CBF-1 Promotes the Establishment and Maintenance of HIV Latency by Recruiting Polycomb Repressive Complexes, PRC1 and PRC2, at HIV LTR
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture, Cell Lines, Antibodies and Chemicals
2.2. HIV Lentiviral Vectors and Generation of VSV-G-Pseudotyped Viral Particles
2.3. Tyagi-Sahu Model to Generate Latently Infected Primary CD4+ T Cells
2.4. ChIP Assays and q-PCR
2.5. Western Blotting
2.6. Luciferase Assays
2.7. Transfection
2.8. Flow Cytometry
2.9. Cell Cytotoxicity: MTS Assay
2.10. Statistical Analysis
3. Results
3.1. CBF-1 Knockdown Disrupts the Latency Maintenance and Leads to the Proviral Reactivation in Primary T Cells
3.2. CBF-1 Recruited PRCs Play Direct Role in Sustaining HIV Provirus in Latent State
3.3. CBF-1 Promotes HIV Latency by Inducing Multiple Types of Repressive Epigenetic Modifications at HIV LTR
3.4. CBF-1 Promotes Both the Establishment and the Maintenance of HIV Latency by Recruiting PRCs at HIV LTR
3.5. CBF-1 Recruited PRCs Facilitate HIV Latency in Primary CD4+ T Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Finzi, D.; Blankson, J.; Siliciano, J.D.; Margolick, J.B.; Chadwick, K.; Pierson, T.; Smith, K.; Lisziewicz, J.; Lori, F.; Flexner, C.; et al. Latent infection of CD4+ T cells provides a mechanism for lifelong persistence of HIV-1, even in patients on effective combination therapy. Nat. Med. 1999, 5, 512–517. [Google Scholar] [CrossRef] [Scilit]
- Wong, J.K.; Hezareh, M.; Gunthard, H.F.; Havlir, D.V.; Ignacio, C.C.; Spina, C.A.; Richman, D.D. Recovery of replication-competent HIV despite prolonged suppression of plasma viremia. Science 1997, 278, 1291–1295. [Google Scholar] [CrossRef] [Scilit]
- Chun, T.W.; Davey, R.T., Jr.; Engel, D.; Lane, H.C.; Fauci, A.S. Re-emergence of HIV after stopping therapy. Nature 1999, 401, 874–875. [Google Scholar] [CrossRef] [Scilit]
- Brennan, T.P.; Woods, J.O.; Sedaghat, A.R.; Siliciano, J.D.; Siliciano, R.F.; Wilke, C.O. Analysis of HIV-1 Viremia and Provirus in Resting CD4+ T Cells Reveals a Novel Source of Residual Viremia in Patients on Antiretroviral Therapy. J. Virol. 2009, 83, 8470–8481. [Google Scholar] [CrossRef] [Scilit]
- Joos, B.; Fischer, M.; Kuster, H.; Pillai, S.K.; Wong, J.K.; Boni, J.; Hirschel, B.; Weber, R.; Trkola, A.; Gunthard, H.F. HIV rebounds from latently infected cells, rather than from continuing low-level replication. Proc. Natl. Acad. Sci. USA 2008, 105, 16725–16730. [Google Scholar] [CrossRef] [Scilit]
- Siliciano, J.D.; Kajdas, J.; Finzi, D.; Quinn, T.C.; Chadwick, K.; Margolick, J.B.; Kovacs, C.; Gange, S.J.; Siliciano, R.F. Long-term follow-up studies confirm the stability of the latent reservoir for HIV-1 in resting CD4+ T cells. Nat. Med. 2003, 9, 727–728. [Google Scholar] [CrossRef] [Scilit]
- Chomont, N.; El-Far, M.; Ancuta, P.; Trautmann, L.; Procopio, F.A.; Yassine-Diab, B.; Boucher, G.; Boulassel, M.R.; Ghattas, G.; Brenchley, J.M.; et al. HIV reservoir size and persistence are driven by T cell survival and homeostatic proliferation. Nat. Med. 2009, 15, 893–900. [Google Scholar] [CrossRef] [Scilit]
- Chun, T.W.; Nickle, D.C.; Justement, J.S.; Large, D.; Semerjian, A.; Curlin, M.E.; O’Shea, M.A.; Hallahan, C.W.; Daucher, M.; Ward, D.J.; et al. HIV-infected individuals receiving effective antiviral therapy for extended periods of time continually replenish their viral reservoir. J. Clin. Investig. 2005, 115, 3250–3255. [Google Scholar] [CrossRef] [Scilit]
