Mammalian Orthoreovirus (MRV) Is Widespread in Wild Ungulates of Northern Italy
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Sample Preparation and RNA Extraction
2.3. Reverse Transcription
2.4. Nested-PCR
2.5. Mengovirus Real-Time PCR
2.6. MRV Type 3 Typing PCR
2.7. Sequencing
2.8. Viral Isolation
2.9. Statistical Analysis
3. Results
3.1. Sampling and MRV Prevalence
3.2. MRV Type 3 Typing PCR
3.3. Confirmation by Sequencing
3.4. Viral Isolation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mertens, P. The dsRNA viruses. Virus Res. 2004, 101, 3–13. [Google Scholar] [CrossRef] [Scilit]
- Coombs, K.M. Reovirus Structure and Morphogenesis. Curr. Top. Microbiol. Immunol. 2006, 309, 117–167. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.; Liu, L.; Wang, P.; Liu, S.; Lin, W.; Hu, F.; Wu, W.; Chen, W.; Cui, S. A potentially novel reovirus isolated from swine in northeastern China in 2007. Virus Genes 2011, 43, 342–349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Day, J.M. The diversity of the orthoreoviruses: Molecular taxonomy and phylogentic divides. Infect. Genet. Evol. 2009, 9, 390–400. [Google Scholar] [CrossRef] [Scilit]
- ViralZone Root. Available online: https://viralzone.expasy.org/ (accessed on 2 November 2020).
- Sabin, A.B. Reoviruses: A new group of respiratory and enteric viruses formerly classified as ECHO type 10 is described. Science 1959, 130, 1387–1389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lelli, D.; Moreno, A.; Lavazza, A.; Bresaola, M.; Canelli, E.; Boniotti, M.B.; Cordioli, P. Identification of Mammalian Orthoreovirus Type 3 in Italian Bats. Zoonoses Public Health 2012, 60, 84–92. [Google Scholar] [CrossRef] [Scilit]
- Guglielmi, K.M.; Johnson, E.M.; Stehle, T.; Dermody, T.S. Attachment and Cell Entry of Mammalian Orthoreovirus. Curr. Top. Microbiol. Immunol. 2006, 309, 1–38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schiff, L.A.; Nibert, M.L.; Tyler, K.L. Orthoreoviruses and Their Replication, In Fields Virology, 5th ed.; Fields, B.N., Knipe, D.M., Howley, P.M., Eds.; Lippincott Williams and Wilkins: Philadelphia, PA, USA, 2007; Volume 2, pp. 1853–1915. [Google Scholar]
- Ahasan, M.S.; Subramaniam, K.; Sayler, K.A.; Loeb, J.C.; Popov, V.L.; Lednicky, J.A.; Wisely, S.M.; Krauer, J.M.C.; Waltzek, T.B. Molecular characterization of a novel reassortment Mammalian orthoreovirus type 2 isolated from a Florida white-tailed deer fawn. Virus Res. 2019, 270, 197642. [Google Scholar] [CrossRef] [Scilit]
- Besozzi, M.; Lauzi, S.; Lelli, D.; Lavazza, A.; Chiapponi, C.; Pisoni, G.; Viganò, R.; Lanfranchi, P.; Luzzago, C. Host range of mammalian orthoreovirus type 3 widening to alpine chamois. Vet. Microbiol. 2019, 230, 72–77. [Google Scholar] [CrossRef] [Scilit]
- Chapell, J.D.; Goral, M.I.; Rodgers, S.E.; Depamphilis, C.W.; Dermody, T.S. Sequence diversity within the reovirus S2 gene: Reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif. J. Virol. 1994, 68, 750–756. [Google Scholar] [CrossRef] [Scilit]
- Steyer, A.; Gutiérrez-Aguire, I.; Kolenc, M.; Koren, S.; Kutnjak, D.; Pokorn, M.; Poljšak-Prijatelj, M.; Rački, N.; Ravnikar, M.; Sagadin, M.; et al. High Similarity of Novel Orthoreovirus Detected in a Child Hospitalized with Acute Gastroenteritis to Mammalian Orthoreoviruses Found in Bats in Europe. J. Clin. Microbiol. 2013, 51, 3818–3825. