A Recombinant Turkey Herpesvirus Expressing the F Protein of Newcastle Disease Virus Genotype XII Generated by NHEJ-CRISPR/Cas9 and Cre-LoxP Systems Confers Protection against Genotype XII Challenge in Chickens
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chickens
2.2. Cell Culture and Virus
2.3. Design of sgRNAs and Construction of the Donor Plasmid
2.4. Generation of the Recombinant HVT Containing the F Gene from NDV of Genotype XII
2.5. Flow Cytometry Analysis
2.6. Excision of the GFP Reporter Cassette Via the Cre-LoxP System
2.7. Indirect Immunofluorescence Assay (IFA)
2.8. Western Blot Analysis
2.9. In Vitro Growth Properties and Plaque Assay
2.10. Genetic Stability of the rHVT-F Virus
2.11. Vaccination in SPF Chickens and Efficacy of the rHVT-F Vaccine against NDV Genotype XII Challenge in SPF Chickens
2.12. ELISA and HI Test
2.13. Evaluation of Challenge Virus Shedding
2.14. Replication and Stability of rHVT-F Virus In Vivo
2.15. Statistical Analysis
3. Results
3.1. Construction and Rescue of the rHVT-F Virus
3.2. Fusion Protein Expression on the Cell Surface by Flow Cytometry Analyses
3.3. Characterization of the rHVT-F Virus
3.4. Genetic Stability of the rHVT-F Virus
3.5. Humoral Immune Response to Vaccination in SPF Chickens
3.6. Efficacy against Genotype XII NDV Challenge
3.7. Detection of the Replication by rHVT-F Virus Isolation from Lymphocytes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cattoli, G.; Susta, L.; Terregino, C.; Brown, C. Newcastle disease: A review of field recognition and current methods of laboratory detection. J. Vet. Diagn. Investig. 2011, 23, 637–656. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dimitrov, K.M.; Afonso, C.L.; Yu, Q.; Miller, P.J. Newcastle disease vaccines—A solved problem or a continuous challenge? Vet. Microbiol. 2017, 206, 126–136. [Google Scholar] [CrossRef] [PubMed]
- Meulemans, G.; Gonze, M.; Carlier, M.C.; Petit, P.; Burny, A.; Long, L. Protective Effects of Hn and F Glycoprotein-Specific Monoclonal Antibodies On Experimental Newcastle Disease. Avian Pathol. 1986, 15, 761–768. [Google Scholar] [CrossRef] [PubMed]
- Diel, D.G.; Da Silva, L.H.A.; Liu, H.; Wang, Z.; Miller, P.J.; Afonso, C.L. Genetic diversity of avian paramyxovirus type 1: Proposal for a unified nomenclature and classification system of Newcastle disease virus genotypes. Infect. Genet. Evol. 2012, 12, 1770–1779. [Google Scholar] [CrossRef] [PubMed]
- Dimitrov, K.M.; Abolnik, C.; Afonso, C.L.; Albina, E.; Bahl, J.; Berg, M.; Briand, F.X.; Brown, I.H.; Choi, K.S.; Chvala, I.; et al. Updated unified phylogenetic classification system and revised nomenclature for Newcastle disease virus. Infect. Genet. Evol. 2019, 74, 103917. [Google Scholar] [CrossRef] [PubMed]
- Diel, D.G.; Susta, L.; Garcia, S.C.; Killian, M.L.; Brown, C.C.; Miller, P.J.; Afonso, C.L. Complete Genome and Clinicopathological Characterization of a Virulent Newcastle Disease Virus Isolate from South America. J. Clin. Microbiol. 2012, 50, 378–387. [Google Scholar] [CrossRef] [Green Version]