- Tyagi, M.; Bukrinsky, M. Human immunodeficiency virus (HIV) latency: The major hurdle in HIV eradication. Mol. Med. 2012, 18, 1096–1108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hosmane, N.N.; Kwon, K.J.; Bruner, K.M.; Capoferri, A.A.; Beg, S.; Rosenbloom, D.I.; Keele, B.F.; Ho, Y.C.; Siliciano, J.D.; Siliciano, R.F. Proliferation of latently infected CD4(+) T cells carrying replication-competent HIV-1: Potential role in latent reservoir dynamics. J. Exp. Med. 2017, 214, 959–972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dinoso, J.B.; Kim, S.Y.; Wiegand, A.M.; Palmer, S.E.; Gange, S.J.; Cranmer, L.; O’Shea, A.; Callender, M.; Spivak, A.; Brennan, T.; et al. Treatment intensification does not reduce residual HIV-1 viremia in patients on highly active antiretroviral therapy. Proc. Natl. Acad. Sci. USA 2009, 106, 9403–9408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mbonye, U.; Karn, J. Transcriptional control of HIV latency: Cellular signaling pathways, epigenetics, happenstance and the hope for a cure. Virology 2014, 454–455, 328–339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siliciano, R.F.; Greene, W.C. HIV latency. Cold Spring Harb. Perspect. Med. 2011, 1, a007096. [Google Scholar] [CrossRef] [Scilit]
- Tyagi, M.; Romerio, F. Models of HIV-1 Persistence in the CD4+ T Cell Compartment: Past, Present and Future. Curr. HIV Res. 2011, 9, 579–587. [Google Scholar] [CrossRef] [Scilit]
- Hakre, S.; Chavez, L.; Shirakawa, K.; Verdin, E. Epigenetic regulation of HIV latency. Curr. Opin. HIV AIDS 2011, 6, 19–24. [Google Scholar] [CrossRef] [Scilit]
- Karn, J. The molecular biology of HIV latency: Breaking and restoring the Tat-dependent transcriptional circuit. Curr. Opin. HIV AIDS 2011, 6, 4–11. [Google Scholar] [CrossRef] [Scilit]
- Margolis, D.M. Mechanisms of HIV latency: An emerging picture of complexity. Curr. HIV/AIDS Rep. 2010, 7, 37–43. [Google Scholar] [CrossRef] [Scilit]
- Choudhary, S.K.; Margolis, D.M. Curing HIV: Pharmacologic Approaches to Target HIV-1 Latency. Ann. Rev. Pharmacol. Toxicol. 2011, 51, 397–418. [Google Scholar] [CrossRef] [Scilit]
- Margolis, D.M. Histone deacetylase inhibitors and HIV latency. Curr. Opin. HIV AIDS 2011, 6, 25–29. [Google Scholar] [CrossRef] [Scilit]
- Tyagi, M.; Karn, J. CBF-1 promotes transcriptional silencing during the establishment of HIV-1 latency. EMBO J. 2007, 26, 4985–4995. [Google Scholar] [CrossRef] [Scilit]
- Lai, E. Keeping a good pathway down: Transcriptional repression of Notch pathway target genes by CSL proteins. EMBO Rep. 2002, 3, 840–845. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Borggrefe, T.; Oswald, F. The Notch signaling pathway: Transcriptional regulation at Notch target genes. Cell Mol. Life Sci. 2009, 66, 1631–1646. [Google Scholar] [CrossRef] [Scilit]
- Ehebauer, M.; Hayward, P.; Arias, A.M. Notch, a universal arbiter of cell fate decisions. Science 2006, 314, 1414–1415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tyagi, M.; Pearson, R.J.; Karn, J. Establishment of HIV latency in primary CD4+ cells is due to epigenetic transcriptional silencing and P-TEFb restriction. J. Virol. 2010, 84, 6425–6437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liefke, R.; Oswald, F.; Alvarado, C.; Ferres-Marco, D.; Mittler, G.; Rodriguez, P.; Dominguez, M.; Borggrefe, T. Histone demethylase KDM5A is an integral part of the core Notch-RBP-J repressor complex. Genes Dev. 2010, 24, 590–601. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martinez, A.M.; Schuettengruber, B.; Sakr, S.; Janic, A.; Gonzalez, C.; Cavalli, G. Polyhomeotic has a tumor suppressor activity mediated by repression of Notch signaling. Nat. Genet. 2009, 41, 1076–1082. [Google Scholar] [CrossRef] [Scilit]
