The Identification of Host Proteins That Interact with Non-Structural Proteins-1α and -1β of Porcine Reproductive and Respiratory Syndrome Virus-1
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plasmids
2.2. Primers
2.3. Plasmid Amplification
2.4. Polymerase Chain Reaction
2.5. DNA Purification
2.6. Sanger Sequencing
2.7. Yeast-2-Hybrid Assay
3. Results
3.1. Yeast-2-Hybrid Reveals Novel Interactions with PRRSV-1 NSP1α and NSP1β
3.1.1. Sixty Potential Binding Partners Were Identified in the PRRSV-1 NSP1α y-2-h Screen
3.1.2. One Hundred and Fifteen Potential Binding Partners Were Identified in the PRRSV-1 NSP1β y-2-h Screen
3.2. The Verification of Interactions between PRRSV-1 NSP1α and NSP1β and Selected Host Proteins
3.2.1. PRRSV-1 NSP1α Interacts with DNAJA3, PIAS1 and PIAS2
3.2.2. PRRSV-1 NSP1β Interacts with Twenty-Seven Host Proteins
3.3. A Comparison of the Strength of Selected Confirmed Interactions
3.3.1. PRRSV-1 NSP1α Interacts More Strongly with PIAS1 Than PIAS2 and DNAJA3
3.3.2. PRRSV-1 NSP1β Interacts with TAB3 and CPSF4 on Agar Containing 2.5 mM 3-AT
3.3.3. PRRSV-1 SU1-Bel NSP1α Interacts with PIAS1 Equally as Strongly as PRRSV-1 215-06 NSP1α
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [PubMed]
- Holtkamp, D.J.; Kliebenstein, J.B.; Neumann, E.J.; Zimmerman, J.J.; Rotto, H.F.; Yoder, T.K.; Wang, C.; Yeske, P.E.; Mowrer, C.L.; Haley, C.A. Assessment of the Economic Impact of Porcine Reproductive and Respiratory Syndrome Virus on United States Pork Producers. J. Swine Health Prod. 2013, 21, 72–84. [Google Scholar]
- de Paz, X. Pig333.Com. 2015, pp. 2013–2016. Available online: https://www.pig333.com/articles/prrs-cost-for-the-european-swine-industry_10069/ (accessed on 12 December 2023).
- Albina, E.; Carrat, C.; Charley, B. Interferon-α Response to Swine Arterivirus (PoAV), the Porcine Reproductive and Respiratory Syndrome Virus. J. Interferon Cytokine Res. 1998, 18, 485–490. [Google Scholar] [CrossRef] [PubMed]
- Morgan, S.B.; Frossard, J.P.; Pallares, F.J.; Gough, J.; Stadejek, T.; Graham, S.P.; Steinbach, F.; Drew, T.W.; Salguero, F.J. Pathology and Virus Distribution in the Lung and Lymphoid Tissues of Pigs Experimentally Inoculated with Three Distinct Type 1 PRRS Virus Isolates of Varying Pathogenicity. Transbound. Emerg. Dis. 2016, 63, 285–295. [Google Scholar] [CrossRef] [PubMed]
- Rossow, K.D. Porcine Reproductive and Respiratory Syndrome. Vet. Pathol. 1998, 35, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Zimmerman, J.J.; Karriker, L.A.; Ramirez, A.; Schwartz, K.J.; Stevenson, G.W. Diseases of Swine, 10th ed.; John Wiley & Sons: Hoboken, NJ, USA, 2012. [Google Scholar]
- Han, K.; Seo, H.W.; Oh, Y.; Kang, I.; Park, C.; Chae, C. Comparison of the Virulence of European and North American Genotypes of Porcine Reproductive and Respiratory Syndrome Virus in Experimentally Infected Pigs. Vet. J. 2013, 195, 313–318. [Google Scholar] [CrossRef]
