] [CrossRef]
- Krupovic, M.; Koonin, E.V. Multiple Origins of Viral Capsid Proteins from Cellular Ancestors. Proc. Natl. Acad. Sci. USA 2017, 114, E2401–E2410. [Google Scholar] [CrossRef][Green Version]
- Chare, E.R.; Holmes, E.C. Selection Pressures in the Capsid Genes of Plant RNA Viruses Reflect Mode of Transmission. J. Gen. Virol. 2004, 85, 3149–3157. [Google Scholar] [CrossRef]
- Davino, S.; Panno, S.; Rangel, E.A.; Davino, M.; Bellardi, M.G.; Rubio, L. Population Genetics of Cucumber Mosaic Virus Infecting Medicinal, Aromatic and Ornamental Plants from Northern Italy. Arch. Virol. 2012, 157, 739–745. [Google Scholar] [CrossRef]
- Zelyüt, F.R.; Ertunç, F. Population Genetic Analysis of Lettuce Big-Vein Disease Viruses and Their Vector Fungi Olpidium Virulentus in Ankara Province, Turkey. Physiol. Mol. Plant Pathol. 2021, 113, 101593. [Google Scholar] [CrossRef]
- Callaway, A.; Giesman-Cookmeyer, D.; Gillock, E.T.; Sit, T.L.; Lommel, S.A. The Multifunctional Capsid Proteins of Plant RNA Viruses. Annu. Rev. Phytopathol. 2001, 39, 419–460. [Google Scholar] [CrossRef]
- Amraee, L.; Rahmani, F. Modified CTAB Protocol for RNA Extraction from Lemon Balm (Melissa Officinalis L.). Acta Agric. Slov. 2020, 115, 53–57. [Google Scholar] [CrossRef][Green Version]
- Gritsenko, D.; Kerimbek, N.; Kapytina, A.; Pozharskiy, A.; Nizamdinova, G.; Taskuzhina, A.; Kostyukova, V.; Adilbayeva, K. Development of Primer Sets for Detection of Raspberry Leaf Blotch Virus and Raspberry Leaf Mottle Virus by Multiplex RT-PCR. Eurasian J. Appl. Biotechnol. 2022, 1, 33–39. [Google Scholar] [CrossRef]
- Edgar, R.C. MUSCLE: A Multiple Sequence Alignment Method with Reduced Time and Space Complexity. BMC Bioinform. 2004, 5, 113. [Google Scholar] [CrossRef][Green Version]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; Mcgettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X Version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data; ScienceOpen, Inc.: Berlin, Germany, 2010. [Google Scholar]
- Ewels, P.; Magnusson, M.; Lundin, S.; Käller, M. MultiQC: Summarize Analysis Results for Multiple Tools and Samples in a Single Report. Bioinformatics 2016, 32, 3047–3048. [Google Scholar] [CrossRef][Green Version]
- Brancaccio, R.N.; Robitaille, A.; Dutta, S.; Rollison, D.E.; Tommasino, M.; Gheit, T. MinION Nanopore Sequencing and Assembly of a Complete Human Papillomavirus Genome. J. Virol. Methods 2021, 294, 114180. [Google Scholar] [CrossRef] [PubMed]
- Wick, R.R.; Judd, L.M.; Holt, K.E. Performance of Neural Network Basecalling Tools for Oxford Nanopore Sequencing. Genome Biol. 2019, 20, 129. [Google Scholar] [CrossRef][Green Version]
- Wick, R. Filtlong. 2018. Available online: https://github.com/rrwick/Filtlong (accessed on 10 March 2023).
- Koren, S.; Walenz, B.P.; Berlin, K.; Miller, J.R.; Bergman, N.H.; Phillippy, A.M. Canu: Scalable and Accurate Long-Read Assembly via Adaptive κ-Mer Weighting and Repeat Separation. Genome Res. 2017, 27, 722–736. [Google Scholar] [CrossRef][Green Version]
- Medaka: Sequence Correction Provided by ONT Research. Available online: https://github.com/nanoporetech/medaka (accessed on 10 March 2023).