- Chumbe, A.; Izquierdo-Lara, R.; Tataje-Lavanda, L.; Figueroa, A.; Segovia, K.; Gonzalez, R.; Cribillero, G.; Montalvan, A.; Fernández-Díaz, M.; Icochea, E. Characterization and Sequencing of a Genotype XII Newcastle Disease Virus Isolated from a Peacock (Pavo cristatus) in Peru. Genome Announc. 2015, 3, e00792-15. [Google Scholar] [CrossRef] [Green Version]
- Chumbe, A.; Izquierdo-Lara, R.; Tataje, L.; Gonzalez, R.; Cribillero, G.; González, A.E.; Fernández-Díaz, M.; Icochea, E. Pathotyping and Phylogenetic Characterization of Newcastle Disease Viruses Isolated in Peru: Defining Two Novel Subgenotypes Within Genotype XII. Avian Dis. 2017, 61, 16–24. [Google Scholar] [CrossRef]
- Morgan, R.W.; Gelb, J.; Schreurs, C.S.; Lütticken, D.; Rosenberger, J.K.; Sondermeijer, P.J.A. Protection of Chickens from Newcastle and Marek’s Diseases with a Recombinant Herpesvirus of Turkeys Vaccine Expressing the Newcastle Disease Virus Fusion Protein. Avian Dis. 1992, 36, 858–870. [Google Scholar] [CrossRef]
- Morgan, R.W.; Gelb, J.; Pope, C.R.; Sondermeijer, P.J.A. Efficacy in Chickens of a Herpesvirus of Turkeys Recombinant Vaccine Containing the Fusion Gene of Newcastle Disease Virus: Onset of Protection and Effect of Maternal Antibodies. Avian Dis. 1993, 37, 1032–1040. [Google Scholar] [CrossRef]
- Heckert, R.A.; Riva, J.; Cook, S.; McMillen, J.; Schwartz, R.D. Onset of Protective Immunity in Chicks after Vaccination with a Recombinant Herpesvirus of Turkeys Vaccine Expressing Newcastle Disease Virus Fusion and Hemagglutinin-Neuraminidase Antigens. Avian Dis. 1996, 40, 770–777. [Google Scholar] [CrossRef] [PubMed]
- Palya, V.; Tatár-Kis, T.; Mató, T.; Felföldi, B.; Kovács, E.; Gardin, Y. Onset and long-term duration of immunity provided by a single vaccination with a turkey herpesvirus vector ND vaccine in commercial layers. Vet. Immunol. Immunopathol. 2014, 158, 105–115. [Google Scholar] [CrossRef] [PubMed]
- Afonso, C.L.; Tulman, E.R.; Lu, Z.; Zsak, L.; Rock, D.L.; Kutish, G.F. The Genome of Turkey Herpesvirus. J. Virol. 2001, 75, 971–978. [Google Scholar] [CrossRef] [Green Version]
- Okazaki, W.; Purchase, H.G.; Burmester, B.R. Protection against Marek’s Disease by Vaccination with a Herpesvirus of Turkeys. Avian Dis. 1970, 14, 413–429. [Google Scholar] [CrossRef] [PubMed]
- Rauw, F.; Gardin, Y.; Palya, V.; Anbari, S.; Lemaire, S.; Boschmans, M.; Van den Berg, T.; Lambrecht, B. Improved vaccination against Newcastle disease by an in ovo recombinant HVT-ND combined with an adjuvanted live vaccine at day-old. Vaccine 2010, 28, 823–833. [Google Scholar] [CrossRef]
- Esaki, M.; Godoy, A.; Rosenberger, J.K.; Rosenberger, S.C.; Gardin, Y.; Yasuda, A.; Dorsey, K.M. Protection and Antibody Response Caused by Turkey Herpesvirus Vector Newcastle Disease Vaccine. Avian Dis. 2013, 57, 750–755. [Google Scholar] [CrossRef]