- Choi, K.; Lee, J.; Park, C.; Jeong, J.; Chae, C. Comparison of the Pathogenesis of Single or Dual Infections with Type 1 and Type 2 Porcine Reproductive and Respiratory Syndrome Virus. J. Comp. Pathol. 2015, 152, 317–324. [Google Scholar] [CrossRef]
- Karniychuk, U.U.; Geldhof, M.; Vanhee, M.; Van Doorsselaere, J.; Saveleva, T.A.; Nauwynck, H.J. Pathogenesis and Antigenic Characterization of a New East European Subtype 3 Porcine Reproductive and Respiratory Syndrome Virus Isolate. BMC Vet. Res. 2010, 6, 30. [Google Scholar] [CrossRef]
- Zuckermann, F.A.; Garcia, E.A.; Luque, I.D.; Christopher-Hennings, J.; Doster, A.; Brito, M.; Osorio, F. Assessment of the Efficacy of Commercial Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) Vaccines Based on Measurement of Serologic Response, Frequency of Gamma-IFN-Producing Cells and Virological Parameters of Protection upon Challenge. Vet. Microbiol. 2007, 123, 69–85. [Google Scholar] [CrossRef]
- Wang, A.; Chen, Q.; Wang, L.; Madson, D.; Harmon, K.; Gauger, P.; Zhang, J.; Li, G. Recombination between Vaccine and Field Strains of Porcine Reproductive and Respiratory Syndrome Virus. Emerg. Infect. Dis. 2019, 25, 2335–2337. [Google Scholar] [CrossRef]
- Dokland, T. The Structural Biology of PRRSV. Virus Res. 2010, 154, 86–97. [Google Scholar] [CrossRef] [PubMed]
- Snijder, E.J.; Kikkert, M.; Fang, Y. Arterivirus Molecular Biology and Pathogenesis. J. Gen. Virol. 2013, 94, 2141–2163. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.; Oh, T.; Cho, H.; Chae, C. A Comparison of Commercial Modified-Live PRRSV-1 and PRRSV-2 Vaccines against a Dual Heterologous PRRSV-1 and PRRSV-2 Challenge in Late Term Pregnancy Gilts. Comp. Immunol. Microbiol. Infect. Dis. 2020, 69, 101423. [Google Scholar] [CrossRef] [PubMed]
- Rascón-Castelo, E.; Burgara-Estrella, A.; Mateu, E.; Hernández, J. Immunological Features of the Non-Structural Proteins of Porcine Reproductive and Respiratory Syndrome Virus. Viruses 2015, 7, 873–886. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Zhang, J.; Zeng, J.; Yin, S.; Li, Y.; Zheng, L.; Guo, X.; Ge, X.; Yang, H. The 30-Amino-Acid Deletion in the Nsp2 of Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus Emerging in China Is Not Related to Its Virulence. J. Virol. 2009, 83, 5156–5167. [Google Scholar] [CrossRef] [PubMed]
- den Boon, J.A.; Faaberg, K.S.; Meulenberg, J.J.; Wassenaar, A.L.; Plagemann, P.G.; Gorbalenya, A.E.; Snijder, E.J. Processing and Evolution of the N-Terminal Region of the Arterivirus Replicase ORF1a Protein: Identification of Two Papainlike Cysteine Proteases. J. Virol. 1995, 69, 4500–4505. [Google Scholar] [CrossRef] [PubMed]
- Kroese, M.V.; Zevenhoven-Dobbe, J.C.; Bos-de Ruijter, J.N.A.; Peeters, B.P.H.; Meulenberg, J.J.M.; Cornelissen, L.A.H.M.; Snijder, E.J. The Nsp 1alpha and Nsp 1beta Papain-like Autoproteinases Are Essential for Porcine Reproductive and Respiratory Syndrome Virus RNA Synthesis. J. Gen. Virol. 2008, 89, 494–499. [Google Scholar] [CrossRef]
- Li, Y.; Treffers, E.E.; Napthine, S.; Tas, A.; Zhu, L.; Sun, Z.; Bell, S.; Mark, B.L.; van Veelen, P.A.; van Hemert, M.J.; et al. Transactivation of Programmed Ribosomal Frameshifting by a Viral Protein. Proc. Natl. Acad. Sci. USA 2014, 111, E2172–E2181. [Google Scholar] [CrossRef]
