GEM-PA-Based Subunit Vaccines of Crimean Congo Hemorrhagic Fever Induces Systemic Immune Responses in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Construction and Expression of Recombinant Baculoviruses
2.2. Expression of CCHFV GPLP3 Fusion Protein
2.3. Production of GEM and binding GPLP3 proteins to Immunobiotic G-GP
2.4. SDS-PAGE, Western Blot and Immuno-Electron Microscope (IEM) Identification of the Binding GEM Particles
2.5. Immunization of Mice
2.6. Virus-Specific IgG and Subtype Detection
2.7. Neutralization Assay
2.8. IFN-γ and IL-4 Cytokine Detection
2.9. Cytokine Measurement of Splenocyte Culture Supernatants
2.10. Data Analysis
3. Results
3.1. Generation of Recombinant Baculovirus and Expression of CCHFV-eGNLP3, CCHFV-eGCLP3 and CCHFV-NAbLP3 Fusion Proteins
3.2. Location of Fusion Proteins on GEM Particles
3.3. Binding Activity of Fusion Proteins on GEM Particles
3.4. Virus-Specific IgG and Subtype
3.5. Virus Neutralization Assay
3.6. Antigen-Specific Cellular Immune Responses
3.7. Cytokine Secretion by Restimulated Splenocytes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Whitehouse, C.A. Crimean-Congo hemorrhagic fever. Antivir. Res. 2004, 64, 145–160. [Google Scholar] [CrossRef] [PubMed]
- Barnwal, B.; Karlberg, H.; Mirazimi, A.; Tan, Y.J. The Non-structural Protein of Crimean-Congo Hemorrhagic Fever Virus Disrupts the Mitochondrial Membrane Potential and Induces Apoptosis. J. Biol. Chem. 2016, 291, 582–592. [Google Scholar] [CrossRef] [PubMed]
- Vincent, M.J.; Sanchez, A.J.; Erickson, B.R.; Basak, A.; Chretien, M.; Seidah, N.G.; Nichol, S.T. Crimean-Congo hemorrhagic fever virus glycoprotein proteolytic processing by subtilase SKI-1. J. Virol. 2003, 77, 8640–8649. [Google Scholar] [CrossRef] [PubMed]
- Bergeron, E.; Vincent, M.J.; Nichol, S.T. Crimean-Congo hemorrhagic fever virus glycoprotein processing by the endoprotease SKI-1/S1P is critical for virus infectivity. J. Virol. 2007, 81, 13271–13276. [Google Scholar] [CrossRef] [PubMed]
- Bertolotti-Ciarlet, A.; Smith, J.; Strecker, K.; Paragas, J.; Altamura, L.A.; McFalls, J.M.; Frias-Staheli, N.; Garcia-Sastre, A.; Schmaljohn, C.S.; Doms, R.W. Cellular localization and antigenic characterization of crimean-congo hemorrhagic fever virus glycoproteins. J. Virol. 2005, 79, 6152–6161. [Google Scholar] [CrossRef] [PubMed]
- Conger, N.G.; Paolino, K.M.; Osborn, E.C.; Rusnak, J.M.; Gunther, S.; Pool, J.; Rollin, P.E.; Allan, P.F.; Schmidt-Chanasit, J.; Rieger, T.; et al. Health care response to CCHF in US soldier and nosocomial transmission to health care providers, Germany, 2009. Emerg. Infect. Dis. 2015, 21, 23–31. [Google Scholar] [CrossRef]
- Spengler, J.R.; Bergeron, E.; Rollin, P.E. Seroepidemiological Studies of Crimean-Congo Hemorrhagic Fever Virus in Domestic and Wild Animals. PLoS Negl. Trop. Dis. 2016, 10, e0004210. [Google Scholar] [CrossRef]