- Palya, V.; Tatár-Kis, T.; Arafa, A.S.A.; Felföldi, B.; Mató, T.; Setta, A. Efficacy of a Turkey Herpesvirus Vectored Newcastle Disease Vaccine against Genotype VII.1.1 Virus: Challenge Route Affects Shedding Pattern. Vaccines 2021, 9, 37. [Google Scholar] [CrossRef]
- Tsukamoto, K.; Saito, S.; Saeki, S.; Sato, T.; Tanimura, N.; Isobe, T.; Mase, M.; Imada, T.; Yuasa, N.; Yamaguchi, S. Complete, Long-Lasting Protection against Lethal Infectious Bursal Disease Virus Challenge by a Single Vaccination with an Avian Herpesvirus Vector Expressing VP2 Antigens. J. Virol. 2002, 76, 5637–5645. [Google Scholar] [CrossRef] [Green Version]
- Kapczynski, D.R.; Dorsey, K.; Chrzastek, K.; Moraes, M.; Jackwood, M.; Hilt, D.; Gardin, Y. Vaccine Protection of Turkeys Against H5N1 Highly Pathogenic Avian Influenza Virus with a Recombinant Turkey Herpesvirus Expressing the Hemagglutinin Gene of Avian Influenza. Avian Dis. 2016, 60, 413–417. [Google Scholar] [CrossRef]
- Li, Y.; Reddy, K.; Reid, S.M.; Cox, W.J.; Brown, I.H.; Britton, P.; Nair, V.; Iqbal, M. Recombinant herpesvirus of turkeys as a vector-based vaccine against highly pathogenic H7N1 avian influenza and Marek’s disease. Vaccine 2011, 29, 8257–8266. [Google Scholar] [CrossRef]
- Esaki, M.; Noland, L.; Eddins, T.; Godoy, A.; Saeki, S.; Saitoh, S.; Yasuda, A.; Dorsey, K.M. Safety and Efficacy of a Turkey Herpesvirus Vector Laryngotracheitis Vaccine for Chickens. Avian Dis. 2013, 57, 192–198. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Sun, W.; Chu, J.; Huang, X.; Wu, Z.; Yan, M.; Zhang, Q.; Zhao, P.; Igietseme, J.U.; Black, C.M.; et al. Construction of Recombinant HVT Expressing PmpD, and Immunological Evaluation against Chlamydia psittaci and Marek’s Disease Virus. PLoS ONE 2015, 10, e0124992. [Google Scholar] [CrossRef] [PubMed]
- Reddy, S.K.; Sharma, J.M.; Ahmad, J.; Reddy, D.N.; McMillen, J.K.; Cook, S.M.; Wild, M.A.; Schwartz, R.D. Protective efficacy of a recombinant herpesvirus of turkeys as an in ovo vaccine against Newcastle and Marek’s diseases in specific-pathogen-free chickens. Vaccine 1996, 14, 469–477. [Google Scholar] [CrossRef]
- Andoh, K.; Yamazaki, K.; Honda, Y.; Honda, T. Turkey herpesvirus with an insertion in the UL3-4 region displays an appropriate balance between growth activity and antibody-eliciting capacity and is suitable for the establishment of a recombinant vaccine. Arch. Virol. 2017, 162, 931–941. [Google Scholar] [CrossRef]
- Tsukamoto, K.; Kojima, C.; Komori, Y.; Tanimura, N.; Mase, M.; Yamaguchi, S. Protection of Chickens against Very Virulent Infectious Bursal Disease Virus (IBDV) and Marek’s Disease Virus (MDV) with a Recombinant MDV Expressing IBDV VP2. Virology 1999, 257, 352–362. [Google Scholar] [CrossRef] [Green Version]
- Tang, N.; Zhang, Y.; Pedrera, M.; Chang, P.; Baigent, S.; Moffat, K.; Shen, Z.; Nair, V.; Yao, Y. A simple and rapid approach to develop recombinant avian herpesvirus vectored vaccines using CRISPR/Cas9 system. Vaccine 2018, 36, 716–722. [Google Scholar] [CrossRef]
