Glycoprotein Non-Metastatic Melanoma Protein B Restricts PRRSV Replication by Inhibiting Autophagosome-Lysosome Fusion
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. RNA Interference Assay
2.3. Plasmids Construction and Transfection
2.4. Viral Infection and Drug Treatment
2.5. Quantitative PCR(qPCR)
2.6. Western Blot
2.7. Virus Titration
2.8. Confocal Microscopy and Immunofluorescence Analysis (IFA)
2.9. Statistical Analysis
3. Results
3.1. PRRSV Infection Induces GPNMB Downregulation
3.2. Knockdown of Endogenous GPNMB Expression Facilitates PRRSV Infection
3.3. Overexpression of GPNMB Inhibits PRRSV Infection
3.4. GPNMB Induce Autophagosome Formation
3.5. GPNMB Blocks Autophagosome Degradation
3.6. Bafilomycin A1 and Chloroquine Inhibit Virus Replication by Decreasing Autophagosome Degradation
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Neumann, E.J.; Kliebenstein, J.B.; Johnson, C.D.; Mabry, J.W.; Bush, E.J.; Seitzinger, A.H.; Green, A.L.; Zimmerman, J.J. Assessment of the economic impact of porcine reproductive and respiratory syndrome on swine production in the United States. J. Am. Vet. Med. Assoc. 2005, 227, 385–392. [Google Scholar] [CrossRef] [PubMed]
- Kappes, M.A.; Faaberg, K.S. PRRSV structure, replication and recombination: Origin of phenotype and genotype diversity. Virology 2015, 479–480, 475–486. [Google Scholar] [CrossRef] [PubMed]
- Cavanagh, D. Nidovirales: A new order comprising Coronaviridae and Arteriviridae. Arch. Virol. 1997, 142, 629–633. [Google Scholar] [PubMed]
- Han, M.; Yoo, D. Engineering the PRRS virus genome: Updates and perspectives. Vet. Microbiol. 2014, 174, 279–295. [Google Scholar] [CrossRef]
- Meulenberg, J.J.; Hulst, M.M.; de Meijer, E.J.; Moonen, P.L.; den Besten, A.; de Kluyver, E.P.; Wensvoort, G.; Moormann, R.J. Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV. Virology 1993, 192, 62–72. [Google Scholar] [CrossRef]
- Nelsen, C.J.; Murtaugh, M.P.; Faaberg, K.S. Porcine reproductive and respiratory syndrome virus comparison: Divergent evolution on two continents. J. Virol. 1999, 73, 270–280. [Google Scholar] [CrossRef]
- Duan, X.; Nauwynck, H.J.; Pensaert, M.B. Effects of origin and state of differentiation and activation of monocytes/macrophages on their susceptibility to porcine reproductive and respiratory syndrome virus (PRRSV). Arch. Virol. 1997, 142, 2483–2497. [Google Scholar] [CrossRef]
- Klionsky, D.J. Autophagy: From phenomenology to molecular understanding in less than a decade. Nat. Rev. Mol. Cell Biol. 2007, 8, 931–937. [Google Scholar] [CrossRef]
- Klionsky, D.J.; Emr, S.D. Autophagy as a regulated pathway of cellular degradation. Science 2000, 290, 1717–1721. [Google Scholar] [CrossRef]
- Orvedahl, A.; MacPherson, S.; Sumpter, R., Jr.; Tallóczy, Z.; Zou, Z.; Levine, B. Autophagy protects against Sindbis virus infection of the central nervous system. Cell Host Microbe 2010, 7, 115–127. [Google Scholar] [CrossRef]
- Staring, J.; von Castelmur, E.; Blomen, V.A.; van den Hengel, L.G.; Brockmann, M.; Baggen, J.; Thibaut, H.J.; Nieuwenhuis, J.; Janssen, H.; van Kuppeveld, F.J.; et al. PLA2G16 represents a switch between entry and clearance of Picornaviridae. Nature 2017, 541, 412–416. [Google Scholar] [CrossRef]