- Okonechnikov, K.; Golosova, O.; Fursov, M.; Varlamov, A.; Vaskin, Y.; Efremov, I.; Grehov, O.G.G.; Kandrov, D.; Rasputin, K.; Syabro, M.; et al. Unipro UGENE: A Unified Bioinformatics Toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Katoh, K.; Misawa, K.; Kuma, K.I.; Miyata, T. MAFFT: A Novel Method for Rapid Multiple Sequence Alignment Based on Fast Fourier Transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Crooks, G.E.; Hon, G.; Chandonia, J.M.; Brenner, S.E. WebLogo: A Sequence Logo Generator. Genome Res. 2004, 14, 1188–1190. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M. Twelve Years of SAMtools and BCFtools. GigaScience 2021, 10, giab008. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Barrett, J. A Statistical Framework for SNP Calling, Mutation Discovery, Association Mapping and Population Genetical Parameter Estimation from Sequencing Data. Bioinformatics 2011, 27, 2987–2993. [Google Scholar] [CrossRef][Green Version]
- Domingo, E.; Martín, V.; Perales, C.; Grande-Pérez, A.; García-Arriaza, J.; Arias, A. Viruses as Quasispecies: Biological Implications. Curr. Top. Microbiol. Immunol. 2006, 299, 51–82. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Campos, S.; Domínguez-Huerta, G.; Díaz-Martínez, L.; Tomás, D.M.; Navas-Castillo, J.; Moriones, E.; Grande-Pérez, A. Differential Shape of Geminivirus Mutant Spectra across Cultivated and Wild Hosts with Invariant Viral Consensus Sequences. Front. Plant Sci. 2018, 9, 932. [Google Scholar] [CrossRef][Green Version]
- Juárez, M.; Rabádan, M.P.; Martínez, L.D.; Tayahi, M.; Grande-Pérez, A.; Gómez, P. Natural Hosts and Genetic Diversity of the Emerging Tomato Leaf Curl New Delhi Virus in Spain. Front. Microbiol. 2019, 10, 140. [Google Scholar] [CrossRef]
- Felsenstein, J. Confidence Limits on Phylogenies: An Approach Using the Bootstrap. Evolution 1985, 39, 783. [Google Scholar] [CrossRef]
- Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian Inference of Phylogenetic Trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef][Green Version]
- Kimura, M. A Simple Method for Estimating Evolutionary Rates of Base Substitutions through Comparative Studies of Nucleotide Sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
- Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian Phylogenetic Inference under Mixed Models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef][Green Version]
- Stamatakis, A. RAxML Version 8: A Tool for Phylogenetic Analysis and Post-Analysis of Large Phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef][Green Version]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Chamberlain, C.J.; Kraus, J.; Kohnen, P.D.; Finn, C.E.; Martin, R.R. First Report of Raspberry Bushy Dwarf Virus in Rubus Multibracteatus from China. Plant Dis. 2003, 87, 603. [Google Scholar] [CrossRef]
- Mavrič Pleško, I.; Viršček Marn, M.; Širca, S.; Urek, G. Biological, Serological and Molecular Characterisation of Raspberry Bushy Dwarf Virus from Grapevine and Its Detection in the Nematode Longidorus Juvenilis. Eur. J. Plant Pathol. 2009, 123, 261–268. [Google Scholar] [CrossRef]