- Merdes, G.; Paro, R. About combs, notches, and tumors: Epigenetics meets signaling. Dev. Cell 2009, 17, 440–442. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- du Chene, I.; Basyuk, E.; Lin, Y.L.; Triboulet, R.; Knezevich, A.; Chable-Bessia, C.; Mettling, C.; Baillat, V.; Reynes, J.; Corbeau, P.; et al. Suv39H1 and HP1gamma are responsible for chromatin-mediated HIV-1 transcriptional silencing and post-integration latency. EMBO J. 2007, 26, 424–435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Imai, K.; Togami, H.; Okamoto, T. Involvement of histone H3 lysine 9 (H3K9) methyltransferase G9a in the maintenance of HIV-1 latency and its reactivation by BIX01294. J. Biol. Chem. 2010, 285, 16538–16545. [Google Scholar] [CrossRef] [Scilit]
- Marban, C.; Suzanne, S.; Dequiedt, F.; de Walque, S.; Redel, L.; Van Lint, C.; Aunis, D.; Rohr, O. Recruitment of chromatin-modifying enzymes by CTIP2 promotes HIV-1 transcriptional silencing. EMBO J. 2007, 26, 412–423. [Google Scholar] [CrossRef] [Scilit]
- Pearson, R.; Kim, Y.K.; Hokello, J.; Lassen, K.; Friedman, J.; Tyagi, M.; Karn, J. Epigenetic silencing of human immunodeficiency virus (HIV) transcription by formation of restrictive chromatin structures at the viral long terminal repeat drives the progressive entry of HIV into latency. J. Virol. 2008, 82, 12291–12303. [Google Scholar] [CrossRef] [Scilit]
- Kouzarides, T. Chromatin modifications and their function. Cell 2007, 128, 693–705. [Google Scholar] [CrossRef] [Scilit]
- Shen, L.; Siliciano, R.F. Viral reservoirs, residual viremia, and the potential of highly active antiretroviral therapy to eradicate HIV infection. J. Allergy Clin. Immunol. 2008, 122, 22–28. [Google Scholar] [CrossRef] [Scilit]
- Cao, R.; Wang, L.; Wang, H.; Xia, L.; Erdjument-Bromage, H.; Tempst, P.; Jones, R.S.; Zhang, Y. Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 2002, 298, 1039–1043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 2002, 12, 198–209. [Google Scholar] [CrossRef] [Scilit]
- Margueron, R.; Li, G.; Sarma, K.; Blais, A.; Zavadil, J.; Woodcock, C.L.; Dynlacht, B.D.; Reinberg, D. Ezh1 and Ezh2 maintain repressive chromatin through different mechanisms. Mol. Cell 2008, 32, 503–518. [Google Scholar] [CrossRef] [Scilit]
- Cao, H.; Ihm, Y.; Wang, C.-Z.; Morris, J.R.; Su, M.; Dobbs, D.; Ho, K.-M. Three-dimensional threading approach to protein structure recognition. Polymer 2004, 45, 687–697. [Google Scholar] [CrossRef] [Scilit]
- Margueron, R.; Reinberg, D. The Polycomb complex PRC2 and its mark in life. Nature 2011, 469, 343–349. [Google Scholar] [CrossRef] [Scilit]
- Li, G.; Margueron, R.; Ku, M.; Chambon, P.; Bernstein, B.E.; Reinberg, D. Jarid2 and PRC2, partners in regulating gene expression. Genes Dev. 2010, 24, 368–380. [Google Scholar] [CrossRef] [Scilit]
- Sewalt, R.G.; Lachner, M.; Vargas, M.; Hamer, K.M.; den Blaauwen, J.L.; Hendrix, T.; Melcher, M.; Schweizer, D.; Jenuwein, T.; Otte, A.P. Selective interactions between vertebrate polycomb homologs and the SUV39H1 histone lysine methyltransferase suggest that histone H3-K9 methylation contributes to chromosomal targeting of Polycomb group proteins. Mol. Cell Biol. 2002, 22, 5539–5553. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, R.; Tsukada, Y.; Zhang, Y. Role of Bmi-1 and Ring1A in H2A ubiquitylation and Hox gene silencing. Mol. Cell 2005, 20, 845–854. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lavigne, M.; Francis, N.J.; King, I.F.; Kingston, R.E. Propagation of silencing; recruitment and repression of naive chromatin in trans by polycomb repressed chromatin. Mol. Cell 2004, 13, 415–425. [Google Scholar] [CrossRef] [Scilit]