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Liu, D.; Ran, X.; Liu, C.; Guo, D.; Hu, X.; Tian, J.; Zhang, X.; Shao, Y.; Liu, S.; et al. Characterization and pathogenicity of a novel mammalian orthoreovirus from wild short-nosed fruit bats. Infect. Genet. Evol. 2016, 43, 347–353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Narayanappa, A.T.; Sooryanarain, H.; Deventhiran, J.; Cao, D.; Venkatachalam, B.A.; Kambiranda, D.; Leroith, T.; Heffron, C.L.; Lindstrom, N.; Hall, K.; et al. A Novel Pathogenic Mammalian Orthoreovirus from Diarrheic Pigs and Swine Blood Meal in the United States. mBio 2015, 6, e00593-15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kohl, C.; Lesnik, R.; Brinkmann, A.; Ebinger, A.; Radonic, A.; Nitsche, A.; Mühldorfer, K.; Wibbelt, G.; Kurth, A. Isolation and Characterization of Three Mammalian Orthoreoviruses from European Bats. PLoS ONE 2012, 7, e43106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naglič, T.; Rihtarič, D.; Hostnik, P.; Toplak, N.; Koren, S.; Kuhar, U.; Jamnikar-Ciglenečki, U.; Kutnjak, D.; Steyer, A. Identification of novel reassortant mammalian orthoreoviruses from bats in Slovenia. BMC Vet. Res. 2018, 14, 264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ouattara, L.A.; Barin, F.; Barthez, M.A.; Bonnaud, B.; Roingeard, P.; Goudeau, A.; Castelnau, P.; Vernet, G.; Paranhos-Baccalà, G.; Komurian-Pradel, F. Novel Human Reovirus Isolated from Children with Acute Necrotizing Encephalopathy. Emerg. Infect. Dis. 2011, 17, 1436–1444. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lelli, D.; Beato, M.S.; Cavicchio, L.; Lavazza, A.; Chiapponi, C.; Leopardi, S.; Baioni, L.; De Benedictis, P.; Moreno, A. First identification of mammalian orthoreovirus type 3 in diarrheic pigs in Europe. Virol. J. 2016, 13, 139. [Google Scholar] [CrossRef] [Scilit]
- Spinner, M.L.; Di Giovanni, G.D. Detection and Identification of Mammalian Reoviruses in Surface Water by Combined Cell Culture and Reverse Transcription-PCR. Appl. Environ. Microbiol. 2001, 67, 3016–3020. [Google Scholar] [CrossRef] [Scilit]
- Muscillo, M.; La Rosa, G.; Marianelli, C.; Zaniratti, S.; Rosaria, C.M.; Cantiani, L.; Carducci, A. A new RT-PCR method for the identification of reoviruses in seawater samples. Water Res. 2001, 35, 548–556. [Google Scholar] [CrossRef] [Scilit]
- Sedmak, G.; Bina, D.; Macdonald, J.; Couillard, L. Nine-Year Study of the Occurrence of Culturable Viruses in Source Water for Two Drinking Water Treatment Plants and the Influent and Effluent of a Wastewater Treatment Plant in Milwaukee, Wisconsin (August 1994 through July 2003). Appl. Environ. Microbiol. 2005, 71, 1042–1050. [Google Scholar] [CrossRef] [Scilit]
- Tani, N.; Dohi, Y.; Kurumatani, N.; Yonemasu, K. Seasonal Distribution of Adenoviruses, Enteroviruses and Reoviruses in Urban River Water. Microbiol. Immunol. 1995, 39, 577–580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwon, H.-J.; Kim, H.-H.; Kim, H.-J.; Park, J.-G.; Son, K.-Y.; Jung, J.; Lee, W.S.; Cho, K.-O.; Park, S.-J.; Kang, M.-I. Detection and molecular chracterization of porcine type 3 orthoreoviruses circulating in South Korea. Vet. Microbiol. 2012, 157, 456–463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, P.; Li, H.; Wang, J.-W.; Wang, B.; Xie, R.-H.; Xu, H.; Zhao, L.-Y.; Li, L.; Pan, Y.; Song, Y.; et al. Genetic and pathogenic characterization of a novel reassortant mammalian orthoreovirus 3 (MRV3) from a diarrheic piglet and seroepidemiological survey of MRV3 in diarrheic pigs from east China. Vet. Microbiol. 2017, 208, 126–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kokubu, T.; Takahashi, T.; Takamura, K.; Yasuda, H.; Hiramatsu, K.; Nakai, M. Isolation of Reovirus Type 3 from Dogs with Diarrhea. J. Vet. Med Sci. 1993, 55, 453–454. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- DeCaro, N.; Campolo, M.; Desario, C.; Ricci, D.; Camero, M.; Lorusso, E.; Elia, G.; Lavazza, A.; Martella, V.; Buonavoglia, C. Virological and molecular characterization of a mammalian orthoreovirus type 3 strain isolated from a dog in Italy. Vet. Microbiol. 2005, 109, 19–27. [Google Scholar] [CrossRef] [Scilit]
- Engeman, R.M.; Massei, G.; Sage, M.; Gentle, M.N. Monitoring wild pig populations: A review of methods. Environ. Sci. Pollut. Res. 2013, 20, 8077–8091. [Google Scholar] [CrossRef] [Scilit]
- Istituto Superiore per la Protezione e la Ricerca Ambientale. Available online: https://www.isprambiente.gov.it/it (accessed on 1 December 2020).