- Capua, I. Crimean-Congo haemorrhagic fever in ostriches: A public health risk for countries of the European Union? Avian. Pathol. 1998, 27, 117–120. [Google Scholar] [CrossRef]
- Shepherd, A.J.; Swanepoel, R.; Leman, P.A.; Shepherd, S.P. Field and laboratory investigation of Crimean-Congo haemorrhagic fever virus (Nairovirus, family Bunyaviridae) infection in birds. Trans. R. Soc. Trop. Med. Hyg. 1987, 81, 1004–1007. [Google Scholar] [CrossRef]
- Papa, A.; Sidira, P.; Kallia, S.; Ntouska, M.; Zotos, N.; Doumbali, E.; Maltezou, H.C.; Demiris, N.; Tsatsaris, A. Factors associated with IgG positivity to Crimean-Congo hemorrhagic fever virus in the area with the highest seroprevalence in Greece. Ticks Tick Borne Dis. 2013, 4, 417–420. [Google Scholar] [CrossRef]
- Chumakov, M.; Vafakulov, K.B.; Zavodova, T. Cases of transmission of Crimean hemorrhagic fever virus in Uzbekistan by contacts with blood of a sick cow and a human patient as well as by tick bites (Russian). Proc. Inst. Polios. Viral Enceph. Acad. Med. Sci. CCR 1974, 22, 29–34. [Google Scholar]
- Nabeth, P.; Cheikh, D.O.; Lo, B.; Faye, O.; Vall, I.O.; Niang, M.; Wague, B.; Diop, D.; Diallo, M.; Diallo, B.; et al. Crimean-Congo hemorrhagic fever, Mauritania. Emerg. Infect. Dis. 2004, 10, 2143–2149. [Google Scholar] [CrossRef] [PubMed]
- Humolli, I.; Dedushaj, I.; Zupanac, T.A.; Mucaj, S. Epidemiological, serological and herd immunity of Crimean-Congo haemorrhagic fever in Kosovo. Med. Arh. 2010, 64, 91–93. [Google Scholar] [PubMed]
- Mousavi-Jazi, M.; Karlberg, H.; Papa, A.; Christova, I.; Mirazimi, A. Healthy individuals’ immune response to the Bulgarian Crimean-Congo hemorrhagic fever virus vaccine. Vaccine 2012, 30, 6225–6229. [Google Scholar] [CrossRef]
- Papa, A.; Papadimitriou, E.; Christova, I. The Bulgarian vaccine Crimean-Congo haemorrhagic fever virus strain. Scand. J. Infect. Dis. 2011, 43, 225–229. [Google Scholar] [CrossRef]
- Pavel, S.T.I.; Yetiskin, H.; Kalkan, A.; Ozdarendeli, A. Evaluation of the cell culture based and the mouse brain derived inactivated vaccines against Crimean-Congo hemorrhagic fever virus in transiently immune-suppressed (IS) mouse model. PLoS Negl. Trop. Dis. 2020, 14, e0008834. [Google Scholar] [CrossRef]
- Canakoglu, N.; Berber, E.; Tonbak, S.; Ertek, M.; Sozdutmaz, I.; Aktas, M.; Kalkan, A.; Ozdarendeli, A. Immunization of knock-out alpha/beta interferon receptor mice against high lethal dose of Crimean-Congo hemorrhagic fever virus with a cell culture based vaccine. PLoS Negl. Trop. Dis. 2015, 9, e0003579. [Google Scholar] [CrossRef]
- Garrison, A.R.; Shoemaker, C.J.; Golden, J.W.; Fitzpatrick, C.J.; Suschak, J.J.; Richards, M.J.; Badger, C.V.; Six, C.M.; Martin, J.D.; Hannaman, D.; et al. A DNA vaccine for Crimean-Congo hemorrhagic fever protects against disease and death in two lethal mouse models. PLoS Negl. Trop. Dis. 2017, 11, e0005908. [Google Scholar] [CrossRef]
