Metaviromic Characterization of Betaflexivirus Populations Associated with a Vitis cultivar Collection in South Africa
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Plant Material
2.2. Isolation of Total RNA and RNAtag-Seq Library Preparation
2.3. Bioinformatics of RNAtag-Seq Data
2.4. Phylogenetic Analyses of Vitivirus Replicase Associated Protein (RAP) Sequences
2.5. RT-PCR Confirmation of Selected Vitiviruses
3. Results and Discussion
3.1. Provenance of Collected Samples
3.2. Illumina Sequencing and Data Analysis
3.3. Viruses Identified: GRSPaV
3.4. GVA
3.5. GVB
3.6. GVE
3.7. GVF
3.8. GVH
3.9. GVI
3.10. GVM
3.11. Evidence for Mixed Infections
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fuchs, M. Grapevine viruses: A multitude of diverse species with simple but overall poorly adopted management solutions in the vineyard. J. Plant. Pathol. 2020, 102, 643–653. [Google Scholar] [CrossRef] [Scilit]
- Galiakparov, N.; Tanne, E.; Sela, I.; Gafny, R. Functional analysis of the grapevine virus A genome. Virology 2003, 306, 42–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Conti, M.; Milne, R.G.; Luisoni, E.; Boecardo, G. A closterovirus from a stem pitting diseased grapevine. Phytopathology 1980, 70, 394–399. [Google Scholar] [CrossRef] [Scilit]
- Boscia, D.; Savino, V.; Minafra, A.; Namba, S.; Elicio, V.; Castellano, M.A.; Gonsalves, D.; Martelli, G.P. Properties of a filamentous virus isolated from grapevine affected by corky bark. Arch. Virol. 1993, 130, 109–120. [Google Scholar] [CrossRef] [Scilit]
- Abou-Ghanem, N.; Saldarelli, P.; Minafra, A.; Buzkan, N.; Castellano, M.A.; Martelli, G.P. Properties of grapevine virus D, a novel putative trichovirus. J. Plant Pathol. 1997, 78, 15–25. [Google Scholar]
- Nakaune, R.; Toda, S.; Mochizuki, M.; Nakano, M. Identification and characterization of a new vitivirus from grapevine. Arch. Virol. 2008, 153, 1827–1832. [Google Scholar] [CrossRef] [Scilit]
- Al Rwahnih, M.; Sudarshana, M.R.; Uyemoto, J.K.; Rowhani, A. Complete genome sequence of a novel vitivirus isolated from grapevine. J. Virol. 2012, 86, 9545. [Google Scholar] [CrossRef] [Scilit]
- Blouin, A.G.; Keenan, S.; Napier, K.R.; Barrero, R.A.; MacDiarmid, R.M. Identification of a novel vitivirus from grapevines in New Zealand. Arch. Virol. 2018, 163, 281–284. [Google Scholar] [CrossRef] [Scilit]
- Candresse, T.; Theil, S.; Faure, C.; Marais, A. Determination of the complete genomic sequence of grapevine virus H, a novel vitivirus infecting grapevine. Arch. Virol. 2018, 163, 277–280. [Google Scholar] [CrossRef] [Scilit]
- Blouin, A.G.; Chooi, K.M.; Warren, B.; Napier, K.R.; Barrero, R.A.; MacDiarmid, R.M. Grapevine virus I, a putative new vitivirus detected in co-infection with grapevine virus G in New Zealand. Arch. Virol. 2018, 163, 1371–1374. [Google Scholar] [CrossRef] [Scilit]
- Diaz-Lara, A.; Golino, D.; Al Rwahnih, M. Genomic characterization of grapevine virus J, a novel virus identified in grapevine. Arch. Virol. 2018, 163, 1965–1967. [Google Scholar] [CrossRef] [Scilit]
- Jo, Y.; Song, M.-K.; Choi, H.; Park, J.-S.; Lee, J.-W.; Lian, S.; Lee, B.C.; Cho, W.K. Genome Sequence of Grapevine Virus K, a Novel Vitivirus Infecting Grapevine. Genome Announc. 2017, 5, e00994-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Debat, H.J.; Zavallo, D.; Brisbane, R.S.; Voncina, D.; Almeida, R.P.P.; Blouin, A.G.; Al Rwahnih, M.; Gomez, T.G.; Asurmendi, S. Grapevine virus L: A novel vitivirus in grapevine. Eur. J. Plant. Pathol. 2019, 155, 319–328. [Google Scholar] [CrossRef] [Scilit]