- Miao, G.; Zhao, H.; Li, Y.; Ji, M.; Chen, Y.; Shi, Y.; Bi, Y.; Wang, P.; Zhang, H. ORF3a of the COVID-19 virus SARS-CoV-2 blocks HOPS complex-mediated assembly of the SNARE complex required for autolysosome formation. Dev. Cell 2021, 56, 427–442.e5. [Google Scholar] [CrossRef]
- Zhou, D.; Spector, S.A. Human immunodeficiency virus type-1 infection inhibits autophagy. AIDS 2008, 22, 695–699. [Google Scholar] [CrossRef]
- Zhou, Z.; Jiang, X.; Liu, D.; Fan, Z.; Hu, X.; Yan, J.; Wang, M.; Gao, G.F. Autophagy is involved in influenza A virus replication. Autophagy 2009, 5, 321–328. [Google Scholar] [CrossRef]
- Gannagé, M.; Dormann, D.; Albrecht, R.; Dengjel, J.; Torossi, T.; Rämer, P.C.; Lee, M.; Strowig, T.; Arrey, F.; Conenello, G.; et al. Matrix protein 2 of influenza A virus blocks autophagosome fusion with lysosomes. Cell Host Microbe 2009, 6, 367–380. [Google Scholar] [CrossRef]
- Wong, J.; Zhang, J.; Si, X.; Gao, G.; Mao, I.; McManus, B.M.; Luo, H. Autophagosome supports coxsackievirus B3 replication in host cells. J. Virol. 2008, 82, 9143–9153. [Google Scholar] [CrossRef]
- Yoon, S.Y.; Ha, Y.E.; Choi, J.E.; Ahn, J.; Lee, H.; Kweon, H.S.; Lee, J.Y.; Kim, D.H. Coxsackievirus B4 uses autophagy for replication after calpain activation in rat primary neurons. J. Virol. 2008, 82, 11976–11978. [Google Scholar] [CrossRef]
- Sun, M.X.; Huang, L.; Wang, R.; Yu, Y.L.; Li, C.; Li, P.P.; Hu, X.C.; Hao, H.P.; Ishag, H.A.; Mao, X. Porcine reproductive and respiratory syndrome virus induces autophagy to promote virus replication. Autophagy 2012, 8, 1434–1447. [Google Scholar] [CrossRef]
- Liu, Q.; Qin, Y.; Zhou, L.; Kou, Q.; Guo, X.; Ge, X.; Yang, H.; Hu, H. Autophagy sustains the replication of porcine reproductive and respiratory virus in host cells. Virology 2012, 429, 136–147. [Google Scholar] [CrossRef]
- Wang, K.; Li, S.; Worku, T.; Hao, X.; Yang, L.; Zhang, S. Rab11a is required for porcine reproductive and respiratory syndrome virus induced autophagy to promote viral replication. Biochem. Biophys. Res. Commun. 2017, 492, 236–242. [Google Scholar] [CrossRef]
- Weterman, M.A.; Ajubi, N.; van Dinter, I.M.; Degen, W.G.; van Muijen, G.N.; Ruitter, D.J.; Bloemers, H.P. nmb, a novel gene, is expressed in low-metastatic human melanoma cell lines and xenografts. Int. J. Cancer 1995, 60, 73–81. [Google Scholar] [CrossRef] [PubMed]
- Saade, M.; de Araujo Souza, G.; Scavone, C.; Kinoshita, P.F. The Role of GPNMB in Inflammation. Front. Immunol. 2021, 12, 674739. [Google Scholar] [CrossRef] [PubMed]
- Rose, A.A.; Grosset, A.A.; Dong, Z.; Russo, C.; Macdonald, P.A.; Bertos, N.R.; St-Pierre, Y.; Simantov, R.; Hallett, M.; Park, M.; et al. Glycoprotein nonmetastatic B is an independent prognostic indicator of recurrence and a novel therapeutic target in breast cancer. Clin. Cancer Res. 2010, 16, 2147–2156. [Google Scholar] [CrossRef] [PubMed]
- Oyewumi, M.O.; Manickavasagam, D.; Novak, K.; Wehrung, D.; Paulic, N.; Moussa, F.M.; Sondag, G.R.; Safadi, F.F. Osteoactivin (GPNMB) ectodomain protein promotes growth and invasive behavior of human lung cancer cells. Oncotarget 2016, 7, 13932–13944. [Google Scholar] [CrossRef] [PubMed]