- Hawman, D.W.; Ahlen, G.; Appelberg, K.S.; Meade-White, K.; Hanley, P.W.; Scott, D.; Monteil, V.; Devignot, S.; Okumura, A.; Weber, F.; et al. A DNA-based vaccine protects against Crimean-Congo haemorrhagic fever virus disease in a Cynomolgus macaque model. Nat. Microbiol. 2021, 6, 187–195. [Google Scholar] [CrossRef]
- Hinkula, J.; Devignot, S.; Akerstrom, S.; Karlberg, H.; Wattrang, E.; Bereczky, S.; Mousavi-Jazi, M.; Risinger, C.; Lindegren, G.; Vernersson, C.; et al. Immunization with DNA Plasmids Coding for Crimean-Congo Hemorrhagic Fever Virus Capsid and Envelope Proteins and/or Virus-Like Particles Induces Protection and Survival in Challenged Mice. J. Virol. 2017, 91, e02076-16. [Google Scholar] [CrossRef]
- Kortekaas, J.; Vloet, R.P.; McAuley, A.J.; Shen, X.; Bosch, B.J.; de Vries, L.; Moormann, R.J.; Bente, D.A. Crimean-Congo Hemorrhagic Fever Virus Subunit Vaccines Induce High Levels of Neutralizing Antibodies But No Protection in STAT1 Knockout Mice. Vector Borne Zoonotic Dis. 2015, 15, 759–764. [Google Scholar] [CrossRef] [PubMed]
- Ghiasi, S.M.; Salmanian, A.H.; Chinikar, S.; Zakeri, S. Mice orally immunized with a transgenic plant expressing the glycoprotein of Crimean-Congo hemorrhagic fever virus. Clin. Vaccine Immunol. 2011, 18, 2031–2037. [Google Scholar] [CrossRef] [PubMed]
- Zivcec, M.; Metcalfe, M.G.; Albarino, C.G.; Guerrero, L.W.; Pegan, S.D.; Spiropoulou, C.F.; Bergeron, E. Assessment of Inhibitors of Pathogenic Crimean-Congo Hemorrhagic Fever Virus Strains Using Virus-Like Particles. PLoS Negl. Trop. Dis. 2015, 9, e0004259. [Google Scholar] [CrossRef] [PubMed]
- Aligholipour Farzani, T.; Földes, K.; Ergünay, K.; Gurdal, H.; Bastug, A.; Ozkul, A. Immunological Analysis of a CCHFV mRNA Vaccine Candidate in Mouse Models. Vaccines 2019, 7, 115. [Google Scholar] [CrossRef]
- Buttigieg, K.R.; Dowall, S.D.; Findlay-Wilson, S.; Miloszewska, A.; Rayner, E.; Hewson, R.; Carroll, M.W. A novel vaccine against Crimean-Congo Haemorrhagic Fever protects 100% of animals against lethal challenge in a mouse model. PLoS ONE 2014, 9, e91516. [Google Scholar] [CrossRef]
- Dowall, S.D.; Buttigieg, K.R.; Findlay-Wilson, S.J.; Rayner, E.; Pearson, G.; Miloszewska, A.; Graham, V.A.; Carroll, M.W.; Hewson, R. A Crimean-Congo hemorrhagic fever (CCHF) viral vaccine expressing nucleoprotein is immunogenic but fails to confer protection against lethal disease. Hum. Vaccines Immunother. 2016, 12, 519–527. [Google Scholar] [CrossRef] [PubMed]
- Zivcec, M.; Safronetz, D.; Scott, D.P.; Robertson, S.; Feldmann, H. Nucleocapsid protein-based vaccine provides protection in mice against lethal Crimean-Congo hemorrhagic fever virus challenge. PLoS Negl. Trop. Dis. 2018, 12, e0006628. [Google Scholar] [CrossRef]
- Rodriguez, S.E.; Cross, R.W.; Fenton, K.A.; Bente, D.A.; Mire, C.E.; Geisbert, T.W. Vesicular Stomatitis Virus-Based Vaccine Protects Mice against Crimean-Congo Hemorrhagic Fever. Sci. Rep. 2019, 9, 7755. [Google Scholar] [CrossRef]