- Tang, N.; Zhang, Y.; Pedrera, M.; Chang, P.; Baigent, S.; Moffat, K.; Shen, Z.; Nair, V.; Yao, Y. Generating Recombinant Avian Herpesvirus Vectors with CRISPR/Cas9 Gene Editing. J. Vis. Exp. 2019, 143, 58193. [Google Scholar] [CrossRef]
- Liu, L.; Wang, T.; Wang, M.; Tong, Q.; Sun, Y.; Pu, J.; Sun, H.; Liu, J. Recombinant turkey herpesvirus expressing H9 hemagglutinin providing protection against H9N2 avian influenza. Virology 2019, 529, 7–15. [Google Scholar] [CrossRef]
- Chang, P.; Ameen, F.; Sealy, J.E.; Sadeyen, J.-R.; Bhat, S.; Li, Y.; Iqbal, M. Application of HDR-CRISPR/Cas9 and Erythrocyte Binding for Rapid Generation of Recombinant Turkey Herpesvirus-Vectored Avian Influenza Virus Vaccines. Vaccines 2019, 7, 192. [Google Scholar] [CrossRef] [Green Version]
- Baigent, S.J.; Petherbridge, L.J.; Smith, L.P.; Zhao, Y.; Chesters, P.M.; Nair, V.K. Herpesvirus of turkey reconstituted from bacterial artificial chromosome clones induces protection against Marek’s disease. J. Gen. Virol. 2006, 87, 769–776. [Google Scholar] [CrossRef]
- Shang, W.; Wang, F.; Fan, G.; Wang, H. Key elements for designing and performing a CRISPR/Cas9-based genetic screen. J. Genet. Genom. 2017, 44, 439–449. [Google Scholar] [CrossRef] [PubMed]
- Rath, D.; Amlinger, L.; Rath, A.; Lundgren, M. The CRISPR-Cas immune system: Biology, mechanisms and applications. Biochimie 2015, 117, 119–128. [Google Scholar] [CrossRef] [PubMed]
- He, X.; Tan, C.; Wang, F.; Wang, Y.; Zhou, R.; Cui, D.; You, W.; Zhao, H.; Ren, J.; Feng, B. Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair. Nucleic Acids Res. 2016, 44, e85. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ran, F.A.; Hsu, P.D.; Wright, J.; Agarwala, V.; Scott, D.A.; Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 2013, 8, 2281–2308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuen, K.S.; Chan, C.P.; Wong, N.H.M.; Ho, C.H.; Ho, T.H.; Lei, T.; Deng, W.; Tsao, S.W.; Chen, H.; Kok, K.H.; et al. CRISPR/Cas9-mediated genome editing of Epstein–Barr virus in human cells. J. Gen. Virol. 2015, 96, 626–636. [Google Scholar] [CrossRef] [Green Version]
- Xu, A.; Qin, C.; Lang, Y.; Wang, M.; Lin, M.; Li, C.; Zhang, R.; Tang, J. A simple and rapid approach to manipulate pseudorabies virus genome by CRISPR/Cas9 system. Biotechnol. Lett. 2015, 37, 1265–1272. [Google Scholar] [CrossRef]
- Tang, Y.D.; Liu, J.T.; Fang, Q.Q.; Wang, T.Y.; Sun, M.X.; An, T.Q.; Tian, Z.J.; Cai, X.H. Recombinant Pseudorabies Virus (PRV) Expressing Firefly Luciferase Effectively Screened for CRISPR/Cas9 Single Guide RNAs and Antiviral Compounds. Viruses 2016, 8, 90. [Google Scholar] [CrossRef] [Green Version]
- Tang, Y.D.; Liu, J.T.; Wang, T.Y.; An, T.Q.; Sun, M.X.; Wang, S.J.; Fang, Q.Q.; Hou, L.L.; Tian, Z.J.; Cai, X.H. Live attenuated pseudorabies virus developed using the CRISPR/Cas9 system. Virus Res. 2016, 225, 33–39. [Google Scholar] [CrossRef] [Green Version]