- Du, J.; Ge, X.; Liu, Y.; Jiang, P.; Wang, Z.; Zhang, R.; Zhou, L.; Guo, X.; Han, J.; Yang, H. Targeting Swine Leukocyte Antigen Class I Molecules for Proteasomal Degradation by the Nsp1α Replicase Protein of the Chinese Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus Strain JXwn06. J. Virol. 2016, 90, 682–693. [Google Scholar] [CrossRef]
- Han, M.; Du, Y.; Song, C.; Yoo, D. Degradation of CREB-Binding Protein and Modulation of Type I Interferon Induction by the Zinc Finger Motif of the Porcine Reproductive and Respiratory Syndrome Virus Nsp1alpha Subunit. Virus Res. 2013, 172, 54–65. [Google Scholar] [CrossRef]
- Jing, H.; Fang, L.; Ding, Z.; Wang, D.; Hao, W.; Gao, L.; Ke, W.; Chen, H.; Xiao, S. Porcine Reproductive and Respiratory Syndrome Virus Nsp1α Inhibits NF-ΚB Activation by Targeting Linear Ubiquitin Chain Assembly Complex (LUBAC). J. Virol. 2016, 91, JVI.01911-16. [Google Scholar] [CrossRef] [PubMed]
- Subramaniam, S.; Kwon, B.; Beura, L.K.; Kuszynski, C.A.; Pattnaik, A.K.; Osorio, F.A. Porcine Reproductive and Respiratory Syndrome Virus Non-Structural Protein 1 Suppresses Tumor Necrosis Factor-Alpha Promoter Activation by Inhibiting NF-ΚB and Sp1. Virology 2010, 406, 270–279. [Google Scholar] [CrossRef] [PubMed]
- Han, M.; Ke, H.; Zhang, Q.; Yoo, D. Nuclear Imprisonment of Host Cellular MRNA by Nsp1β Protein of Porcine Reproductive and Respiratory Syndrome Virus. Virology 2017, 505, 42–55. [Google Scholar] [CrossRef] [PubMed]
- He, Q.; Li, Y.; Zhou, L.; Ge, X.; Guo, X.; Yang, H. Both Nsp1beta and Nsp11 Are Responsible for Differential TNF-Alpha Production Induced by Porcine Reproductive and Respiratory Syndrome Virus Strains with Different Pathogenicity In Vitro. Virus Res. 2015, 201, 32–40. [Google Scholar] [CrossRef] [PubMed]
- Kim, O.; Sun, Y.; Lai, F.W.; Song, C.; Yoo, D. Modulation of Type I Interferon Induction by Porcine Reproductive and Respiratory Syndrome Virus and Degradation of CREB-Binding Protein by Non-Structural Protein 1 in MARC-145 and HeLa Cells. Virology 2010, 402, 315–326. [Google Scholar] [CrossRef]
- Beura, L.K.; Sarkar, S.N.; Kwon, B.; Subramaniam, S.; Jones, C.; Pattnaik, A.K.; Osorio, F.A. Porcine Reproductive and Respiratory Syndrome Virus Nonstructural Protein 1beta Modulates Host Innate Immune Response by Antagonizing IRF3 Activation. J. Virol. 2010, 84, 1574–1584. [Google Scholar] [CrossRef]
- Miskin, J.E.; Abrams, C.C.; Goatley, L.C.; Dixon, L.K. A Viral Mechanism for Inhibition of the Cellular Phosphatase Calcineurin. Science 1998, 281, 562–565. [Google Scholar] [CrossRef]
- Morgan, S.B.; Graham, S.P.; Salguero, F.J.; Sánchez Cordón, P.J.; Mokhtar, H.; Rebel, J.M.J.; Weesendorp, E.; Bodman-Smith, K.B.; Steinbach, F.; Frossard, J.P. Increased Pathogenicity of European Porcine Reproductive and Respiratory Syndrome Virus Is Associated with Enhanced Adaptive Responses and Viral Clearance. Vet. Microbiol. 2013, 163, 13–22. [Google Scholar] [CrossRef]