- Leary, T.; Erker, J.C.; Chalmers, M.L.; Cruz, A.T.; Wetzel, J.D.; Desai, S.M.; Mushahwar, I.K.; Dermody, T.S. Detection of Mammalian Reovirus RNA by Using Reverse Transcription-PCR: Sequence Diversity within the λ3-Encoding L1 Gene. J. Clin. Microbiol. 2002, 40, 1368–1375. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chiari, M.; Zanoni, M.; Tagliabue, S.; Lavazza, A.; Alborali, L.G. Salmonella serotypes in wild boars (Sus scrofa) hunted in northern Italy. Acta Vet. Scand. 2013, 55, 42. [Google Scholar] [CrossRef] [Scilit]
- Mann, M.A.; Knipe, D.M.; Fischbach, G.D.; Fields, B.N. Type 3 Reovirus Neuroinvasion after Intramuscular Inoculation: Direct Invasion of Nerve Terminals and Age-Dependent Pathogenesis. Virology 2002, 303, 222–231. [Google Scholar] [CrossRef] [Scilit]
- Tyler, K.L.; Barton, E.S.; Ibach, M.L.; Robinson, C.; Campbell, J.A.; O’Donnell, S.M.; Valyi-Nagy, T.; Clarke, P.; Wetzel, J.D.; Dermody, T.S. Isolation and Molecular Characterization of a Novel Type 3 Reovirus from a Child with Meningitis. J. Infect. Dis. 2004, 189, 1664–1675. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tai, J.H.; Williams, J.V.; Edwards, K.M.; Wright, P.F.; Crowe, J.E.; Dermody, T.S. Prevalence of Reovirus-Specific Antibodies in Young Children in Nashville, Tennessee. J. Infect. Dis. 2005, 191, 1221–1224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lewandowska, D.W.; Capaul, R.; Prader, S.; Zagordi, O.; Geissberger, F.-D.; Kügler, M.; Knorr, M.; Berger, C.; Gungor, T.; Reichenbach, J.; et al. Persistent mammalian orthoreovirus, coxsackievirus and adenovirus co-infection in a child with a primary immunodeficiency detected by metagenomic sequencing: A case report. BMC Infect. Dis. 2018, 18, 33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamamoto, S.P.; Motooka, D.; Egawa, K.; Kaida, A.; Hirai, Y.; Kubo, H.; Motomura, K.; Nakamura, S.; Iritani, N. Novel human reovirus isolated from children and its long-term circulation with reassortments. Sci. Rep. 2020, 10, 963–967. [Google Scholar] [CrossRef] [Scilit] [PubMed]
| Name | Type | Sequence | Position 1 | Amplicon Size |
|---|---|---|---|---|
| L1-rv5 | Forward | 5′–GCATCCATTGTAAATGACGAGTCTG–3′ | 1888–1912 | 416 bp |
| L1-rv6 | Reverse | 5′–CTTGAGATTAGCTCTAGCATCTTCTG–3′ | 2278–2303 | |
| L1-rv7 | Forward | 5′–GCTAGGCCGATATCGGGAATGCAG–3′ | 1930–1953 | 344 bp |
| L1-rv8 | Reverse | 5′–GTCTCACTATTCACCTTACCAGCAG–3′ | 2249–2273 |
| Name | Type | Sequence |
|---|---|---|
| Mengo 110 | Forward | 5′–GCGGGTCCTGCCGAAAGT–3′ |
| Mengo 209 | Reverse | 5′–GAAGTAACATATAGACAGACGCACAC–3′ |
| Mengo 147 | Probe | 5′–FAM–ATCACATTACTGGCCGAAGC–MGB–3′ |
| Name | Type | Sequence | Position 1 | Amplicon Size |
|---|---|---|---|---|
| S1-R3F | Forward | 5′–TGGGACAACTTGAGACAGGA–3′ | 338–357 | 326 bp |
| S1-R3R | Reverse | 5′–CTGAAGTCCACCRTTTTGWA–3′ | 644–663 |
| Sampling Area | Gender | Collection Year | Age Class 1 | Total Samples | ||
|---|---|---|---|---|---|---|
| 0 | 1 | 2 | ||||