- Liang, X.; Sun, L.; Yu, T.; Pan, Y.; Wang, D.; Hu, X.; Fu, Z.; He, Q.; Cao, G. A CRISPR/Cas9 and Cre/Lox system-based express vaccine development strategy against re-emerging Pseudorabies virus. Sci. Rep. 2016, 6, 19176. [Google Scholar] [CrossRef] [Green Version]
- Tang, Y.D.; Guo, J.C.; Wang, T.Y.; Zhao, K.; Liu, J.T.; Gao, J.C.; Tian, Z.J.; An, T.Q.; Cai, X.H. CRISPR/Cas9-mediated 2-sgRNA cleavage facilitates pseudorabies virus editing. Faseb J. 2018, 32, 4293–4301. [Google Scholar] [CrossRef] [Green Version]
- Zhao, Y.; Wang, L.Q.; Zheng, H.H.; Yang, Y.R.; Liu, F.; Zheng, L.L.; Jin, Y.; Chen, H.Y. Construction and immunogenicity of a gE/gI/TK-deleted PRV based on porcine pseudorabies virus variant. Mol. Cell. Probes 2020, 53, 101605. [Google Scholar] [CrossRef] [PubMed]
- Pan, Q.; Wang, J.; Gao, Y.; Cui, H.; Liu, C.; Qi, X.; Zhang, Y.; Wang, Y.; Wang, X. The Natural Large Genomic Deletion Is Unrelated to the Increased Virulence of the Novel Genotype Fowl Adenovirus 4 Recently Emerged in China. Viruses 2018, 10, 494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, M.; Zhang, W.; Wang, J.; Al Yaghchi, C.; Ahmed, J.; Chard, L.; Lemoine, N.R.; Wang, Y. Efficiently Editing the Vaccinia Virus Genome by Using the CRISPR-Cas9 System. J. Virol. 2015, 89, 5176–5179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yao, Y.; Bassett, A.; Nair, V. Targeted editing of avian herpesvirus vaccine vector using CRISPR/Cas9 nuclease. Int. J. Vaccines Technol. 2016, 1, 1–7. [Google Scholar]
- Zou, Z.; Huang, K.; Wei, Y.; Chen, H.; Liu, Z.; Jin, M. Construction of a highly efficient CRISPR/Cas9-mediated duck enteritis virus-based vaccine against H5N1 avian influenza virus and duck Tembusu virus infection. Sci. Rep. 2017, 7, 1478. [Google Scholar] [CrossRef] [Green Version]
- Chang, P.; Yao, Y.; Tang, N.; Sadeyen, J.R.; Sealy, J.; Clements, A.; Bhat, S.; Munir, M.; Bryant, J.E.; Iqbal, M. The Application of NHEJ-CRISPR/Cas9 and Cre-Lox System in the Generation of Bivalent Duck Enteritis Virus Vaccine against Avian Influenza Virus. Viruses 2018, 10, 81. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Tang, N.; Sadigh, Y.; Baigent, S.; Shen, Z.; Nair, V.; Yao, Y. Application of CRISPR/Cas9 Gene Editing System on MDV-1 Genome for the Study of Gene Function. Viruses 2018, 10, 279. [Google Scholar] [CrossRef] [Green Version]
- Atasoy, M.O.; Rohaim, M.A.; Munir, M. Simultaneous Deletion of Virulence Factors and Insertion of Antigens into the Infectious Laryngotracheitis Virus Using NHEJ-CRISPR/Cas9 and Cre–Lox System for Construction of a Stable Vaccine Vector. Vaccines 2019, 7, 207. [Google Scholar] [CrossRef] [Green Version]
- Tang, N.; Zhang, Y.; Sadigh, Y.; Moffat, K.; Shen, Z.; Nair, V.; Yao, Y. Generation of A Triple Insert Live Avian Herpesvirus Vectored Vaccine Using CRISPR/Cas9-Based Gene Editing. Vaccines 2020, 8, 97. [Google Scholar] [CrossRef] [Green Version]
