Highly Pathogenic PRRSV-Infected Alveolar Macrophages Impair the Function of Pulmonary Microvascular Endothelial Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statements
2.2. Cells and Virus
2.3. Transwell Co-Cultures System
2.4. Transcriptome mRNA Library Construction and Sequencing
2.5. Venn, GO and KEGG Pathway Enrichment Analysis
2.6. Quantitative Reverse Transcription PCR (RT-qPCR)
2.7. Western Blot
2.8. Trans-Endothelial Electrical Resistance and In Vitro Vascular Permeability Assay
2.9. Statistical Analysis
3. Results
3.1. Establishment of PMVECs and PAMs Transwell Co-Cultures In Vitro
3.2. Differential Transcription Analysis of Genes in PMVECs in Response to the Interaction with HP-PRRSV-Infected PAMs
3.3. Analysis of Gene Ontology (GO) Terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathways of DEGs
3.4. Cell Adhesion Molecules and Pro-Inflammatory Cytokines Are Induced in PMVECs upon the Interaction with HP-PRRSV-Infected PAMs
3.5. HP-PRRSV Triggers Endothelial Barrier Dysfunction In Vitro
3.6. HP-PRRSV Infection Dysregulates PMVEC Tight Junction Proteins In Vitro
3.7. Experimental Validation of Selected Genes
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Walker, P.J.; Siddell, S.G.; Lefkowitz, E.J.; Mushegian, A.R.; Adriaenssens, E.M.; Dempsey, D.M.; Dutilh, B.E.; Harrach, B.; Harrison, R.L.; Hendrickson, R.C.; et al. Changes to virus taxonomy and the Statutes ratified by the International Committee on Taxonomy of Viruses. Arch. Virol. 2020, 165, 2737–2748. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Collins, J.E.; Benfield, D.A.; Christianson, W.T.; Harris, L.; Hennings, J.C.; Shaw, D.P.; Goyal, S.M.; McCullough, S.; Morrison, R.B.; Joo, H.S.; et al. Isolation of Swine Infertility and Respiratory Syndrome Virus (Isolate ATCC VR-2332) in North America and Experimental Reproduction of the Disease in Gnotobiotic Pigs. J. Vet. Diagn. Investig. 1992, 4, 117–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benfield, D.A.; Nelson, E.; Collins, J.E.; Harris, L.; Goyal, S.M.; Robison, D.; Christianson, W.T.; Morrison, R.B.; Gorcyca, D.; Chladek, D. Characterization of Swine Infertility and Respiratory Syndrome (SIRS) Virus (Isolate ATCC VR-2332). J. Vet. Diagn. Investig. 1992, 4, 127–133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wensvoort, G.; Terpstra, C.; Pol, J.M.A.; Ter Laak, E.A.; Bloemraad, M.; De Kluyver, E.P.; Kragten, C.; Van Buiten, L.; den Besten, A.; Wagenaar, F.; et al. Mystery swine disease in the Netherlands: The isolation of Lelystad virus. Vet. Q. 1991, 13, 121–130. [Google Scholar] [CrossRef] [Scilit]
- Terpstra, C.; Wensvoort, G.; Pol, J.M.A. Experimental reproduction of porcine epidemic abortion and respiratory syndrome (mystery swine disease) by infection with Lelystad virus: Koch’s postulates fulfilled. Vet. Q. 1991, 13, 131. [Google Scholar] [CrossRef] [Scilit]
- Tian, K.; Yu, X.; Zhao, T.; Feng, Y.; Cao, Z.; Wang, C.; Hu, Y.; Chen, X.; Hu, D.; Tian, X.; et al. Emergence of Fatal PRRSV Variants: Unparalleled Outbreaks of Atypical PRRS in China and Molecular Dissection of the Unique Hallmark. PLoS ONE 2007, 2, e526. [Google Scholar] [CrossRef] [Scilit]
- Zhou, L.; Yang, H.C. Porcine reproductive and respiratory syndrome in China. Virus Res. 2010, 154, 31–37. [Google Scholar] [CrossRef] [Scilit]