- Zhang, H.; Fang, L.; Zhu, X.; Wang, D.; Xiao, S. Global Analysis of Ubiquitome in PRRSV-Infected Pulmonary Alveolar Macrophages. J. Proteom. 2018, 184, 16–24. [Google Scholar] [CrossRef]
- Ke, H.; Han, M.; Kim, J.; Gustin, K.E.; Yoo, D. Porcine Reproductive and Respiratory Syndrome Virus Nonstructural Protein 1 Beta Interacts with Nucleoporin 62 to Promote Viral Replication and Immune Evasion. J. Virol. 2019, 93, 10–1128. [Google Scholar] [CrossRef]
- Yang, L.; Wang, R.; Ma, Z.; Xiao, Y.; Nan, Y.; Wang, Y.; Lin, S.; Zhang, Y.-J. Porcine Reproductive and Respiratory Syndrome Virus Antagonizes JAK/STAT3 Signaling via Nsp5, Which Induces STAT3 Degradation. J. Virol. 2017, 91, 2087–2103. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Yu, Y.-Y.; Wang, H.-Y.; Wang, J.-F.; He, X.-J. The IFN-γ-Induced Immunoproteasome Is Suppressed in Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus-Infected Alveolar Macrophages. Vet. Immunol. Immunopathol. 2020, 226, 110069. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, D.; Müller, S. Members of the PIAS Family Act as SUMO Ligases for C-Jun and P53 and Repress P53 Activity. Proc. Natl. Acad. Sci. USA 2002, 99, 2872–2877. [Google Scholar] [CrossRef] [PubMed]
- Kahyo, T.; Nishida, T.; Yasuda, H. Involvement of PIAS1 in the Sumoylation of Tumor Suppressor P53. Mol. Cell 2001, 8, 713–718. [Google Scholar] [CrossRef] [PubMed]
- Trinh, D.L.N.; Elwi, A.N.; Kim, S.W. Direct Interaction between P53 and Tid1 Proteins Affects P53 Mitochondrial Localization and Apoptosis. Oncotarget 2010, 1, 396. [Google Scholar] [CrossRef] [PubMed]
- Nan, Y.; Wu, C.; Gu, G.; Sun, W.; Zhang, Y.J.; Zhou, E.M. Improved Vaccine against PRRSV: Current Progress and Future Perspective. Front. Microbiol. 2017, 8, 1635. [Google Scholar] [CrossRef]
- Wang, R.; Nan, Y.; Yu, Y.; Zhang, Y.-J. Porcine Reproductive and Respiratory Syndrome Virus Nsp1β Inhibits Interferon-Activated JAK/STAT Signal Transduction by Inducing Karyopherin-1 Degradation. J. Virol. 2013, 87, 5219–5228. [Google Scholar] [CrossRef]
- Sun, Y.; Han, M.; Kim, C.; Calvert, J.G.; Yoo, D. Interplay between Interferon-Mediated Innate Immunity and Porcine Reproductive and Respiratory Syndrome Virus. Viruses 2012, 4, 424–446. [Google Scholar] [CrossRef]
- Beura, L.K.; Dinh, P.X.; Osorio, F.A.; Pattnaik, A.K. Cellular Poly(C) Binding Proteins 1 and 2 Interact with Porcine Reproductive and Respiratory Syndrome Virus Nonstructural Protein 1 and Support Viral Replication. J. Virol. 2011, 85, 12939–12949. [Google Scholar] [CrossRef]
- Zhang, W.; Chen, K.; Zhang, X.; Guo, C.; Chen, Y.; Liu, X. An Integrated Analysis of Membrane Remodeling during Porcine Reproductive and Respiratory Syndrome Virus Replication and Assembly. PLoS ONE 2018, 13, e0200919. [Google Scholar] [CrossRef]