- Beisel, C.; Paro, R. Silencing chromatin: Comparing modes and mechanisms. Nat. Rev. Genet. 2011, 12, 123–135. [Google Scholar] [CrossRef] [Scilit]
- Enderle, D.; Beisel, C.; Stadler, M.B.; Gerstung, M.; Athri, P.; Paro, R. Polycomb preferentially targets stalled promoters of coding and noncoding transcripts. Genome Res. 2011, 21, 216–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuzmichev, A.; Nishioka, K.; Erdjument-Bromage, H.; Tempst, P.; Reinberg, D. Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein. Genes Dev. 2002, 16, 2893–2905. [Google Scholar] [CrossRef] [Scilit]
- van der Vlag, J.; Otte, A.P. Transcriptional repression mediated by the human polycomb-group protein EED involves histone deacetylation. Nat. Genet. 1999, 23, 474–478. [Google Scholar] [CrossRef] [Scilit]
- Vire, E.; Brenner, C.; Deplus, R.; Blanchon, L.; Fraga, M.; Didelot, C.; Morey, L.; Van Eynde, A.; Bernard, D.; Vanderwinden, J.M.; et al. The Polycomb group protein EZH2 directly controls DNA methylation. Nature 2006, 439, 871–874. [Google Scholar] [CrossRef] [Scilit]
- Hernandez-Munoz, I.; Lund, A.H.; van der Stoop, P.; Boutsma, E.; Muijrers, I.; Verhoeven, E.; Nusinow, D.A.; Panning, B.; Marahrens, Y.; van Lohuizen, M. Stable X chromosome inactivation involves the PRC1 Polycomb complex and requires histone MACROH2A1 and the CULLIN3/SPOP ubiquitin E3 ligase. Proc. Natl. Acad Sci. USA 2005, 102, 7635–7640. [Google Scholar] [CrossRef] [Scilit]
- Okamoto, I.; Otte, A.P.; Allis, C.D.; Reinberg, D.; Heard, E. Epigenetic dynamics of imprinted X inactivation during early mouse development. Science 2004, 303, 644–649. [Google Scholar] [CrossRef] [Scilit]
- Plath, K.; Fang, J.; Mlynarczyk-Evans, S.K.; Cao, R.; Worringer, K.A.; Wang, H.; de la Cruz, C.C.; Otte, A.P.; Panning, B.; Zhang, Y. Role of histone H3 lysine 27 methylation in X inactivation. Science 2003, 300, 131–135. [Google Scholar] [CrossRef] [Scilit]
- Silva, J.; Mak, W.; Zvetkova, I.; Appanah, R.; Nesterova, T.B.; Webster, Z.; Peters, A.H.; Jenuwein, T.; Otte, A.P.; Brockdorff, N. Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes. Dev. Cell 2003, 4, 481–495. [Google Scholar] [CrossRef] [Scilit]
- Friedman, J.; Cho, W.K.; Chu, C.K.; Keedy, K.S.; Archin, N.M.; Margolis, D.M.; Karn, J. Epigenetic silencing of HIV-1 by the histone H3 lysine 27 methyltransferase enhancer of Zeste 2. J. Virol. 2011, 85, 9078–9089. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matsuda, Y.; Kobayashi-Ishihara, M.; Fujikawa, D.; Ishida, T.; Watanabe, T.; Yamagishi, M. Epigenetic heterogeneity in HIV-1 latency establishment. Sci. Rep. 2015, 5, 7701. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, K.; Das, B.; Dobrowolski, C.; Karn, J. Multiple Histone Lysine Methyltransferases Are Required for the Establishment and Maintenance of HIV-1 Latency. MBio 2017, 8, e00133-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tripathy, M.K.; McManamy, M.E.; Burch, B.D.; Archin, N.M.; Margolis, D.M. H3K27 Demethylation at the Proviral Promoter Sensitizes Latent HIV to the Effects of Vorinostat in Ex Vivo Cultures of Resting CD4+ T Cells. J. Virol. 2015, 89, 8392–8405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zapata, J.C.; Campilongo, F.; Barclay, R.A.; DeMarino, C.; Iglesias-Ussel, M.D.; Kashanchi, F.; Romerio, F. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology 2017, 506, 34–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsia, S.C.; Shi, Y.B. Chromatin disruption and histone acetylation in regulation of the human immunodeficiency virus type 1 long terminal repeat by thyroid hormone receptor. Mol. Cell. Biol. 2002, 22, 4043–4052. [Google Scholar] [CrossRef] [Scilit]