- Zhou, L.; Chen, S.; Zhang, J.; Zeng, J.; Guo, X.; Ge, X.; Zhang, D.; Yang, H. Molecular variation analysis of porcine reproductive and respiratory syndrome virus in China. Virus Res. 2009, 145, 97–105. [Google Scholar] [CrossRef] [Scilit]
- Zhou, L.; Zhang, J.; Zeng, J.; Yin, S.; Li, Y.; Zheng, L.; Guo, X.; Ge, X.; Yang, H. The 30-Amino-Acid Deletion in the Nsp2 of Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus Emerging in China Is Not Related to Its Virulence. J. Virol. 2009, 83, 5156–5167. [Google Scholar] [CrossRef] [Scilit]
- Trevisan, G.; Li, G.; Moura, C.A.A.; Coleman, K.; Thomas, P.; Zhang, J.; Gauger, P.; Zeller, M.; Linhares, D. Complete Coding Genome Sequence of a Novel Porcine Reproductive and Respiratory Syndrome Virus 2 Restriction Fragment Length Polymorphism 1-4-4 Lineage 1C Variant Identified in Iowa, USA. Microbiol. Resour. Announc. 2021, 10, e0044821. [Google Scholar] [CrossRef] [Scilit]
- Han, D.; Hu, Y.; Li, L.; Tian, H.; Chen, Z.; Wang, L.; Ma, H.; Yang, H.; Teng, K. Highly pathogenic porcine reproductive and respiratory syndrome virus infection results in acute lung injury of the infected pigs. Vet. Microbiol. 2014, 169, 135–146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tichet, M.; Prod’Homme, V.; Fenouille, N.; Ambrosetti, D.; Mallavialle, A.; Cerezo, M.; Ohanna, M.L.; Audebert, S.; Rocchi, S.; Giacchero, D.; et al. Tumour-derived SPARC drives vascular permeability and extravasation through endothelial VCAM1 signalling to promote metastasis. Nat. Commun. 2015, 6, 6993. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohmura, T.; Tian, Y.; Sarich, N.; Ke, Y.; Meliton, A.; Shah, A.S.; Andreasson, K.; Birukov, K.G.; Birukova, A.A. Regulation of lung endothelial permeability and inflammatory responses by prostaglandin A2: Role of EP4 receptor. Mol. Biol. Cell 2017, 28, 1622–1635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reymond, N.; D’Agua, B.B.; Ridley, A.J. Crossing the endothelial barrier during metastasis. Nat. Rev. Cancer 2013, 13, 858–870. [Google Scholar] [CrossRef] [Scilit]
- Matthay, M.A.; Ware, L.B.; Zimmerman, G.A. The acute respiratory distress syndrome. J. Clin. Investig. 2012, 122, 2731. [Google Scholar] [CrossRef] [Scilit]
- Xiong, S.; Hong, Z.; Huang, L.S.; Tsukasaki, Y.; Malik, A.B. IL-1β Suppression of VE-cadherin transcription underlies sepsis-induced inflammatory lung injury. J. Clin. Investig. 2020, 130, 3684–3698. [Google Scholar] [CrossRef] [Scilit]
- Dejana, E. Endothelial cell–cell junctions: Happy together. Nat. Rev. Mol. Cell Biol. 2004, 5, 261–270. [Google Scholar] [CrossRef] [Scilit]
- Komarova, Y.; Malik, A.B. Regulation of Endothelial Permeability via Paracellular and Transcellular Transport Pathways. Annu. Rev. Physiol. 2010, 72, 463–493. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.-B.; Wang, J.-T.; Zhang, L.; Geng, Z.H.; Xu, W.-L.; Xu, T.; Huo, Y.; Zhu, X.; Plow, E.F.; Chen, M.; et al. P-selectin primes leukocyte integrin activation during inflammation. Nat. Immunol. 2007, 8, 882–892, Corrigendum in 2014, 15, 305. [Google Scholar] [CrossRef] [Scilit]
- Krüger-Genge, A.; Blocki, A.; Franke, R.P.; Jung, F. Vascular Endothelial Cell Biology: An Update. Int. J. Mol. Sci. 2019, 20, 4411. [Google Scholar] [CrossRef] [Scilit]