- Ke, H.; Lee, S.; Kim, J.; Liu, H.C.; Yoo, D. Interaction of PIAS1 with PRRS Virus Nucleocapsid Protein Mediates NF-ΚB Activation and Triggers Proinflammatory Mediators during Viral Infection. Sci. Rep. 2019, 9, 11042. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Wang, R.; Yang, S.; Ma, Z.; Lin, S.; Nan, Y.; Li, Q.; Tang, Q.; Zhang, Y.-J. Karyopherin Alpha 6 Is Required for Replication of Porcine Reproductive and Respiratory Syndrome Virus and Zika Virus. J. Virol. 2018, 92, e00072-18. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.; Cao, X. Regulation of Stat3 Nuclear Import by Importin A5 and Importin A7 via Two Different Functional Sequence Elements. Cell. Signal. 2006, 18, 1117–1126. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Guo, X.; Ge, X.; Chen, Y.; Sun, Q.; Yang, H. Changes in the Cellular Proteins of Pulmonary Alveolar Macrophage Infected with Porcine Reproductive and Respiratory Syndrome Virus by Proteomics Analysis. J. Proteome Res. 2009, 8, 3091–3097. [Google Scholar] [CrossRef]
- Hicke, L. Protein Regulation by Monoubiquitin. Nat. Rev. Mol. Cell Biol. 2001, 2, 195–201. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, K. The Proteasome: Overview of Structure and Functions. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 2009, 85, 12. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Chen, Z.J. Regulation of NF-κB by Ubiquitination. Curr. Opin. Immunol. 2012, 25, 4–12. [Google Scholar] [CrossRef]
- Pang, Y.; Li, M.; Zhou, Y.; Liu, W.; Tao, R.; Zhang, H.; Xiao, S.; Fang, L. The Ubiquitin Proteasome System Is Necessary for Efficient Proliferation of Porcine Reproductive and Respiratory Syndrome Virus. Vet. Microbiol. 2021, 253, 108947. [Google Scholar] [CrossRef]
- Furukawa, M.; He, Y.J.; Borchers, C.; Xiong, Y. Targeting of Protein Ubiquitination by BTB–Cullin 3–Roc1 Ubiquitin Ligases. Nat. Cell Biol. 2003, 5, 1001–1007. [Google Scholar] [CrossRef]
- Sarikas, A.; Hartmann, T.; Pan, Z.Q. The Cullin Protein Family. Genome Biol. 2011, 12, 220. [Google Scholar] [CrossRef]
- Kloetzel, P.M. Antigen Processing by the Proteasome. Nat. Rev. Mol. Cell Biol. 2001, 2, 179–188. [Google Scholar] [CrossRef] [PubMed]
- Yi, H.; Wang, Q.; Lu, L.; Ye, R.; Xie, E.; Yu, Z.; Sun, Y.; Chen, Y.; Cai, M.; Qiu, Y.; et al. PSMB4 Degrades the Porcine Reproductive and Respiratory Syndrome Virus Nsp1α Protein via the Autolysosome Pathway and Induces the Production of Type I Interferon. J. Virol. 2023, 97. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Cattaneo, A.; Gobert, F.X.; Müller, M.; Toscano, F.; Flores, M.; Lescure, A.; Del Nery, E.; Benaroch, P. Cleavage of Toll-like Receptor 3 by Cathepsins B and H Is Essential for Signaling. Proc. Natl. Acad. Sci. USA 2012, 109, 9053–9058. [Google Scholar] [CrossRef] [PubMed]
- Shuai, K.; Liu, B. Regulation of Gene-Activation Pathways by PIAS Proteins in the Immune System. Nat. Rev. Immunol. 2005, 5, 593–605. [Google Scholar] [CrossRef] [PubMed]
- Liu, B.; Yang, R.; Wong, K.A.; Getman, C.; Stein, N.; Teitell, M.A.; Cheng, G.; Wu, H.; Shuai, K. Negative Regulation of NF-KappaB Signaling by PIAS1. Mol. Cell. Biol. 2005, 25, 1113–1123. [Google Scholar] [CrossRef] [PubMed]
- Shuai, K. Regulation of Cytokine Signaling Pathways by PIAS Proteins. Cell Res. 2006, 16, 196–202. [Google Scholar] [CrossRef] [PubMed]