- Valasevich, N.; Kukharchyk, N.; Kvarnheden, A. Molecular Characterisation of Raspberry Bushy Dwarf Virus Isolates from Sweden and Belarus. Arch. Virol. 2011, 156, 369–374. [Google Scholar] [CrossRef]
- Mavrič Pleško, I.; Lamovšek, J.; Lešnik, A.; Viršček Marn, M. Raspberry Bushy Dwarf Virus in Slovenia—Geographic Distribution, Genetic Diversity and Population Structure. Eur. J. Plant Pathol. 2020, 158, 1033–1042. [Google Scholar] [CrossRef]
- Haňcinský, R.; Mihálik, D.; Mrkvová, M.; Candresse, T.; Glasa, M. Plant Viruses Infecting Solanaceae Family Members in the Cultivated and Wild Environments: A Review. Plants 2020, 9, 667. [Google Scholar] [CrossRef]
- Shates, T.M.; Sun, P.; Malmstrom, C.M.; Dominguez, C.; Mauck, K.E. Addressing Research Needs in the Field of Plant Virus Ecology by Defining Knowledge Gaps and Developing Wild Dicot Study Systems. Front. Microbiol. 2018, 9, 3305. [Google Scholar] [CrossRef] [PubMed]
- Malmstrom, C.M.; Alexander, H.M. Effects of Crop Viruses on Wild Plants. Curr. Opin. Virol. 2016, 19, 30–36. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Paudel, D.B.; Sanfaçon, H. Exploring the Diversity of Mechanisms Associated with Plant Tolerance to Virus Infection. Front. Plant Sci. 2018, 9, 1575. [Google Scholar] [CrossRef] [PubMed]
- Roossinck, M.J.; Bazán, E.R. Symbiosis: Viruses as Intimate Partners. Annu. Rev. Virol. 2017, 4, 123–139. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.-J.; Jacques, F.M.B.; Liu, Y.-S.C.; Su, T.; Ferguson, D.K.; Xing, Y.-W.; Zhou, Z.-K. Rubus (Rosaceae) Diversity in the Late Pliocene of Yunnan, Southwestern China. Geobios 2015, 48, 439–448. [Google Scholar] [CrossRef]
- Yang, Y.; Gao, J.; Wang, J.; Heffernan, R.; Hanson, J.; Paliwal, K.; Zhou, Y. Sixty-Five Years of the Long March in Protein Secondary Structure Prediction: The Final Stretch? Brief. Bioinform. 2018, 19, 482–494. [Google Scholar] [CrossRef][Green Version]
- Hallgren, J.; Tsirigos, K.D.; Pedersen, M.D.; Juan, J.; Armenteros, A.; Marcatili, P.; Nielsen, H.; Krogh, A.; Winther, O. DeepTMHMM Predicts Alpha and Beta Transmembrane Proteins Using Deep Neural Networks. bioRxiv, 2022; bioRxiv:2022.04.08.487609. [Google Scholar] [CrossRef]
- Hessa, T.; Meindl-Beinker, N.M.; Bernsel, A.; Kim, H.; Sato, Y.; Lerch-Bader, M.; Nilsson, I.; White, S.H.; Heijne, G.V. Molecular Code for Transmembrane-Helix Recognition by the Sec61 Translocon. Nature 2007, 450, 1026–1030. [Google Scholar] [CrossRef] [PubMed]
- Peiró, A.; Martínez-Gil, L.; Tamborero, S.; Pallás, V.; Sánchez-Navarro, J.A.; Mingarro, I. The Tobacco Mosaic Virus Movement Protein Associates with but Does Not Integrate into Biological Membranes. J. Virol. 2014, 88, 3016–3026. [Google Scholar] [CrossRef][Green Version]
- Gallitelli, D.; Finetti-Sialer, M.; Martelli, G.P. Anulavirus, a Proposed New Genus of Plant Viruses in the Family Bromoviridae. Arch. Virol. 2005, 150, 407–411. [Google Scholar] [CrossRef]
- Isogai, M.; Matsudaira, T.; Ito, M.; Yoshikawa, N. The 1b Gene of Raspberry Bushy Dwarf Virus Is a Virulence Component That Facilitates Systemic Virus Infection in Plants. Virology 2019, 526, 222–230. [Google Scholar] [CrossRef]