- Alabi, O.J.; McBride, S.; Appel, D.N.; Al Rwahnih, M.; Pontasch, F.M. Grapevine virus M, a novel vitivirus discovered in the American hybrid bunch grape cultivar Blanc du Bois in Texas. Arch. Virol. 2019, 164, 1739–1741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Read, D.A.; Thompson, G.D.; Le Cordeur, N.; Swanevelder, D.; Pietersen, G. Genomic characterization of grapevine viruses N and O: Novel vitiviruses from South Africa. Arch. Virol. 2022, 167, 611–614. [Google Scholar] [CrossRef] [Scilit]
- du Preez, J.; Stephan, D.; Mawassi, M.; Burger, J.T. The grapevine-infecting vitiviruses, with particular reference to grapevine virus A. Arch. Virol. 2011, 156, 1495–1503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goszczynski, D.E.; Jooste, A. Identification of divergent variants of Grapevine virus A. Eur. J. Plant Pathol. 2003, 109, 397–403. [Google Scholar] [CrossRef] [Scilit]
- Goszczynski, D.E.; du Preez, J.; Burger, J.T. Molecular divergence of Grapevine virus A (GVA) variants associated with Shiraz disease in South Africa. Virus Res. 2008, 138, 105–110. [Google Scholar] [CrossRef] [Scilit]
- Goszczynski, D.E. Divergent molecular variants of Grapevine virus B (GVB) from corky bark (CB)-affected and CB-negative LN33 hybrid grapevines. Virus Genes 2010, 41, 273–281. [Google Scholar] [CrossRef] [Scilit]
- Coetzee, B.; Maree, H.J.; Stephan, D.; Freeborough, M.J.; Burger, J.T. The first complete nucleotide sequence of a grapevine virus E variant. Arch. Virol. 2010, 155, 1357–1360. [Google Scholar] [CrossRef] [Scilit]
- Molenaar, N.; Burger, J.T.; Maree, H.J. Detection of a divergent variant of grapevine virus F by next-generation sequencing. Arch. Virol. 2015, 160, 2125–2127. [Google Scholar] [CrossRef] [Scilit]
- Read, D.A.; Thompson, G.D.; Swanevelder, D.; Pietersen, G. Detection and diversity of grapevine virus L from a vitis cultivar collection in Stellenbosch, South Africa. Eur. J. Plant Pathol. 2021, 161, 1007–1011. [Google Scholar] [CrossRef] [Scilit]
- Rowhani, A.; Daubert, S.; Arnold, K.; Al Rwahnih, M.; Klaassen, V.; Golino, D.; Uyemoto, J.K. Synergy between grapevine vitiviruses and grapevine leafroll viruses. Eur. J. Plant Pathol. 2018, 151, 919–925. [Google Scholar] [CrossRef] [Scilit]
- Rowhani, A.; Uyemoto, J.K.; Golino, D.; Daubert, S.D.; Al Rwahnih, M. Viruses involved in graft-incompatibility and decline. In Grapevine Viruses: Molecular Biology, Diagnostics, and Management; Meng, B., Fuchs, M., Martelli, G.P., Golino, D., Eds.; Springer: New York, NY, USA, 2016; pp. 289–302. [Google Scholar]
- Tobar, M.; Fiore, N.; Pérez-Donoso, A.G.; León, R.; Rosales, I.M.; Gambardella, M. Divergent molecular and growth responses of young “Cabernet Sauvignon” (Vitis vinifera) plants to simple and mixed infections with Grapevine rupestris stem pitting-associated virus. Hortic. Res. 2022, 7, 2. [Google Scholar] [CrossRef] [Scilit]
- Meng, B.; Pang, S.; Forsline, P.L.; McFerson, J.R.; Gonsalves, D. Nucleotide sequence and genome structure of grapevine rupestris stem pitting associated virus-1 reveal similarities to apple stem pitting virus. J. Gen. Virol. 1998, 79, 2059–2069. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martelli, G.P. Directory of virus and virus-like diseases of the grapevine and their agents. J. Plant Pathol. 2014, 96, 73–88. [Google Scholar]