- Kanayama, A.; Seth, R.B.; Sun, L.; Ea, C.-K.; Hong, M.; Shaito, A.; Chiu, Y.-H.; Deng, L.; Chen, Z.J. TAB2 and TAB3 Activate the NF-ΚB Pathway through Binding to Polyubiquitin Chains. Mol. Cell 2004, 15, 535–548. [Google Scholar] [CrossRef]
- Li, R.; Chen, C.; He, J.; Zhang, L.; Zhang, L.; Guo, Y.; Zhang, W.; Tan, K.; Huang, J. E3 Ligase ASB8 Promotes Porcine Reproductive and Respiratory Syndrome Virus Proliferation by Stabilizing the Viral Nsp1α Protein and Degrading Host IKKβ Kinase. Virology 2019, 532, 55–68. [Google Scholar] [CrossRef]
- Chen, J.; Wang, D.; Sun, Z.; Gao, L.; Zhu, X.; Guo, J.; Xu, S.; Fang, L.; Li, K.; Xiao, S. Arterivirus Nsp4 Antagonizes Interferon Beta Production by Proteolytically Cleaving NEMO at Multiple Sites. J. Virol. 2019, 93, 385–404. [Google Scholar] [CrossRef]
- Shi, X.; Wang, L.; Li, X.; Zhang, G.; Guo, J.; Zhao, D.; Chai, S.; Deng, R. Endoribonuclease Activities of Porcine Reproductive and Respiratory Syndrome Virus Nsp11 Was Essential for Nsp11 to Inhibit IFN-β Induction. Mol. Immunol. 2011, 48, 1568–1572. [Google Scholar] [CrossRef]
- Sun, M.-X.; Huang, L.; Wang, R.; Yu, Y.-L.; Li, C.; Li, P.-P.; Hu, X.-C.; Hao, H.-P.; Ishag, H.A.; Mao, X. Porcine Reproductive and Respiratory Syndrome Virus Induces Autophagy to Promote Virus Replication. Autophagy 2012, 8, 1434–1447. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Chen, K.; Guo, Y.; Chen, Y.; Liu, X. Involvement of PRRSV NSP3 and NSP5 in the Autophagy Process. Virol. J. 2019, 16, 13. [Google Scholar] [CrossRef] [PubMed]
- Kang, R.; Zeh, H.J.; Lotze, M.T.; Tang, D. The Beclin 1 Network Regulates Autophagy and Apoptosis. Cell Death Differ. 2011, 18, 571–580. [Google Scholar] [CrossRef] [PubMed]
- Niso-Santano, M.; Criollo, A.; Malik, S.A.; Michaud, M.; Morselli, E.; Mariño, G.; Lachkar, S.; Galluzzi, L.; Maiuri, M.C.; Kroemer, G. Direct Molecular Interactions between Beclin 1 and the Canonical NFκB Activation Pathway. Autophagy 2012, 8, 268–270. [Google Scholar] [CrossRef]
- Qi, P.; Liu, K.; Wei, J.; Li, Y.; Li, B.; Shao, D.; Wu, Z.; Shi, Y.; Tong, G.; Qiu, Y.; et al. Nonstructural Protein 4 of Porcine Reproductive and Respiratory Syndrome Virus Modulates Cell Surface Swine Leukocyte Antigen Class I Expression by Downregulating Β2-Microglobulin Transcription. J. Virol. 2017, 91, e01755-16. [Google Scholar] [CrossRef]



| Primer Name | Sequence (5′ to 3′) |
|---|---|
| pGADT7 F | AACCACTGTCACCTGGTTG |
| pGADT7 R | ACAGTTGAAGTGAACTTGC |
| 215-06 NSP1α F | GCGCATATGTCTGGGACGTTCTCC |
| 215-06 NSP1α R | GCGGAATTCTTAATGAGCCTCTTC |
| 215-06 NSP1β F | GCGCATATGTCCAGCGTGTACAGGTG |
| 215-06 NSP1β R | GCGGAATTCTTAATACCACTTATG |
| SU1-Bel NSP1α F | GCGCATATGTCTGGGACGTTCTCC |
| SU1-Bel NSP1α R | GCGGAATTCTTAGTGGGCTTCCTC |
| SU1-Bel NSP1β F | GCGCATATGTCTGATGTGTATAAATG |
| SU1-Bel NSP1β R | GCGGAATTCTTAATACCACCTATG |
| No. | AC # | Protein * | Function | Interacting Amino Acid Region |
|---|---|---|---|---|