- Sztuba-Solińska, J.; Bujarski, J.J. Insights into the Single-Cell Reproduction Cycle of Members of the Family Bromoviridae : Lessons from the Use of Protoplast Systems. J. Virol. 2008, 82, 10330–10340. [Google Scholar] [CrossRef][Green Version]
- Thekke-Veetil, T.; Ho, T.; Postman, J.D.; Tzanetakis, I.E. Characterization and Detection of a Novel Idaeovirus Infecting Blackcurrant. Eur. J. Plant Pathol. 2017, 149, 751–757. [Google Scholar] [CrossRef]
- Ziegler, A.; Mayo, M.A.; Murant, A.F. Proposed Classification of the Bipartite-Genomed Raspberry Bushy Dwarf Idaeovirus, with Tripartite-Genomed Viruses in the Family Bromoviridae. Arch. Virol. 1993, 131, 483–488. [Google Scholar] [CrossRef]
- Kumar, G.; Dasgupta, I. Variability, Functions and Interactions of Plant Virus Movement Proteins: What Do We Know So Far? Microorganisms 2021, 9, 695. [Google Scholar] [CrossRef] [PubMed]
- Tenllado, F.; Bol, J.F. Genetic Dissection of the Multiple Functions of Alfalfa Mosaic Virus Coat Protein in Viral RNA Replication, Encapsidation, and Movement. Virology 2000, 268, 29–40. [Google Scholar] [CrossRef][Green Version]
- Akamatsu, N.; Takeda, A.; Kishimoto, M.; Kaido, M.; Okuno, T.; Mise, K. Phosphorylation and Interaction of the Movement and Coat Proteins of Brome Mosaic Virus in Infected Barley Protoplasts. Arch. Virol. 2007, 152, 2087–2093. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Navarro, J.A.; Bol, J.F. Role of the Alfalfa Mosaic Virus Movement Protein and Coat Protein in Virus Transport. Mol. Plant-Microbe Interact. 2001, 14, 1051–1062. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Bernardo, P.; Charles-Dominique, T.; Barakat, M.; Ortet, P.; Fernandez, E.; Filloux, D.; Hartnady, P.; Rebelo, T.A.; Cousins, S.R.; Mesleard, F.; et al. Geometagenomics Illuminates the Impact of Agriculture on the Distribution and Prevalence of Plant Viruses at the Ecosystem Scale. ISME J 2018, 12, 173–184. [Google Scholar] [CrossRef][Green Version]
- Fraile, A.; Alonso-Prados, J.L.; Aranda, M.A.; Bernal, J.J.; Malpica, J.M.; García-Arenal, F. Genetic Exchange by Recombination or Reassortment Is Infrequent in Natural Populations of a Tripartite RNA Plant Virus. J. Virol. 1997, 71, 934–940. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Isogai, M.; Yoshida, M.; Imanishi, H.; Yoshikawa, N. First Report of Raspberry Yellows Disease Caused by Raspberry Bushy Dwarf Virus in Japan. J. Gen. Plant Pathol. 2012, 78, 360–363. [Google Scholar] [CrossRef]
- Pleško, I.M.; Marn, M.V.; Nyerges, K.; Lázár, J. First Report of Raspberry Bushy Dwarf Virus Infecting Grapevine in Hungary. Plant Dis. 2012, 96, 1582. [Google Scholar] [CrossRef] [PubMed]
- Czotter, N.; Molnar, J.; Szabó, E.; Demian, E.; Kontra, L.; Baksa, I.; Szittya, G.; Kocsis, L.; Deak, T.; Bisztray, G.; et al. NGS of Virus-Derived Small RNAs as a Diagnostic Method Used to Determine Viromes of Hungarian Vineyards. Front. Microbiol. 2018, 9, 122. [Google Scholar] [CrossRef][Green Version]
Virus | Purpose | Region | Direction | Sequence (5′–3′) | Amplicon Size (bp) |
---|---|---|---|---|---|
RBDV | Detection | CP | F | agatccatgacggatgtgg | 182 |
R | aactaagttagaactattgtgg | ||||