- Alfonso, C.L.; Miller, P.J.; Grund, C.; Kock, G.; Peeters, B.; Selleck, P.W.; Srinivas, G. Newcastle Disease. In Manual of Diagnostic Test and Vaccines for Terrestrial Animals; OIE: Paris, France, 2018; pp. 964–983. [Google Scholar]
- Sondermeijer, P.J.A.; Claessens, J.A.J.; Jenniskens, P.E.; Adrian Mockett, A.P.; Thijssen, R.A.J.; Willemse, M.J.; Morgan, R.W. Avian herpesvirus as a live viral vector for the expression of heterologous antigens. Vaccine 1993, 11, 349–358. [Google Scholar] [CrossRef]
- McPherson, M.C.; Cheng, H.H.; Delany, M.E. Marek’s disease herpesvirus vaccines integrate into chicken host chromosomes yet lack a virus-host phenotype associated with oncogenic transformation. Vaccine 2016, 34, 5554–5561. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, H.; De Almeida, R.S.; Gil, P.; Majó, N.; Nofrarías, M.; Briand, F.X.; Jestin, V.; Albina, E. Can genotype mismatch really affect the level of protection conferred by Newcastle disease vaccines against heterologous virulent strains? Vaccine 2018, 36, 3917–3925. [Google Scholar] [CrossRef]
- Dortmans, J.C.F.M.; Peeters, B.P.H.; Koch, G. Newcastle disease virus outbreaks: Vaccine mismatch or inadequate application? Vet. Microbiol. 2012, 160, 17–22. [Google Scholar] [CrossRef] [PubMed]
- Miller, P.J.; King, D.J.; Afonso, C.L.; Suarez, D.L. Antigenic differences among Newcastle disease virus strains of different genotypes used in vaccine formulation affect viral shedding after a virulent challenge. Vaccine 2007, 25, 7238–7246. [Google Scholar] [CrossRef] [PubMed]
- Miller, P.J.; Estevez, C.; Yu, Q.; Suarez, D.L.; King, D.J. Comparison of Viral Shedding Following Vaccination with Inactivated and Live Newcastle Disease Vaccines Formulated with Wild-Type and Recombinant Viruses. Avian Dis. Dig. 2009, 53, 39–49. [Google Scholar] [CrossRef]
- Kaspers, B.; Schat, K.A.; Göbel, T.; Vervelde, L. Avian Immunology, 3rd ed.; Lavoisier: Cachan, France, 2021. [Google Scholar]
- Rauw, F.; Van Borm, S.; Welby, S.; Ngabirano, E.; Gardin, Y.; Palya, V.; Lambrecht, B. Quantification of rHVT-F genome load in feather follicles by specific real-time qPCR as an indicator of NDV-specific humoral immunity induced by day-old vaccination in SPF chickens. Avian Pathol. 2015, 44, 154–161. [Google Scholar] [CrossRef]
- Palya, V.; Kiss, I.; Tatár-Kis, T.; Mató, T.; Felföldi, B.; Gardin, Y. Advancement in Vaccination Against Newcastle Disease: Recombinant HVT NDV Provides High Clinical Protection and Reduces Challenge Virus Shedding with the Absence of Vaccine Reactions. Avian Dis. 2012, 56, 282–287. [Google Scholar] [CrossRef]
- Meulemans, G.; Letellier, C.; Gonze, M.; Carlier, M.C.; Burny, A. Newcastle disease virus f glycoprotein expressed from a recombinant vaccinia virus vector protects chickens against live-virus challenge. Avian Pathol. 1988, 17, 821–827. [Google Scholar] [CrossRef] [Green Version]