- Singh, M.; Del Carpio-Cano, F.; Belcher, J.Y.; Crawford, K.; Frara, N.; Owen, T.A.; Popoff, S.N.; Safadi, F.F. Functional roles of osteoactivin in normal and disease processes. Crit. Rev. Eukaryot. Gene Expr. 2010, 20, 341–357. [Google Scholar] [CrossRef]
- Zhou, L.T.; Liu, F.Y.; Li, Y.; Peng, Y.M.; Liu, Y.H.; Li, J. Gpnmb/osteoactivin, an attractive target in cancer immunotherapy. Neoplasma 2012, 59, 1–5. [Google Scholar] [CrossRef]
- Maric, G.; Rose, A.A.; Annis, M.G.; Siegel, P.M. Glycoprotein non-metastatic b (GPNMB): A metastatic mediator and emerging therapeutic target in cancer. OncoTargets Ther. 2013, 6, 839–852. [Google Scholar]
- Wang, T.Y.; Liu, Y.G.; Li, L.; Wang, G.; Wang, H.M.; Zhang, H.L.; Zhao, S.F.; Gao, J.C.; An, T.Q.; Tian, Z.J.; et al. Porcine alveolar macrophage CD163 abundance is a pivotal switch for porcine reproductive and respiratory syndrome virus infection. Oncotarget 2018, 9, 12174–12185. [Google Scholar] [CrossRef]
- Gu, W.; Guo, L.; Yu, H.; Niu, J.; Huang, M.; Luo, X.; Li, R.; Tian, Z.; Feng, L.; Wang, Y. Involvement of CD16 in antibody-dependent enhancement of porcine reproductive and respiratory syndrome virus infection. J. Gen. Virol. 2015, 96 Pt 7, 1712–1722. [Google Scholar] [CrossRef]
- Li, R.; Guo, L.; Gu, W.; Luo, X.; Zhang, J.; Xu, Y.; Tian, Z.; Feng, L.; Wang, Y. Production of porcine TNFα by ADAM17-mediated cleavage negatively regulates porcine reproductive and respiratory syndrome virus infection. Immunol. Res. 2016, 64, 711–720. [Google Scholar] [CrossRef]
- Guo, L.; Niu, J.; Yu, H.; Gu, W.; Li, R.; Luo, X.; Huang, M.; Tian, Z.; Feng, L.; Wang, Y. Modulation of CD163 expression by metalloprotease ADAM17 regulates porcine reproductive and respiratory syndrome virus entry. J. Virol. 2014, 88, 10448–10458. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Guo, L.; Yu, H.; Gu, W.; Luo, X.; Li, R.; Zhang, J.; Xu, Y.; Yang, L.; Shen, N.; Feng, L.; et al. Autophagy Negatively Regulates Transmissible Gastroenteritis Virus Replication. Sci. Rep. 2016, 6, 23864. [Google Scholar] [CrossRef]
- Xu, J.; Zhang, L.; Xu, Y.; Zhang, H.; Gao, J.; Wang, Q.; Tian, Z.; Xuan, L.; Chen, H.; Wang, Y. PP2A Facilitates Porcine Reproductive and Respiratory Syndrome Virus Replication by Deactivating irf3 and Limiting Type I Interferon Production. Viruses 2019, 11, 948. [Google Scholar] [CrossRef]
- Chua, B.H.; Phuektes, P.; Sanders, S.A.; Nicholls, P.K.; McMinn, P.C. The molecular basis of mouse adaptation by human enterovirus 71. J. Gen. Virol. 2008, 89 Pt 7, 1622–1632. [Google Scholar] [CrossRef]
- Li, B.; Castano, A.P.; Hudson, T.E.; Nowlin, B.T.; Lin, S.L.; Bonventre, J.V.; Swanson, K.D.; Duffield, J.S. The melanoma-associated transmembrane glycoprotein Gpnmb controls trafficking of cellular debris for degradation and is essential for tissue repair. FASEB J. 2010, 24, 4767–4781. [Google Scholar]
- Díaz-Troya, S.; Pérez-Pérez, M.E.; Florencio, F.J.; Crespo, J.L. The role of TOR in autophagy regulation from yeast to plants and mammals. Autophagy 2008, 4, 851–865. [Google Scholar] [CrossRef]
- Kimura, S.; Noda, T.; Yoshimori, T. Dissection of the autophagosome maturation process by a novel reporter protein, tandem fluorescent-tagged LC3. Autophagy 2007, 3, 452–460. [Google Scholar] [CrossRef]
- Katayama, H.; Yamamoto, A.; Mizushima, N.; Yoshimori, T.; Miyawaki, A. GFP-like proteins stably accumulate in lysosomes. Cell Struct. Funct. 2008, 33, 1–12. [Google Scholar] [CrossRef]