| 1 | XP_003354674.1 | DNAJ homolog subfamily A member 3 (DNAJA3) | Molecular chaperone protein that binds and activates Hsp70 chaperone proteins to perform protein folding, degradation, and complex assembly. Also involved in maintaining mitochondrial DNA and membrane potential. | 175–453 |
| 2 | XP_020948317.1 | E3 SUMO-protein ligase PIAS2 (PIAS2) | SUMO E3 ligase that regulates transcription factors, including STATs and NF-κB. | 352–542 |
| 3 | XP_003121797 | E3 SUMO-protein ligase PIAS1 (PIAS1) | SUMO E3 ligase that regulates transcription factors, including STATs and NF-κB. | 383–595 |
| No. | AC # | Protein * | Function | Interacting Amino Acid Region |
|---|---|---|---|---|
| 1 | NP_001231384.1 | Proteasome subunit beta type-4 (PSMB4) | Non-catalytic subunit of the 20S proteasome complex. | 1–264 |
| 2 | AEX59168.1 | MHC class II antigen, (MHC class II) | Antigen presentation | 9–98 |
| 3 | XP_020936488.1 | TGF-beta-activated kinase 1 and MAP3K7-binding protein 3 (TAB3) | Regulates both the NF-κB pathway and autophagy. | 414–701 |
| 4 | BAM75557.1 | IgG heavy chain precursor | The large polypeptide subunit of an antibody. | 130–459 |
| 5 | ACL97681.1 | Toll-like receptor 4 (TLR4) | Pattern recognition receptor. | 24–100 |
| 6 | XP_020951815.1 | Collectin-12 | Soluble pattern recognition receptor that activates the alternative pathway of complement. | 533–737 |
| 7 | NP_001038045.1 | Signal transducer and activator of transcription 3 (STAT3) | Transcription factor activated in response to cytokines and growth factors. | 1–165 |
| 8 | NP_001090927.1 | Cathepsin B precursor | Lysosomal cysteine protease that functions in intracellular proteolysis. | 44–327 |
| 9 | XM_021062561.1 | p21 (RAC1) activated kinase 1 (PAK1) | Protein kinase involved in intracellular signalling pathways downstream of integrins and receptor-type kinases. | 76–179 |
| 10 | XP_003122270.2 | Nucleoporin GLE1 (GLE1) | RNA export mediator. Also involved in transcription termination and translation initiation and termination. | 1–202 |
| 11 | XP_003123013.1 | Proteasome subunit alpha type-1 (PSMA1) | Non-catalytic subunit of the 20S proteasome complex. | 74–263 |
| 12 | XP_020946779.1 | CD163 | Receptor involved in clearance and endocytosis of haemoglobin/haptoglobin complexes by macrophages. | 97–370 |
| 13 | XP_013834181.1 | Mediator of RNA polymerase II transcription subunit 4 (MED4) | Component of the mediator complex involved in regulating RNA polymerase II-dependent transcription. | 1–104 |
| 14 | AY792822.1 | Cathepsin D protein | Lysosomal aspartic endo-protease that degrades proteins and activates protein precursors. | 151–395 |
| 15 | CAN13318.1 | Proteasome subunit, beta type 8 (PSMB8) | Catalytic subunit of the immunoproteasome. | 37–208 |
| 16 | XP_001929303.2 | Cullin-9 | Hydrophobic protein that provides a scaffold for ubiquitin ligases. | 296–458 |
| 17 | NP_001090889.1 | Endothelial PAS domain-containing protein 1 (EPAS-1) | Hypoxia-inducible transcription factor. | 104–558 |