- Orfanidou, C.G.; Moraki, K.; Panailidou, P.; Lotos, L.; Katsiani, A.; Avgelis, A.; Katis, N.I.; Maliogka, V.I. Prevalence and genetic diversity of viruses associated with rugose wood complex in Greek vineyards. Plant Dis. 2021, 105, 3677–3685. [Google Scholar] [CrossRef] [Scilit]
- Sabaghian, S.; Rakhshandehroo, F.; Zamanizadeh, H.; Elbeaino, T. Biological, epidemiological and population structure analyses of vitiviruses in Iran. Eur. J. Plant Pathol. 2021, 159, 117–129. [Google Scholar] [CrossRef] [Scilit]
- Minafra, A.; Mawassi, M.; Goszczynski, D.; Saldarelli, P. Grapevine Viruses. In Grapevine Viruses: Molecular Biology, Diagnostics, and Management; Meng, B., Martelli, G.P., Golino, D.A., Fuchs, M., Eds.; Springer: New York, NY, USA, 2017; Chapter 11; pp. 229–256. [Google Scholar]
- White, E.; Venter, M.; Hiten, N.F.; Burger, J.T. Modified cetyltrimethylammonium bromide method improves robustness and versatility: The benchmark for plant RNA extraction. Biotechnol. J. 2008, 3, 1424–1428. [Google Scholar] [CrossRef] [Scilit]
- Shishkin, A.A.; Giannoukos, G.; Kucukural, A.; Ciulla, D.; Busby, M.; Surka, C.; Chen, J.; Bhattacharyya, R.P.; Rudy, R.F.; Patel, M.M.; et al. Simultaneous generation of many RNA-Seq libraries in a single reaction. Nat. Methods 2015, 12, 323–325. [Google Scholar] [CrossRef] [Scilit]
- Girardot, C.; Scholtalbers, J.; Sauer, S.; Su, S.Y.; Furlong, E.E.M. Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers. BMC Bioinform. 2016, 17, 419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nurk, S.; Meleshko, D.; Korobeynikov, A.; Pevzner, P.A. metaSPAdes: A new versatile metagenomic assembler. Genome Res. 2017, 27, 824–834. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Wheeler, D.L.; Church, D.M.; Federhen, S.; Lash, A.E.; Madden, T.L.; Pontius, J.U.; Schuler, G.D.; Schriml, L.M.; Sequeira, E.; Tatusova, T.A.; et al. Database resources of the National Center for Biotechnology. Nucleic Acids Res. 2003, 31, 28–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Meng, B.; Rowhani, A. Grapevine rupestris stem pitting-associated virus. In Grapevine Viruses: Molecular Biology, Diagnostics and Management; Springer International Publishing: Berlin/Heidelberg, Germany, 2017; pp. 257–287. [Google Scholar]
- Stecher, G.; Tamura, K.; Kumar, S. Molecular Evolutionary Genetics Analysis (MEGA) for macOS. Mol. Biol. Evol. 2020, 37, 1237–1239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jones, D.T.; Taylor, W.R.; Thornton, J.M. The Rapid Generation of Mutation Data Matrices from Protein Sequences. CABIOS 1992, 8, 275–282. [Google Scholar] [CrossRef] [Scilit]
- Le, S.Q.; Gascuel, O. An improved general amino acid replacement matrix. Mol. Biol. Evol. 2008, 25, 1307–1320. [Google Scholar] [CrossRef] [Scilit]
- Jooste, A.E.C.; Pietersen, G.; Burger, J.T. Distribution of Grapevine Leafroll Associated Virus-3 Variants in South African Vineyards. Eur. J. Plant Pathol. 2011, 131, 371–381. [Google Scholar] [CrossRef] [Scilit]
- Morgan, S.W.; Read, D.A.; Burger, J.T.; Pietersen, G. Diversity of viroids infecting grapevines in the South African Vitis germplasm collection. Virus Genes 2023, 59, 244–253. [Google Scholar] [CrossRef] [Scilit]