- Wong, E.; Xu, F.; Joffre, J.; Nguyen, N.; Wilhelmsen, K.; Hellman, J. ERK1/2 has Divergent Roles in LPS-Induced Microvascular Endothelial Cell Cytokine Production and Permeability. Shock 2021, 55, 349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khakpour, S.; Wilhelmsen, K.; Hellman, J. Vascular endothelial cell Toll-like receptor pathways in sepsis. Innate Immun. 2015, 21, 827–846. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hosseinkhani, B.; Kuypers, S.; van den Akker, N.; Molin, D.G.; Michiels, L. Extracellular Vesicles Work as a Functional Inflammatory Me-diator Between Vascular Endothelial Cells and Immune Cells. Front. Immunol. 2018, 9, 1789. [Google Scholar] [CrossRef] [Scilit]
- Ríos-Navarro, C.; de Pablo, C.; Collado-Diaz, V.; Orden, S.; Blas-Garcia, A.; Martínez-Cuesta, M.Á.; Esplugues, J.V.; Alvarez, A. Differential effects of anti-TNF-α and anti-IL-12/23 agents on human leukocyte–endothelial cell interactions. Eur. J. Pharmacol. 2015, 765, 355–365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Luo, R.; Fang, L.; Wang, D.; Bi, J.; Chen, H.; Xiao, S. Porcine reproductive and respiratory syndrome virus (PRRSV) infection activates chemokine RANTES in MARC-145 cells. Mol. Immunol. 2011, 48, 586–591. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gómez-Laguna, J.; Salguero, F.J.; Barranco, I.; Pallarés, F.J.; Rodríguez-Gómez, I.M.; Bernabé, A.; Carrasco, L. Cytokine Expression by Macrophages in the Lung of Pigs Infected with the Porcine Reproductive and Respiratory Syndrome Virus. J. Comp. Pathol. 2009, 142, 51–60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Guo, X.; Ge, X.; Chen, Y.; Sun, Q.; Yang, H. Changes in the Cellular Proteins of Pulmonary Alveolar Macrophage Infected with Porcine Reproductive and Respiratory Syndrome Virus by Proteomics Analysis. J. Proteome Res. 2009, 8, 3091–3097. [Google Scholar] [CrossRef] [Scilit]
- Zeng, N.; Wang, C.; Liu, S.; Miao, Q.; Zhou, L.; Ge, X.; Han, J.; Guo, X.; Yang, H. Transcriptome Analysis Reveals Dynamic Gene Expression Profiles in Porcine Alveolar Macrophages in Response to the Chinese Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus. BioMed Res. Int. 2018, 2018, 1538127. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, R36. [Google Scholar] [CrossRef] [Scilit]
- Beatty, P.R.; Puerta-Guardo, H.; Killingbeck, S.S.; Glasner, D.R.; Hopkins, K.; Harris, E. Dengue virus NS1 triggers endothelial permeability and vascular leak that is prevented by NS1 vaccination. Sci. Transl. Med. 2015, 7, 304ra141. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.J.; Huh, D.; Hamilton, G.; Ingber, D.E. Human gut-on-a-chip inhabited by microbial flora that experiences intestinal peristalsis-like motions and flow. Lab. Chip 2012, 12, 2165–2174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Wu, Z.; Liu, K.; Qi, P.; Xu, J.; Wei, J.; Li, B.; Shao, D.; Shi, Y.; Qiu, Y.; et al. Proteomic Analysis of the Secretome of Porcine Alveolar Macrophages Infected with Porcine Reproductive and Respiratory Syndrome Virus. Proteomics 2017, 17, 1700080. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.M.; Kleiboeker, S.B. Porcine arterivirus activates the NF-κB pathway through IκB degradation. Virology 2005, 342, 47–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mateu, E.; Diaz, I. The challenge of PRRS immunology. Vet. J. 2008, 177, 345–351. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Petrache, I.; Birukova, A.; Ramirez, S.I.; Garcia, J.G.N.; Verin, A.D. The Role of the Microtubules in Tumor Necrosis Factor-α–Induced Endothelial Cell Permeability. Am. J. Respir. Cell Mol. Biol. 2003, 28, 574–581. [Google Scholar] [CrossRef] [Scilit]