| 18 | XP_020934777.1 | MyoD family inhibitor domain-containing protein (MDFIC) | Acts as a transcriptional activator or repressor. | 110–242 |
| 19 | XP_013836386.1 | Beclin-1 | Regulates both autophagy and apoptosis. | 5–448 |
| 20 | ACB70169.1 | Cathepsin H | Lysosomal cysteine proteinase important in the overall degradation of lysosomal proteins. | 19–235 |
| 21 | XP_020941778.1 | Cleavage and polyadenylation specificity factor subunit 4 (CPSF4) | Component of the cleavage and polyadenylation specificity factor (CPSF) complex that functions in pre-mRNA 3′-end formation. | 2–213 |
| 22 | XP_013833352.2 | Nucleoprotein TPR (TPR) | Component of the nuclear pore complex that regulates mRNA export via the NXF1:NXT1 pathway. | 458–554 |
| 23 | NP_001070681.1 | Macrophage migration inhibitory factor (MIF) | Binds to CD74 on immune cells to trigger an acute immune response. | 1–67 |
| 24 | XP_005656773.1 | Kelch-like protein 20 | Component of the (BTB-CUL3-RBX1) E3 ubiquitin–protein ligase complex. | 1–193 |
| 25 | XP_020925047.1 | Nuclear pore membrane glycoprotein 210 (NUP210) | Nucleoporin essential for nuclear pore assembly and fusion, nuclear pore spacing, as well as structural integrity. | 655–721 |
| 26 | NP_999472.1 | 10 kDa heat shock protein, mitochondrial (HSP10) | HSPs are chaperones with roles in folding/unfolding of proteins. | 1–102 |
| 27 | XP_020942083.1 | Major vault protein (MVP) | Multi-subunit structures that may be involved in nucleo-cytoplasmic transport. | 1–179 |
| Protein Combination | No 3-AT | 2.5 mM | 5 mM | 10 mM | 20 mM | 60 mM |
|---|---|---|---|---|---|---|
| NSP1α + PIAS1 | + | + | + | + | + | + |
| PIAS1 + p53 | + | + | + | + | + | + |
| NSP1α + PIAS2 | + | + | + | + | - | - |
| PIAS2 + p53 | + | + | + | + | - | - |
| NSP1α + DNAJA3 | + | - | - | - | - | - |
| DNAJA3 + p53 | + | - | - | - | - | - |
| NSP1β + TAB3 | + | + | - | - | - | - |
| NSP1β + CPSF4 | + | + | - | - | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Riccio, S.; Childs, K.; Jackson, B.; Graham, S.P.; Seago, J. The Identification of Host Proteins That Interact with Non-Structural Proteins-1α and -1β of Porcine Reproductive and Respiratory Syndrome Virus-1. Viruses 2023, 15, 2445. https://doi.org/10.3390/v15122445
Riccio S, Childs K, Jackson B, Graham SP, Seago J. The Identification of Host Proteins That Interact with Non-Structural Proteins-1α and -1β of Porcine Reproductive and Respiratory Syndrome Virus-1. Viruses. 2023; 15(12):2445. https://doi.org/10.3390/v15122445
Chicago/Turabian StyleRiccio, Sofia, Kay Childs, Ben Jackson, Simon P. Graham, and Julian Seago. 2023. "The Identification of Host Proteins That Interact with Non-Structural Proteins-1α and -1β of Porcine Reproductive and Respiratory Syndrome Virus-1" Viruses 15, no. 12: 2445. https://doi.org/10.3390/v15122445
APA StyleRiccio, S., Childs, K., Jackson, B., Graham, S. P., & Seago, J. (2023). The Identification of Host Proteins That Interact with Non-Structural Proteins-1α and -1β of Porcine Reproductive and Respiratory Syndrome Virus-1. Viruses, 15(12), 2445. https://doi.org/10.3390/v15122445