- Mao, Z.; Bozzella, M.; Seluanov, A.; Gorbunova, V. Comparison of nonhomologous end joining and homologous recombination in human cells. DNA Repair 2008, 7, 1765–1771. [Google Scholar] [CrossRef] [Green Version]
Primers and sgRNAs | Sequences (5′→3′) |
---|---|
NDV-F(XII)-5F | TGGGAACAATACCCTCGATCA |
HVT UL46-5R | GTTTCGGAATCTGGCAGGGT |
HVT UL45F | TCGCAAACGCCAAAGTTCTG |
HVT UL46R | CGAGCAATGACCCTCCAGTT |
1F | CGTTGTAAAACGACGGCCAG |
1R | TGGCTTGGGAACAATACCCT |
2F | ATTGAGTCACCACCCCTATGC |
2R | CCCAACTTCTCGGGGACTGT |
sgRNA-UL45-46-F | CACCgTAGACATTATAAACATAATA |
sgRNA-UL45-46-R | AAACTATTATGTTTATAATGTCTAc |
Group | Number of Viral Shedding Chickens (Positive/Total) | |||||
---|---|---|---|---|---|---|
3 dpc (a) | 5 dpc | 8 dpc | ||||
Oral | Cloacal | Oral | Cloacal | Oral | Cloacal | |
Vaccinated | 2/7 | 0/7 | 0/7 | 0/7 | 0/7 | 0/7 |
Control | 7/7 | 5/7 | 6/6 | 6/6 | NS (b) | NS |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Calderón, K.; Rojas-Neyra, A.; Carbajal-Lévano, B.; Luján-Valenzuela, L.; Ticona, J.; Isasi-Rivas, G.; Montalvan, A.; Criollo-Orozco, M.; Huaccachi-Gonzáles, E.; Tataje-Lavanda, L.; et al. A Recombinant Turkey Herpesvirus Expressing the F Protein of Newcastle Disease Virus Genotype XII Generated by NHEJ-CRISPR/Cas9 and Cre-LoxP Systems Confers Protection against Genotype XII Challenge in Chickens. Viruses 2022, 14, 793. https://doi.org/10.3390/v14040793
Calderón K, Rojas-Neyra A, Carbajal-Lévano B, Luján-Valenzuela L, Ticona J, Isasi-Rivas G, Montalvan A, Criollo-Orozco M, Huaccachi-Gonzáles E, Tataje-Lavanda L, et al. A Recombinant Turkey Herpesvirus Expressing the F Protein of Newcastle Disease Virus Genotype XII Generated by NHEJ-CRISPR/Cas9 and Cre-LoxP Systems Confers Protection against Genotype XII Challenge in Chickens. Viruses. 2022; 14(4):793. https://doi.org/10.3390/v14040793
Chicago/Turabian StyleCalderón, Katherine, Aldo Rojas-Neyra, Brigith Carbajal-Lévano, Luis Luján-Valenzuela, Julio Ticona, Gisela Isasi-Rivas, Angela Montalvan, Manuel Criollo-Orozco, Edison Huaccachi-Gonzáles, Luis Tataje-Lavanda, and et al. 2022. "A Recombinant Turkey Herpesvirus Expressing the F Protein of Newcastle Disease Virus Genotype XII Generated by NHEJ-CRISPR/Cas9 and Cre-LoxP Systems Confers Protection against Genotype XII Challenge in Chickens" Viruses 14, no. 4: 793. https://doi.org/10.3390/v14040793
APA StyleCalderón, K., Rojas-Neyra, A., Carbajal-Lévano, B., Luján-Valenzuela, L., Ticona, J., Isasi-Rivas, G., Montalvan, A., Criollo-Orozco, M., Huaccachi-Gonzáles, E., Tataje-Lavanda, L., Alvarez, K. L. F., Fernández-Sánchez, M., Fernández-Díaz, M., Tang, N., Yao, Y., & Nair, V. (2022). A Recombinant Turkey Herpesvirus Expressing the F Protein of Newcastle Disease Virus Genotype XII Generated by NHEJ-CRISPR/Cas9 and Cre-LoxP Systems Confers Protection against Genotype XII Challenge in Chickens. Viruses, 14(4), 793. https://doi.org/10.3390/v14040793