- Koh, H.; Tasaka, S.; Hasegawa, N.; Asano, K.; Kotani, T.; Morisaki, H.; Takeda, J.; Fujishima, S.; Matsuda, T.; Hashimoto, S.; et al. Vascular endothelial growth factor in epithelial lining fluid of patients with acute respiratory distress syndrome. Respirology 2007, 13, 281–284. [Google Scholar] [CrossRef] [Scilit]
- Mura, M.; Santos, C.; Stewart, D.; Liu, M. Vascular endothelial growth factor and related molecules in acute lung injur. J. Appl. Physiol. 2004, 97, 1605–1617. [Google Scholar] [CrossRef] [Scilit]
- Nagy, J.A.; Benjamin, L.; Zeng, H.; Dvorak, A.M.; Dvorak, H.F. Vascular permeability, vascular hyperpermeability and angiogenesis. Angiogenesis 2008, 11, 109–119. [Google Scholar] [CrossRef] [Scilit]
- Chai, Q.; He, W.Q.; Zhou, M.; Lu, H.; Fu, Z.F. Enhancement of Blood-Brain Barrier Permeability and Reduction of Tight Junction Protein Expression Are Modulated by Chemokines/Cytokines Induced by Rabies Virus Infection. J. Virol. 2014, 88, 4698–4710. [Google Scholar] [CrossRef] [Scilit]
- Hayer, A.; Shao, L.; Chung, M.; Joubert, L.M.; Yang, H.W.; Tsai, F.C.; Bisaria, A.; Betzig, E.; Meyer, T. Engulfed cadherin fingers are polarized junctional structures between collectively migrating endothelial cells. Nat. Cell Biol. 2016, 18, 1311–1323. [Google Scholar] [CrossRef] [Scilit] [PubMed]











| Names * | Primer Sequence (5′-3′) |
|---|---|
| β-actin-F | ACCACCATGTACCCAGGCAT |
| β-actin-R | GGACTCGTCGTACTCCTGCT |
| CCL20-F | AAGCAACTTTGACTGCTGCC |
| CCL20-R | GGATCTGCACACACGGCTAA |
| STAT1-F | CCATTGGTCCTGAAGACTGGAG |
| STAT1-R | TTCGTGTGAGTGCCCAAAATG |
| CLDN1-F | CCGTGCCTTGATGGTAATTG |
| CLDN1-R | ACCATGCTGTGGCAACTAAG |
| CLDN4-F | TGGATGATGAGAGCGCCAAG |
| CLDN4-R | GGGATTGTAGAAGTCGCGGA |
| CLDN8-F | TGGTGGTGTTGGAATGGTGG |
| CLDN8-R | GTTGCTTCCAATGAAGGCGG |
| OCLN-F | GCTGGAGGAAGACTGGAT |
| OCLN-R | ATCCGCAGATCCCTTAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, W.; Wu, W.; Jiang, N.; Ge, X.; Zhang, Y.; Han, J.; Guo, X.; Zhou, L.; Yang, H. Highly Pathogenic PRRSV-Infected Alveolar Macrophages Impair the Function of Pulmonary Microvascular Endothelial Cells. Viruses 2022, 14, 452. https://doi.org/10.3390/v14030452
Sun W, Wu W, Jiang N, Ge X, Zhang Y, Han J, Guo X, Zhou L, Yang H. Highly Pathogenic PRRSV-Infected Alveolar Macrophages Impair the Function of Pulmonary Microvascular Endothelial Cells. Viruses. 2022; 14(3):452. https://doi.org/10.3390/v14030452
Chicago/Turabian StyleSun, Weifeng, Weixin Wu, Nan Jiang, Xinna Ge, Yongning Zhang, Jun Han, Xin Guo, Lei Zhou, and Hanchun Yang. 2022. "Highly Pathogenic PRRSV-Infected Alveolar Macrophages Impair the Function of Pulmonary Microvascular Endothelial Cells" Viruses 14, no. 3: 452. https://doi.org/10.3390/v14030452
APA StyleSun, W., Wu, W., Jiang, N., Ge, X., Zhang, Y., Han, J., Guo, X., Zhou, L., & Yang, H. (2022). Highly Pathogenic PRRSV-Infected Alveolar Macrophages Impair the Function of Pulmonary Microvascular Endothelial Cells. Viruses, 14(3), 452. https://doi.org/10.3390/v14030452