RBDV | Amplification | RNA2 | F | agatccatgacggatgtgg | 2231 |
R | aactaagttagaactattgtgg | ||||
RLMV | Detection | CP | F | tagcgtacttgtactgttc | 163 |
R | tacacttgtagcatgtttgg | ||||
RLBV | Detection | NP | F | tacacttgtagcatgtttgg | 106 |
R | ccaacccttgtcaattttgat | ||||
RpRSV | Detection | MP | F | cagagtatgggtgatttct | 127 |
R | gaaacagcgcactctt |
Isolate | Accession | Country | Host | Year | Source |
---|---|---|---|---|---|
J1 | AB948215 | Japan | Red raspberry cv. Autumn Britten | 2016 | Direct submission |
RBDV-China | DQ120126 | China | Rubus multibracteatus | 2003 | [49] |
GR-6 | EU796085 | Slovenia | Grapevine | 2009 | [50] |
GR-4 | EU796086 | Slovenia | Grapevine | 2009 | [50] |
GR-2 | EU796087 | Slovenia | Grapevine | 2009 | [50] |
RR-1 | EU796088 | Slovenia | Red raspberry | 2009 | [50] |
CmRR-1 | EU796089 | Slovenia | C. murale—raspberry | 2009 | [50] |
CmGR-2 | EU796090 | Slovenia | C. murale—grapevine | 2009 | [50] |
BY1 | FR687354 | Belarus | Red raspberry cv. Zolotye Cupola | 2011 | [51] |
BY3 | FR687355 | Belarus | Red raspberry cv. Abricosovaya | 2011 | [51] |
BY8 | FR687356 | Belarus | Red raspberry cv. Zolotye Cupola | 2011 | [51] |
BY22 | FR687357 | Belarus | Red raspberry cv. Elegantnaya | 2011 | [51] |
SE3 | FR687358 | Sweden | Red raspberry | 2011 | [51] |
Ec_Az | KJ007640 | Ecuador | Rubus glaucus—Andean rasp | 2014 | [16] |
RR2 | KY417868 | Slovenia | Red raspberry cv. Chilliwack | 2016 | Direct submission |
RR3 | KY417869 | Slovenia | Red raspberry | 2016 | Direct submission |
RR5 | KY417870 | Slovenia | Red raspberry | 2016 | Direct submission |
RR8 | KY417871 | Slovenia | Red raspberry cv. Titan | 2016 | Direct submission |
GR7 | KY417872 | Slovenia | Grapevine cv. Chardonnay | 2016 | Direct submission |
GR10 | KY417873 | Slovenia | Grapevine cv. Renski Rizling (Riesling) | 2016 | Direct submission |
GR11 | KY417874 | Slovenia | Grapevine cv. Sipon | 2016 | Direct submission |
GR12 | KY417875 | Slovenia | Grapevine cv. Zweigelt | 2016 | Direct submission |
GR13 | KY417876 | Slovenia | Grapevine cv. Kraljevina | 2016 | Direct submission |
GR8 | KY417880 | Slovenia | Grapevine cv. Modra Frankinja (Blaufrankisch) | 2020 | [52] |
GR9 | KY417881 | Slovenia | Grapevine cv. Modra Frankinja (Blaufrankisch) | 2020 | [52] |
12G412 | MH802010 | Canada | Grapevine | 2019 | Direct submission |
PV-0053 | MW582778 | N/A | Chenopodium quinoa (lab) DSMZ PV-0053 | 2021 | Direct submission |
B39 | MW729744 | Turkey | Cherry | 2022 | [7] |
B188 | MW729744 | Turkey | Cherry | 2022 | [7] |
PV-1316 | MZ202351 | Netherlands | Red raspberry DSMZ PV-1316 | 2021 | Direct submission |
R15 | S55890 | UK | Red raspberry cv. Mailing Jewel | 1991 | [11] |