- Hily, J.M.; Beuve, M.; Vigne, E.; Demangeat, G.; Candresse, T.; Lemaire, O. A genome-wide diversity study of grapevine rupestris stem pitting-associated virus. Arch. Virol. 2018, 163, 3105–3111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Glasa, M.; Predajňa, L.; Šoltys, K.; Sihelská, N.; Nagyová, A.; Wetzel, T.; Sabanadzovic, S. Analysis of grapevine rupestris stem pitting-associated virus in Slovakia reveals differences in intra-host population diversity and naturally occurring recombination events. Plant Pathol. J. 2017, 33, 34–42. [Google Scholar] [CrossRef] [Scilit]
- Mostert, I.; Burger, J.T.; Maree, H.J. Genetic diversity and identification of putative recombination events in grapevine rupestris stem pitting-associated virus. Arch. Virol. 2018, 163, 2491–2496. [Google Scholar] [CrossRef] [Scilit]
- Morelli, M.; Minafra, A.; Boscia, D.; Martelli, G.P. Complete nucleotide sequence of a new variant of grapevine rupestris stem pitting-associated virus from southern Italy. Arch. Virol. 2011, 156, 543–546. [Google Scholar] [CrossRef] [Scilit]
- Porotikova, E.; Terehova, U.; Volodin, V.; Yurchenko, E.; Vinogradova, S. Distribution and genetic diversity of grapevine viruses in Russia. Plants 2021, 10, 1080. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Selmi, I.; Pacifico, D.; Lehad, A.; Stigliano, E.; Crucitti, D.; Carimi, F.; Mahfoudhi, N. Genetic diversity of grapevine rupestris stem pitting-associated virus isolates from Tunisian grapevine germplasm. Plant Pathol. 2020, 69, 1051–1059. [Google Scholar] [CrossRef] [Scilit]
- Schoelz, J.; Volenberg, D.; Adhab, M.; Fang, Z.; Klassen, V.; Spinka, C.; Rwahnih, M.A. A survey of viruses found in grapevine cultivars grown in Missouri. Am. J. Enol. Vitic. 2021, 72, 73–84. [Google Scholar] [CrossRef] [Scilit]
- Jooste, A.E.C.; Molenaar, N.; Maree, H.J.; Bester, R.; Morey, L.; de Koker, W.C.; Burger, J.T. Identification and distribution of multiple virus infections in Grapevine leafroll diseased vineyards. Eur. J. Plant Pathol. 2015, 142, 363–375. [Google Scholar] [CrossRef] [Scilit]
- Martelli, G.P.; Minafra, A.; Sardarelli, P. Vitivirus, a new genus of plant viruses. Arch. Virol. 1997, 142, 1929–1932. [Google Scholar]
- Predajňa, L.; Glasa, M. Partial sequence analysis of geographically close grapevine virus A isolates reveals their high regional variability and an intra-isolate heterogeneity. J. Phytopathol. 2016, 164, 427–431. [Google Scholar] [CrossRef] [Scilit]
- Goszczynski, D.E. The identification of a new genetic variant of Grapevine virus B. J. Plant Pathol. 2018, 100, 105–109. [Google Scholar] [CrossRef] [Scilit]
- Jagunić, M.; De Stradis, A.; Preiner, D.; La Notte, P.; Al Rwahnih, M.; Almeida, R.P.P.; Vončina, D. Biology and Ultrastructural Characterization of Grapevine Badnavirus 1 and Grapevine Virus G. Viruses 2022, 14, 2695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Selmi, I.; Lehad, A.; Pacifico, D.; Carimi, F.; Mahfoudhi, N. First report of grapevine virus E and grapevine virus F in Tunisian grapevines. J. Plant Pathol. 2017, 99, 543. [Google Scholar]
- Sabaghian, S.; Rakhshandehroo, F.; Zamanizadeh, H.; Elbeaino, T. First detection of grapevine virus F in Iran. J. Plant Pathol. 2018, 100, 111–112. [Google Scholar] [CrossRef] [Scilit]
- Panailidou, P.; Lotos, L.; Olmos, A.; Ruiz-Garcia, A.B.; Moran, F.; Orfanidou, C.G.; Sassalou, C.L.; Katis, N.I.; Maliogka, V.I. First report of grapevine virus E and grapevine virus F in grapevine in Greece. Plant Dis. 2019, 103, 1440. [Google Scholar] [CrossRef] [Scilit]