- Aligholipour Farzani, T.; Foldes, K.; Hanifehnezhad, A.; Yener Ilce, B.; Bilge Dagalp, S.; Amirzadeh Khiabani, N.; Ergunay, K.; Alkan, F.; Karaoglu, T.; Bodur, H.; et al. Bovine Herpesvirus Type 4 (BoHV-4) Vector Delivering Nucleocapsid Protein of Crimean-Congo Hemorrhagic Fever Virus Induces Comparable Protective Immunity against Lethal Challenge in IFNalpha/beta/gammaR-/- Mice Models. Viruses 2019, 11, 590. [Google Scholar] [CrossRef]
- Bosma, T.; Kanninga, R.; Neef, J.; Audouy, S.A.; van Roosmalen, M.L.; Steen, A.; Buist, G.; Kok, J.; Kuipers, O.P.; Robillard, G.; et al. Novel surface display system for proteins on non-genetically modified gram-positive bacteria. Appl. Environ. Microbiol. 2006, 72, 880–889. [Google Scholar] [CrossRef]
- Van Braeckel-Budimir, N.; Haijema, B.J.; Leenhouts, K. Bacterium-like particles for efficient immune stimulation of existing vaccines and new subunit vaccines in mucosal applications. Front. Immunol. 2013, 4, 282. [Google Scholar] [CrossRef]
- Choudhari, S.P.; Chen, X.; Kim, J.H.; Van Roosmalen, M.L.; Greenwood, J.C., 2nd; Joshi, S.B.; Picking, W.D.; Leenhouts, K.; Middaugh, C.R.; Picking, W.L. Biophysical characterization of the type III secretion tip proteins and the tip proteins attached to bacterium-like particles. J. Pharm. Sci. 2015, 104, 424–432. [Google Scholar] [CrossRef] [PubMed]
- Li, E.; Chi, H.; Huang, P.; Yan, F.; Zhang, Y.; Liu, C.; Wang, Z.; Li, G.; Zhang, S.; Mo, R.; et al. A Novel Bacterium-Like Particle Vaccine Displaying the MERS-CoV Receptor-Binding Domain Induces Specific Mucosal and Systemic Immune Responses in Mice. Viruses 2019, 11, 799. [Google Scholar] [CrossRef] [PubMed]
- Xu, S.; Jiao, C.; Jin, H.; Li, W.; Li, E.; Cao, Z.; Shi, Z.; Yan, F.; Zhang, S.; He, H.; et al. A Novel Bacterium-Like Particle-Based Vaccine Displaying the SUDV Glycoprotein Induces Potent Humoral and Cellular Immune Responses in Mice. Viruses 2019, 11, 1149. [Google Scholar] [CrossRef] [PubMed]
- Rigter, A.; Widjaja, I.; Versantvoort, H.; Coenjaerts, F.E.; van Roosmalen, M.; Leenhouts, K.; Rottier, P.J.; Haijema, B.J.; de Haan, C.A. A protective and safe intranasal RSV vaccine based on a recombinant prefusion-like form of the F protein bound to bacterium-like particles. PLoS ONE 2013, 8, e71072. [Google Scholar] [CrossRef]
- Bi, J.; Li, F.; Zhang, M.; Wang, H.; Lu, J.; Zhang, Y.; Ling, H.; Wang, J.; Gao, F.; Kong, W.; et al. An HIV-1 vaccine based on bacterium-like particles elicits Env-specific mucosal immune responses. Immunol. Lett. 2020, 222, 29–39. [Google Scholar] [CrossRef] [PubMed]