KZ3-4 | OQ336272 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZD6-1 | OQ336288 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZD8 | OQ336289 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZHybrid4-33 | OQ336273 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZMol11 | OQ336274 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZMol13 | OQ336275 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZMol2 | OQ336276 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZMol3 | OQ336277 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZMol5 | OQ336278 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZMol6 | OQ336279 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZMol8 | OQ336280 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZMol9 | OQ336281 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZOgonek | OQ336282 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZSelection1 | OQ336283 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZSelection2-8 | OQ336284 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZSelection4 | OQ336285 | Kazakhstan | Red raspberry, crop | 2021 | Present study |
KZWild2 | OQ336286 | Kazakhstan | Red raspberry, wild | 2021 | Present study |
KZWild4 | OQ336287 | Kazakhstan | Red raspberry, wild | 2021 | Present study |
Mutation Frequency per Codon, 10−3 | ||||||
---|---|---|---|---|---|---|
Samples | Mutation Frequency, 10−3 | MP | CP | SNP | Indel | Shannon Index |
KZ3-4 | 1.19 | 4.02 | 4.04 | 30 | 0 | 0.00278 |
KZD6-1 | 0.97 | 3.25 | 2.42 | 21 | 0 | 0.00233 |
KZD8 | 0.97 | 3.25 | 2.42 | 21 | 0 | 0.00233 |
KZHybrid4-33 | 1.00 | 3.25 | 2.42 | 22 | 1 | 0.00238 |
KZMol11 | 0.97 | 3.25 | 2.42 | 21 | 1 | 0.00233 |
KZMol13 | 1.10 | 3.71 | 3.84 | 21 | 0 | 0.00258 |
KZMol2 | 0.95 | 2.94 | 3.43 | 21 | 0 | 0.00228 |
KZMol3 | 1.10 | 3.71 | 3.84 | 21 | 1 | 0.00258 |
KZMol5 | 0.95 | 2.94 | 3.43 | 21 | 0 | 0.00228 |
KZMol6 | 0.97 | 3.25 | 2.63 | 26 | 0 | 0.00233 |
KZMol8 | 1.10 | 3.71 | 3.84 | 20 | 0 | 0.00258 |
KZMol9 | 0.97 | 3.25 | 2.42 | 20 | 0 | 0.00233 |
KZOgonek | 1.12 | 3.87 | 3.84 | 26 | 0 | 0.00263 |
KZSelection1 | 0.95 | 2.94 | 3.43 | 26 | 0 | 0.00228 |
KZSelection2-8 | 0.97 | 3.09 | 3.03 | 26 | 1 | 0.00233 |
KZSelection4 | 1.12 | 3.87 | 3.84 | 26 | 0 | 0.00263 |
KZWild2 | 1.10 | 3.40 | 3.23 | 25 | 0 | 0.00258 |
KZWild4 | 1.07 | 3.40 | 3.23 | 25 | 0 | 0.00253 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kolchenko, M.; Kapytina, A.; Kerimbek, N.; Pozharskiy, A.; Nizamdinova, G.; Khusnitdinova, M.; Taskuzhina, A.; Gritsenko, D. Genetic Characterization of Raspberry Bushy Dwarf Virus Isolated from Red Raspberry in Kazakhstan. Viruses 2023, 15, 975. https://doi.org/10.3390/v15040975
Kolchenko M, Kapytina A, Kerimbek N, Pozharskiy A, Nizamdinova G, Khusnitdinova M, Taskuzhina A, Gritsenko D. Genetic Characterization of Raspberry Bushy Dwarf Virus Isolated from Red Raspberry in Kazakhstan. Viruses. 2023; 15(4):975. https://doi.org/10.3390/v15040975
Chicago/Turabian StyleKolchenko, Mariya, Anastasiya Kapytina, Nazym Kerimbek, Alexandr Pozharskiy, Gulnaz Nizamdinova, Marina Khusnitdinova, Aisha Taskuzhina, and Dilyara Gritsenko. 2023. "Genetic Characterization of Raspberry Bushy Dwarf Virus Isolated from Red Raspberry in Kazakhstan" Viruses 15, no. 4: 975. https://doi.org/10.3390/v15040975
APA StyleKolchenko, M., Kapytina, A., Kerimbek, N., Pozharskiy, A., Nizamdinova, G., Khusnitdinova, M., Taskuzhina, A., & Gritsenko, D. (2023). Genetic Characterization of Raspberry Bushy Dwarf Virus Isolated from Red Raspberry in Kazakhstan. Viruses, 15(4), 975. https://doi.org/10.3390/v15040975