- Rasool, S.; Naz, S.; Rowhani, A.; Diaz-Lara, A.; Golino, D.A.; Farrar, K.D.; Al Rwahnih, M. Survey of grapevine pathogens in Pakistan. J. Plant Pathol. 2019, 101, 725–732. [Google Scholar] [CrossRef] [Scilit]
- Shvets, D.; Porotikova, E.; Sandomirsky, K.; Vinogradova, S. Virome of grapevine germplasm from the Anapa ampelogaphic collection (Russia). Viruses 2022, 14, 1314. [Google Scholar] [CrossRef] [Scilit]
- Vončina, D.; Al Rwahnih, M.; Rowhani, A.; Gouran, M.; Almeida, R.P.P. Viral Diversity in Autochthonous Croatian Grapevine Cultivars. Plants 2017, 6, 48. [Google Scholar] [CrossRef] [Scilit]
- Panailidou, P.; Lotos, L.; Sassalou, C.L.; Gagiano, E.; Pietersen, G.; Katis, N.I.; Maliogka, V.I. First report of grapevine virus H in grapevine in Greece. Plant Dis. 2021, 105, 2738. [Google Scholar] [CrossRef] [Scilit]
- Jagunic, M.; Lazarevic, B.; Nikolic, K.; Stupic, D.; Preiner, D.; Voncina, D. Detection, Transmission, and Characterization of Grapevine Virus H in Croatia. Pathogens 2022, 10, 1578. [Google Scholar] [CrossRef] [Scilit]
- Schianchi, N.; Flore, S.; Jagunić, M.; Serra, S.; Prota, V.A.; Vončina, D. Identification of grapevine virus G and grapevine virus H in Sardinia, Italy. Phytopathol. Mediterr. 2022, 61, 505–511. [Google Scholar] [CrossRef] [Scilit]
- Diaz-Lara, A.; Brisbane, R.S.; Aram, K.; Golino, D.; Al Rwahnih, M. Detection of new vitiviruses infecting grapevine in California. Arch. Virol. 2019, 164, 2573–2580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, R.; Dias, N.P.; Soltani, N.; Vargas-Asencio, J.; Hensley, D.D.; Perry, K.L.; Domier, L.L.; Hajimorad, M.R. Cultivated and wild grapevines in Tennessee possess overlapping but distinct virus populations. Plant Dis. 2021, 105, 2785–2791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lotos, L.; Ruiz-García, A.B.; Panailidou, P.; Olmos, A.; Katis, N.I.; Maliogka, V.I. The complete genome sequence of a divergent grapevine virus I isolate naturally infecting grapevine in Greece. Arch. Virol. 2020, 165, 3003–3006. [Google Scholar] [CrossRef] [Scilit]
- Adams, M.J.; Antoniw, J.F.; Bar-Joseph, M.; Brunt, A.A.; Candresse, T.; Foster, G.D.; Martelli, G.P.; Milne, R.G.; Zavriev, S.K.; Fauquet, C.M. The new plant virus family Flexiviridae and assessment of molecular criteria for species demarcation. Arch. Virol. 2004, 149, 1045–1060. [Google Scholar] [CrossRef] [Scilit]
- This, P.; Lacombe, T.; Thomas, M.R. Historical origins and genetic diversity of wine grapes. Trends Genet. 2006, 22, 511–519. [Google Scholar] [CrossRef] [Scilit]
- El Aou-ouad, H.; Montero, R.; Baraza, E.; Bota, J. Recovering Ancient Grapevine Cultivars in the Balearic Islands: Sanitary Status Evaluation and Virus Elimination. Plants 2022, 11, 1754. [Google Scholar] [CrossRef] [Scilit]
- Čarija, M.; Radić, T.; Černi, S.; Mucalo, A.; Zdunić, G.; Vončina, D.; Jagunić, M.; Hančević, K. Prevalence of Virus Infections and GLRaV-3 Genetic Diversity in Selected Clones of Croatian Indigenous Grapevine Cultivar Plavac Mali. Pathogens 2022, 11, 176. [Google Scholar] [CrossRef] [Scilit]
- Golino, D.A.; Fuchs, M.; Rwahnih, M.A.; Farrar, K.; Schmidt, A.; Martelli, G.P. Regulatory Aspects of Grape Viruses and Virus Diseases: Certification, Quarantine, and Harmonization. In Grapevine Viruses: Molecular Biology, Diagnostics and Management; Springer: Berlin/Heidelberg, Germany, 2017; pp. 581–598. [Google Scholar]