- Levine, B. Eating oneself and uninvited guests: Autophagy-related pathways in cellular defense. Cell 2005, 120, 159–162. [Google Scholar]
- Kyei, G.B.; Dinkins, C.; Davis, A.S.; Roberts, E.; Singh, S.B.; Dong, C.; Wu, L.; Kominami, E.; Ueno, T.; Yamamoto, A.; et al. Autophagy pathway intersects with HIV-1 biosynthesis and regulates viral yields in macrophages. J. Cell Biol. 2009, 186, 255–268. [Google Scholar] [CrossRef] [PubMed]
- Berkova, Z.; Crawford, S.E.; Trugnan, G.; Yoshimori, T.; Morris, A.P.; Estes, M.K. Rotavirus NSP4 induces a novel vesicular compartment regulated by calcium and associated with viroplasms. J. Virol. 2006, 80, 6061–6071. [Google Scholar] [CrossRef] [PubMed]
- Mohamud, Y.; Shi, J.; Qu, J.; Poon, T.; Xue, Y.C.; Deng, H.; Zhang, J.; Luo, H. Enteroviral Infection Inhibits Autophagic Flux via Disruption of the SNARE Complex to Enhance Viral Replication. Cell Rep. 2018, 22, 3292–3303. [Google Scholar] [CrossRef] [PubMed]
- Ding, B.; Zhang, G.; Yang, X.; Zhang, S.; Chen, L.; Yan, Q.; Xu, M.; Banerjee, A.K.; Chen, M. Phosphoprotein of human parainfluenza virus type 3 blocks autophagosome-lysosome fusion to increase virus production. Cell Host Microbe 2014, 15, 564–577. [Google Scholar] [CrossRef]
- Khakpoor, A.; Panyasrivanit, M.; Wikan, N.; Smith, D.R. A role for autophagolysosomes in dengue virus 3 production in HepG2 cells. J. Gen. Virol. 2009, 90 Pt 5, 1093–1103. [Google Scholar] [CrossRef]
- Ke, P.Y.; Chen, S.S. Activation of the unfolded protein response and autophagy after hepatitis C virus infection suppresses innate antiviral immunity in vitro. J. Clin. Investig. 2011, 121, 37–56. [Google Scholar] [CrossRef]
- Pedersen, K.W.; van der Meer, Y.; Roos, N.; Snijder, E.J. Open reading frame 1a-encoded subunits of the arterivirus replicase induce endoplasmic reticulum-derived double-membrane vesicles which carry the viral replication complex. J. Virol. 1999, 73, 2016–2026. [Google Scholar] [CrossRef]
- Gosert, R.; Kanjanahaluethai, A.; Egger, D.; Bienz, K.; Baker, S.C. RNA replication of mouse hepatitis virus takes place at double-membrane vesicles. J. Virol. 2002, 76, 3697–3708. [Google Scholar] [CrossRef]
- Gadlage, M.J.; Sparks, J.S.; Beachboard, D.C.; Cox, R.G.; Doyle, J.D.; Stobart, C.C.; Denison, M.R. Murine hepatitis virus nonstructural protein 4 regulates virus-induced membrane modifications and replication complex function. J. Virol. 2010, 84, 280–290. [Google Scholar] [CrossRef]
- Beachboard, D.C.; Anderson-Daniels, J.M.; Denison, M.R. Mutations across murine hepatitis virus nsp4 alter virus fitness and membrane modifications. J. Virol. 2015, 89, 2080–2089. [Google Scholar] [CrossRef]
- Snijder, E.J.; Limpens, R.; de Wilde, A.H.; de Jong, A.W.M.; Zevenhoven-Dobbe, J.C.; Maier, H.J.; Faas, F.; Koster, A.J.; Bárcena, M. A unifying structural and functional model of the coronavirus replication organelle: Tracking down RNA synthesis. PLoS Biol. 2020, 18, e3000715. [Google Scholar] [CrossRef]
- Van der Hoeven, B.; Oudshoorn, D.; Koster, A.J.; Snijder, E.J.; Kikkert, M.; Bárcena, M. Biogenesis and architecture of arterivirus replication organelles. Virus Res. 2016, 220, 70–90. [Google Scholar] [CrossRef]