| SO | Male | 2018/2019 | 10 | 23 | 15 | 106 |
| 2019/2020 | 12 | 34 | 12 | |||
| Female | 2018/2019 | 3 | 19 | 12 | 55 | |
| 2019/2020 | 5 | 11 | 5 | |||
| Total samples | 30 | 87 | 44 | 161 | ||
| PR | Male | 2018/2019 | 1 | 17 | 20 | 74 |
| 2019/2020 | 13 | 6 | 17 | |||
| Female | 2018/2019 | 1 | 23 (6) | 43 (32) | 101 (38) | |
| 2019/2020 | 6 | 9 | 19 | |||
| Total samples | 21 | 55 | 99 | 175 | ||
| Gender | Total Samples | Age Class 1 | ||
|---|---|---|---|---|
| 0 | 1 | 2 | ||
| Male | 48 | 19 | 14 | 15 |
| Female | 70 | 16 | 10 | 44 |
| Total samples | 118 | 35 | 24 | 59 |
| Wild Ruminants (n = 128) | Wild Boars (n = 336) | Overall (n = 464) | |
|---|---|---|---|
| Gender | |||
| Males | 39.8% (27.5–53.5%) | 28.2% (21.4–36.1%) | 38.2% (31.6–45.4%) |
| Females | 40.3% (28.8–53.0%) | 28.9% (21.2–38.1%) | 33.1% (26.7–40.2%) |
| Age class | |||
| Class 0 | 41.7% (26.9–58.1%) | 29.8% (18.6–44.0%) | 39.2% (29.4–50.0%) |
| Class 1 | 42.3% (25.2–61.5%) | 30.4% (22.8–39.3%) | 39.9% (31.9–48.5%) |
| Class 2 | 36.2% (25.1–49.0%) | 25.6% (18.4–34.4%) | 28.3% (22.3–35.2%) |
| Collection year | |||
| 2016–2017 | 43.3% (31.5–56.0%) | – | |
| 2017–2018 | 65.6% (47.9–79.8%) * | ||
| 2018–2019 | 8.3% (2.7–22.9%) * | 21.2% (15.3–28.7%) | |
| 2019–2020 | – | 37.2% (29.1–46.1%) * | |
| Sampling area | |||
| Parma | 15.4% (10.8–21.5%) | ||
| Sondrio | 45.3% (37.8–53.0%) * |
| Sampling Area | Collection Year | Number of Analyzed Samples | Number of MRV Positive Samples | MRV Prevalence (95% CI) |
|---|---|---|---|---|
| SO | 2018–2019 | 82 | 25 | 30.4% (21.5–41.1%) |
| 2019–2020 | 79 | 48 | 60.7% (49.7–70.7%) | |
| Total | 161 | 73 | 45.3% (37.8–53.0%) | |
| PR | 2018–2019 | 105 | 16 | 15.2% (9.6–23.3%) |
| 2019–2020 | 70 | 11 | 15.7% (9.0–25.9%) | |
| Total | 175 | 27 | 15.4% (10.8–21.5%) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arnaboldi, S.; Righi, F.; Filipello, V.; Trogu, T.; Lelli, D.; Bianchi, A.; Bonardi, S.; Pavoni, E.; Bertasi, B.; Lavazza, A. Mammalian Orthoreovirus (MRV) Is Widespread in Wild Ungulates of Northern Italy. Viruses 2021, 13, 238. https://doi.org/10.3390/v13020238
Arnaboldi S, Righi F, Filipello V, Trogu T, Lelli D, Bianchi A, Bonardi S, Pavoni E, Bertasi B, Lavazza A. Mammalian Orthoreovirus (MRV) Is Widespread in Wild Ungulates of Northern Italy. Viruses. 2021; 13(2):238. https://doi.org/10.3390/v13020238
Chicago/Turabian StyleArnaboldi, Sara, Francesco Righi, Virginia Filipello, Tiziana Trogu, Davide Lelli, Alessandro Bianchi, Silvia Bonardi, Enrico Pavoni, Barbara Bertasi, and Antonio Lavazza. 2021. "Mammalian Orthoreovirus (MRV) Is Widespread in Wild Ungulates of Northern Italy" Viruses 13, no. 2: 238. https://doi.org/10.3390/v13020238
APA StyleArnaboldi, S., Righi, F., Filipello, V., Trogu, T., Lelli, D., Bianchi, A., Bonardi, S., Pavoni, E., Bertasi, B., & Lavazza, A. (2021). Mammalian Orthoreovirus (MRV) Is Widespread in Wild Ungulates of Northern Italy. Viruses, 13(2), 238. https://doi.org/10.3390/v13020238