- Nganou-Makamdop, K.; van Roosmalen, M.L.; Audouy, S.A.; van Gemert, G.J.; Leenhouts, K.; Hermsen, C.C.; Sauerwein, R.W. Bacterium-like particles as multi-epitope delivery platform for Plasmodium berghei circumsporozoite protein induce complete protection against malaria in mice. Malar J. 2012, 11, 50. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Guo, X.; Guo, M.; Chen, X.; Li, B.; Yu, J.; Gu, T.; Kong, W.; Wu, Y. Combined prime-boost immunization with systemic and mucosal pneumococcal vaccines based on Pneumococcal surface protein A to enhance protection against lethal pneumococcal infections. Immunol. Res. 2019, 67, 398–407. [Google Scholar] [CrossRef] [PubMed]
- Cheng, H.; Chen, J.; Cai, Z.; Du, L.; Hou, J.; Qiao, X.; Zheng, Q. Development of GEM-PA-nanotrap for purification of foot-and-mouth disease virus. Vaccine 2019, 37, 3205–3213. [Google Scholar] [CrossRef] [PubMed]
- Audouy, S.A.; van Selm, S.; van Roosmalen, M.L.; Post, E.; Kanninga, R.; Neef, J.; Estevao, S.; Nieuwenhuis, E.E.; Adrian, P.V.; Leenhouts, K.; et al. Development of lactococcal GEM-based pneumococcal vaccines. Vaccine 2007, 25, 2497–2506. [Google Scholar] [CrossRef] [PubMed]
- Qiao, X.W.; Yu, X.M.; Li, P.C.; Yu, S.S.; Chen, J.; Zhang, Y.P.; Yang, L.; Hou, L.T.; Zheng, Q.S.; Hou, J.B. Immune efficacy of a porcine circovirus type 2 vaccine purified using Gram-positive enhancer matrix surface display technology. J. Appl. Microbiol. 2019, 127, 658–669. [Google Scholar] [CrossRef] [PubMed]
- Ramirez, K.; Ditamo, Y.; Rodriguez, L.; Picking, W.L.; van Roosmalen, M.L.; Leenhouts, K.; Pasetti, M.F. Neonatal mucosal immunization with a non-living, non-genetically modified Lactococcus lactis vaccine carrier induces systemic and local Th1-type immunity and protects against lethal bacterial infection. Mucosal. Immunol. 2010, 3, 159–171. [Google Scholar] [CrossRef]
- Arce, L.P.; Raya Tonetti, M.F.; Raimondo, M.P.; Muller, M.F.; Salva, S.; Alvarez, S.; Baiker, A.; Villena, J.; Vizoso Pinto, M.G. Oral Vaccination with Hepatitis E Virus Capsid Protein and Immunobiotic Bacterium-Like Particles Induce Intestinal and Systemic Immunity in Mice. Probiotics Antimicrob. Proteins 2020, 12, 961–972. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Hou, H.; Wang, D.; Leenhouts, K.; Roosmalen, M.L.V.; Sun, T.; Gu, T.; Song, Y.; Jiang, C.; Kong, W.; et al. Systemic and mucosal immune responses elicited by intranasal immunization with a pneumococcal bacterium-like particle-based vaccine displaying pneumolysin mutant Plym2. Immunol. Lett. 2017, 187, 41–46. [Google Scholar] [CrossRef] [PubMed]
- van Roosmalen, M.L.; Kanninga, R.; El Khattabi, M.; Neef, J.; Audouy, S.; Bosma, T.; Kuipers, A.; Post, E.; Steen, A.; Kok, J.; et al. Mucosal vaccine delivery of antigens tightly bound to an adjuvant particle made from food-grade bacteria. Methods 2006, 38, 144–149. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Zhang, C.; Liang, B.; Wang, W.; Feng, N.; Zhao, Y.; Wang, T.; Guo, Z.; Yan, F.; Yang, S.; et al. Characterization of Immune Response Diversity in Rodents Vaccinated with a Vesicular Stomatitis Virus Vectored COVID-19 Vaccine. Viruses 2022, 14, 1127. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, A.A.; McFalls, J.M.; Hoffmann, C.; Filone, C.M.; Stewart, S.M.; Paragas, J.; Khodjaev, S.; Shermukhamedova, D.; Schmaljohn, C.S.; Doms, R.W.; et al. Presence of broadly reactive and group-specific neutralizing epitopes on newly described isolates of Crimean-Congo hemorrhagic fever virus. J. Gen. Virol. 2005, 86, 3327–3336. [Google Scholar] [CrossRef] [PubMed]
- Zivcec, M.; Guerrero, L.I.W.; Albarino, C.G.; Bergeron, E.; Nichol, S.T.; Spiropoulou, C.F. Identification of broadly neutralizing monoclonal antibodies against Crimean-Congo hemorrhagic fever virus. Antivir. Res. 2017, 146, 112–120. [Google Scholar] [CrossRef] [PubMed]
- Rahpeyma, M.; Fotouhi, F.; Makvandi, M.; Ghadiri, A.; Samarbaf-Zadeh, A. Crimean-Congo Hemorrhagic Fever Virus Gn Bioinformatic Analysis and Construction of a Recombinant Bacmid in Order to Express Gn by Baculovirus Expression System. Jundishapur J. Microbiol. 2015, 8, e25502. [Google Scholar] [CrossRef] [PubMed]
- Rahpeyma, M.; Samarbaf-Zadeh, A.; Makvandi, M.; Ghadiri, A.A.; Dowall, S.D.; Fotouhi, F. Expression and characterization of codon-optimized Crimean-Congo hemorrhagic fever virus Gn glycoprotein in insect cells. Arch. Virol. 2017, 162, 1951–1962. [Google Scholar] [CrossRef] [PubMed]
- Ludwig, G.V.; Israel, B.A.; Christensen, B.M.; Yuill, T.M.; Schultz, K.T. Role of La Crosse virus glycoproteins in attachment of virus to host cells. Virology 1991, 181, 564–571. [Google Scholar] [CrossRef]
- Spik, K.; Shurtleff, A.; McElroy, A.K.; Guttieri, M.C.; Hooper, J.W.; SchmalJohn, C. Immunogenicity of combination DNA vaccines for Rift Valley fever virus, tick-borne encephalitis virus, Hantaan virus, and Crimean Congo hemorrhagic fever virus. Vaccine 2006, 24, 4657–4666. [Google Scholar] [CrossRef] [PubMed]
- Shepherd, A.J.; Swanepoel, R.; Leman, P.A. Antibody response in Crimean-Congo hemorrhagic fever. Rev. Infect. Dis. 1989, 11 (Suppl. S4), S801–S806. [Google Scholar] [CrossRef] [PubMed]
- Dowall, S.D.; Graham, V.A.; Rayner, E.; Hunter, L.; Watson, R.; Taylor, I.; Rule, A.; Carroll, M.W.; Hewson, R. Protective effects of a Modified Vaccinia Ankara-based vaccine candidate against Crimean-Congo Haemorrhagic Fever virus require both cellular and humoral responses. PLoS ONE 2016, 11, e0156637. [Google Scholar] [CrossRef] [PubMed]
Oligonucleotide Primers Sequence (5’–3’) Enzyme Site | ||
---|---|---|
eGN-F 1,3 | TGCTCTAGACATCACCATCACCATCACTCTGAGGAACCTAGCGACG | XBaI |
eGN-R | ACCAGAACCACCACCAGAACCACCCAGGAAGGCCATGGTGGTCT | |
eGC-F 1,3 | TGCTCTAGACATCACCATCACCATCACTTCCTGGACTCCACCGCC | XBaI |
eGC-R | ACCAGAACCACCACCAGAACCACCGCTCTTCACGGATTCCAGCCAAC | |
NAb-F 1,3 | TGCTCTAGACATCACCATCACCATCACTCCGGCCTGAAGTTCGC | XBaI |
NAb-R | ACCAGAACCACCACCAGAACCACCACAGGTGGAGTTCTGCTTGCC | |
PA3-F 2 | GGTGGTTCTGGTGGTGGTTCTGGTGATGGTGCTTCTTCAGCTGGT | |