- Maliogka, V.I.; Martelli, G.P.; Fuchs, M.; Katis, N.I. Control of viruses infecting grapevine. Adv. Virus Res. 2015, 91, 175–227. [Google Scholar]

| Virus | Primer Name | Sequence (5′–3′) | Target (nt) | Ta °C | Product (bp) |
|---|---|---|---|---|---|
| GVF | GVF-CP-F | CTACTCTTGTTATGCCAGAGGTCTA | 6450–6474 | 52 | 507 |
| GVF-CP-R | AATCAAACATGACCTGCGGTTCT | 6935–6957 | |||
| GVH | GVH-CP-F | GCTATGATGTGCCTATGTATCTCGAA | 6564–6589 | 53 | 424 |
| GVH-CP-R | ACGAGAATTCAGACCTTGGATCACA | 6964–6988 | |||
| GVI | GVI-CP-F | GGAGATAAGGAAGGCAGTCCTACA | 6420–6443 | 55 | 485 |
| GVI-CP-R | GCCTCAGATCGAGTGAGTTTACC | 6883–6905 | |||
| GVM | GVM-CP-F | TTACATTGCTGTGGTGGGCACTTCGA | 6571–6596 | 58 | 391 |
| GVM-CP-R | AGAGTCGTGAATTTAGCCCCTGGATC | 6937–6962 |
| Unique Betaflexivirus Combination | Number of Occurrences |
|---|---|
| GRSPaV, GVA, GVF, GVH, GVI, GVL | 1 |
| GVA, GVB, GVE, GVH, GVM, GVL | 2 |
| GVA, GVB, GVH, GVM, GVL | 1 |
| GRSPaV, GVB, GVH, GVI, GVN | 1 |
| GRSPaV, GVB, GVH, GVI, GVL | 1 |
| GRSPaV, GVB, GVE, GVH, GVL | 1 |
| GRSPaV, GVA, GVE, GVH | 1 |
| GRSPaV, GVA, GVH, GVI | 1 |
| GRSPaV, GVE, GVH, GVL | 1 |
| GRSPaV, GVB, GVI, GVL | 1 |
| GRSPaV, GVB, GVE, GVH | 1 |
| GRSPaV, GVB, GVH, GVN | 1 |
| GRSPaV, GVA, GVH, GVL | 2 |
| GRSPaV, GVA, GVE, GVH | 1 |
| GVA, GVE, GVF, GVL | 1 |
| GVA, GVB, GVH, GVL | 2 |
| GRSPaV, GVB, GVF, GVH | 1 |
| GRSPaV, GVB, GVH, GVL | 3 |
| GRSPaV, GVB, GVE, GVL | 2 |
| GVA, GVB, GVE, GVL | 2 |
| GRSPaV, GVB, GVH, GVL | 3 |
| GRSPaV, GVA, GVH, GVL | 2 |
| GRSPaV, GVA, GVB, GVL | 1 |
| GRSPaV, GVB, GVH, GVL | 4 |
| GRSPaV, GVB, GVF, GVH | 1 |
| GRSPaV, GVB, GVL, GVN | 1 |
| GVB, GVH, GVL | 7 |
| GRSPaV, GVI, GVL | 1 |
| GRSPaV, GVH, GVI | 1 |
| GRSPaV, GVB, GVH | 5 |
| GVA, GVB, GVI | 1 |
| GVA, GVB, GVH | 2 |
| GRSPaV, GVH, GVL | 8 |
| GRSPaV, GVE, GVH | 3 |
| GVH, GVL, GVN | 1 |
| GVE, GVH, GVL | 4 |
| GVA, GVB, GVF | 1 |
| GVA, GVB, GVE | 1 |
| GRSPaV, GVB, GVM | 2 |
| GRSPaV, GVH, GVL | 8 |
| GRSPaV, GVB, GVH | 4 |
| GVA, GVH, GVL | 1 |
| GRSPaV, GVL | 10 |
| GVA, GVL | 1 |
| GVB, GVH | 9 |
| GVB, GVE | 3 |
| GRSPaV, GVB | 6 |
| GVH, GVL | 9 |
| GVE, GVL | 4 |
| GVH, GVI | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Read, D.A.; Thompson, G.D.; Swanevelder, D.Z.H.; Pietersen, G. Metaviromic Characterization of Betaflexivirus Populations Associated with a Vitis cultivar Collection in South Africa. Viruses 2023, 15, 1474. https://doi.org/10.3390/v15071474
Read DA, Thompson GD, Swanevelder DZH, Pietersen G. Metaviromic Characterization of Betaflexivirus Populations Associated with a Vitis cultivar Collection in South Africa. Viruses. 2023; 15(7):1474. https://doi.org/10.3390/v15071474
Chicago/Turabian StyleRead, David A., Genevieve D. Thompson, Dirk Z. H. Swanevelder, and Gerhard Pietersen. 2023. "Metaviromic Characterization of Betaflexivirus Populations Associated with a Vitis cultivar Collection in South Africa" Viruses 15, no. 7: 1474. https://doi.org/10.3390/v15071474
APA StyleRead, D. A., Thompson, G. D., Swanevelder, D. Z. H., & Pietersen, G. (2023). Metaviromic Characterization of Betaflexivirus Populations Associated with a Vitis cultivar Collection in South Africa. Viruses, 15(7), 1474. https://doi.org/10.3390/v15071474