- Wolff, G.; Limpens, R.; Zevenhoven-Dobbe, J.C.; Laugks, U.; Zheng, S.; de Jong, A.W.M.; Koning, R.I.; Agard, D.A.; Grünewald, K.; Koster, A.J.; et al. A molecular pore spans the double membrane of the coronavirus replication organelle. Science 2020, 369, 1395–1398. [Google Scholar] [CrossRef]
- Choi, Y.; Bowman, J.W.; Jung, J.U. Autophagy during viral infection—A double-edged sword. Nat. Rev. Microbiol. 2018, 16, 341–354. [Google Scholar] [CrossRef]
- Corona, A.K.; Saulsbery, H.M.; Corona Velazquez, A.F.; Jackson, W.T. Enteroviruses Remodel Autophagic Trafficking through Regulation of Host SNARE Proteins to Promote Virus Replication and Cell Exit. Cell Rep. 2018, 22, 3304–3314. [Google Scholar] [CrossRef]
- Kemball, C.C.; Alirezaei, M.; Flynn, C.T.; Wood, M.R.; Harkins, S.; Kiosses, W.B.; Whitton, J.L. Coxsackievirus infection induces autophagy-like vesicles and megaphagosomes in pancreatic acinar cells in vivo. J. Virol. 2010, 84, 12110–12124. [Google Scholar] [CrossRef]
- Jackson, W.T.; Giddings, T.H., Jr.; Taylor, M.P.; Mulinyawe, S.; Rabinovitch, M.; Kopito, R.R.; Kirkegaard, K. Subversion of cellular autophagosomal machinery by RNA viruses. PLoS Biol. 2005, 3, e156. [Google Scholar] [CrossRef]






| RNA Oligo Name | Sequence (Positive Strand) (5′–3′) |
|---|---|
| Negative Control | UUCUCCGAACGUGUCACGUTT |
| siRNA-1 | CCAGCCAAGGCCAUCACAATT |
| siRNA-2 | CCACACACUUGGUCAGUAUTT |
| siRNA-3 | CCAUACCUAUGUGCUCAAUTT |
| Primer Name | Primer Sequence (5′–3′) |
|---|---|
| pCAGGS-GPNMB-CDS-F-KpnI | CGGGGTACCATGGAATGTCTCTACTGTTTTCT |
| pCAGGS-GPNMB-CDS-R-XhoI | CCGCTCGAGGTTCTTGAGCAGTGGATCTTTCTCC |
| pLVX-GPNMB-CDS-F-XhoI | CCGCTCGAGATGGAATGTCTCTACTGTTTTCT |
| pLVX-GPNMB-CDS-R-NotI | ATTGCGGCCGCGTTCTTGAGCAGTGGATCTTTCTCC |
| Primer Name | Primer Sequence (5′–3′) |
|---|---|
| PRRSV-ORF7-F | AGATCATCGCCCAACAAAAC |
| PRRSV-ORF7-R | GACACAATTGCCGCTCACTA |
| Porcine-β-actin-F | CTTCCTGGGCATGGAGTCC |
| Porcine-β-actin-R | GGCGCGATGATCTTGATCTTC |
| Porcine-GPNMB-F | CAGGGGAGCATCCCCACGGA |
| Porcine-GPNMB-R | AAGGGTGCTCGTGAGGGCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, Y.; Wang, M.; Zhang, L.; Pan, Y.; Zhang, W.; Ma, W.; Chen, H.; Tang, L.; Xia, C.; Wang, Y. Glycoprotein Non-Metastatic Melanoma Protein B Restricts PRRSV Replication by Inhibiting Autophagosome-Lysosome Fusion. Viruses 2023, 15, 920. https://doi.org/10.3390/v15040920
Xu Y, Wang M, Zhang L, Pan Y, Zhang W, Ma W, Chen H, Tang L, Xia C, Wang Y. Glycoprotein Non-Metastatic Melanoma Protein B Restricts PRRSV Replication by Inhibiting Autophagosome-Lysosome Fusion. Viruses. 2023; 15(4):920. https://doi.org/10.3390/v15040920
Chicago/Turabian StyleXu, Yunfei, Mengjie Wang, Lin Zhang, Yu Pan, Wenli Zhang, Wenjie Ma, Hongyan Chen, Lijie Tang, Changyou Xia, and Yue Wang. 2023. "Glycoprotein Non-Metastatic Melanoma Protein B Restricts PRRSV Replication by Inhibiting Autophagosome-Lysosome Fusion" Viruses 15, no. 4: 920. https://doi.org/10.3390/v15040920
APA StyleXu, Y., Wang, M., Zhang, L., Pan, Y., Zhang, W., Ma, W., Chen, H., Tang, L., Xia, C., & Wang, Y. (2023). Glycoprotein Non-Metastatic Melanoma Protein B Restricts PRRSV Replication by Inhibiting Autophagosome-Lysosome Fusion. Viruses, 15(4), 920. https://doi.org/10.3390/v15040920