PA3-R 1 | CGGGGTACCTTACTTGATACGCAGGTATTGACC | KpnI |
Group | n | Immunization Route | Antigen | Adjuvant | ||
---|---|---|---|---|---|---|
A-G-eGN | 15 | subcutaneous | 1/5/20 μg A-G-eGN | 201VG + Poly(I/C) | ||
A-G-eGC | 15 | subcutaneous | 1/5/20 μg A-G-eGC | 201VG + Poly(I/C) | ||
A-G-NAb | 15 | subcutaneous | 1/5/20 μgA-G-NAb | 201VG + Poly(I/C) | ||
G-eGN | 5 | subcutaneous | 5 μg G-eGN | - | ||
G-eGC | 5 | subcutaneous | 5 μg G-eGC | - | ||
G-NAb | 5 | subcutaneous | 5 μg G-NAb | - | ||
| GEM + 201 + polyI:C | 5 | subcutaneous | GEM + 201 + polyI:C | - | |
Control | 201 + polyI:C | 5 | subcutaneous | 201 + polyI:C | - | |
PBS | 5 | subcutaneous | PBS | - |
Vaccine | Dose (μg) | Antibody Titer (GMT) | |||||||
---|---|---|---|---|---|---|---|---|---|
First Immunization | Second Immunization | Third Immunization | Fourth Immunization | ||||||
ELISA | N ab | ELISA | N ab | ELISA | N ab | ELISA | N ab | ||
G-eGN | 20 | ND | ND | 3584 ± S.D | ND | 24576 ± S.D | ND | 24576 ± S.D | ND |
5 | ND | ND | 3072 ± S.D | ND | 22528 ± S.D | ND | 24576 ± S.D | ND | |
1 | ND | ND | 1536 ± S.D | ND | 3584 ± S.D | ND | 5632 ± S.D | ND | |
G-eGC | 20 | ND | ND | 1126.4 ± S.D | 19.2 ± S.D | 20480 ± S.D | 76.8 ± S.D | 22528 ± S.D | 89.6 ± S.D |
5 | ND | ND | 5120 ± S.D | 16 ± S.D | 20480 ± S.D | 70.4 ± S.D | 20480 ± S.D | 76.8 ± S.D | |
1 | ND | ND | 2048 ± S.D | 5.6 ± S.D | 4096 ± S.D | 14.4 ± S.D | 5120 ± S.D | 28.8 ± S.D | |
G-NAb | 20 | ND | ND | 4096 ± S.D | ND | 22528 ± S.D | ND | 24576 ± S.D | ND |
5 | ND | ND | 3584 ± S.D | ND | 22528 ± S.D | ND | 24576 ± S.D | ND | |
1 | ND | ND | 2304 ± S.D | ND | 4096 ± S.D | ND | 8192 ± S.D | ND |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Q.; Wang, S.; Shi, Z.; Li, Z.; Zhao, Y.; Feng, N.; Bi, J.; Jiao, C.; Li, E.; Wang, T.; et al. GEM-PA-Based Subunit Vaccines of Crimean Congo Hemorrhagic Fever Induces Systemic Immune Responses in Mice. Viruses 2022, 14, 1664. https://doi.org/10.3390/v14081664
Wang Q, Wang S, Shi Z, Li Z, Zhao Y, Feng N, Bi J, Jiao C, Li E, Wang T, et al. GEM-PA-Based Subunit Vaccines of Crimean Congo Hemorrhagic Fever Induces Systemic Immune Responses in Mice. Viruses. 2022; 14(8):1664. https://doi.org/10.3390/v14081664
Chicago/Turabian StyleWang, Qi, Shen Wang, Zhikang Shi, Zhengrong Li, Yongkun Zhao, Na Feng, Jinhao Bi, Cuicui Jiao, Entao Li, Tiecheng Wang, and et al. 2022. "GEM-PA-Based Subunit Vaccines of Crimean Congo Hemorrhagic Fever Induces Systemic Immune Responses in Mice" Viruses 14, no. 8: 1664. https://doi.org/10.3390/v14081664
APA StyleWang, Q., Wang, S., Shi, Z., Li, Z., Zhao, Y., Feng, N., Bi, J., Jiao, C., Li, E., Wang, T., Wang, J., Jin, H., Huang, P., Yan, F., Yang, S., & Xia, X. (2022). GEM-PA-Based Subunit Vaccines of Crimean Congo Hemorrhagic Fever Induces Systemic Immune Responses in Mice. Viruses, 14(8), 1664. https://doi.org/10.3390/v14081664