- Coull, J.J.; Romerio, F.; Sun, J.M.; Volker, J.L.; Galvin, K.M.; Davie, J.R.; Shi, Y.; Hansen, U.; Margolis, D.M. The human factors YY1 and LSF repress the human immunodeficiency virus type 1 long terminal repeat via recruitment of histone deacetylase 1. J. Virol. 2000, 74, 6790–6799. [Google Scholar] [CrossRef] [Scilit]
- Imai, K.; Okamoto, T. Transcriptional repression of human immunodeficiency virus type 1 by AP-4. J. Biol. Chem. 2006, 281, 12495–12505. [Google Scholar] [CrossRef] [Scilit]
- Williams, S.A.; Chen, L.F.; Kwon, H.; Ruiz-Jarabo, C.M.; Verdin, E.; Greene, W.C. NF-kappaB p50 promotes HIV latency through HDAC recruitment and repression of transcriptional initiation. EMBO J. 2006, 25, 139–149. [Google Scholar] [CrossRef] [Scilit]
- Zufferey, R.; Dull, T.; Mandel, R.J.; Bukovsky, A.; Quiroz, D.; Naldini, L.; Trono, D. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J. Virol. 1998, 72, 9873–9880. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dull, T.; Zufferey, R.; Kelly, M.; Mandel, R.J.; Nguyen, M.; Trono, D.; Naldini, L. A third-generation lentivirus vector with a conditional packaging system. J. Virol. 1998, 72, 8463–8471. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naldini, L.; Blomer, U.; Gallay, P.; Ory, D.; Mulligan, R.; Gage, F.H.; Verma, I.M.; Trono, D. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 1996, 272, 263–267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sahu, G.K.; Lee, K.; Ji, J.; Braciale, V.; Baron, S.; Cloyd, M.W. A novel in vitro system to generate and study latently HIV-infected long-lived normal CD4+ T-lymphocytes. Virology 2006, 355, 127–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taube, R.; Peterlin, B.M. Lost in Transcription: Molecular Mechanisms that Control HIV Latency. Viruses 2013, 5, 902–927. [Google Scholar] [CrossRef] [Scilit]
- Miranda, T.B.; Cortez, C.C.; Yoo, C.B.; Liang, G.; Abe, M.; Kelly, T.K.; Marquez, V.E.; Jones, P.A. DZNep is a global histone methylation inhibitor that reactivates developmental genes not silenced by DNA methylation. Mol. Cancer Ther. 2009, 8, 1579–1588. [Google Scholar] [CrossRef] [Scilit]
- Mbonye, U.; Karn, J. Control of HIV latency by epigenetic and non-epigenetic mechanisms. Curr. HIV Res. 2011, 9, 554–567. [Google Scholar]
- Marban, C.; Redel, L.; Suzanne, S.; Van Lint, C.; Lecestre, D.; Chasserot-Golaz, S.; Leid, M.; Aunis, D.; Schaeffer, E.; Rohr, O. COUP-TF interacting protein 2 represses the initial phase of HIV-1 gene transcription in human microglial cells. Nucleic Acids Res. 2005, 33, 2318–2331. [Google Scholar] [CrossRef] [Scilit]
- Levy, Y.; Lacabaratz, C.; Weiss, L.; Viard, J.P.; Goujard, C.; Lelievre, J.D.; Boue, F.; Molina, J.M.; Rouzioux, C.; Avettand-Fenoel, V.; et al. Enhanced T cell recovery in HIV-1-infected adults through IL-7 treatment. J. Clin. Investig. 2009, 119, 997–1007. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Wang, X.; Lu, Z.; Zhang, B.; Guan, Z.; Liu, Z.; Zhong, Q.; Gu, L.; Zhou, J.; Zhu, B.; et al. Polycomb CBX7 directly controls trimethylation of histone H3 at lysine 9 at the p16 locus. PLoS ONE 2010, 5, e13732. [Google Scholar] [CrossRef] [Scilit]
- Fuks, F.; Hurd, P.J.; Deplus, R.; Kouzarides, T. The DNA methyltransferases associate with HP1 and the SUV39H1 histone methyltransferase. Nucleic Acids Res. 2003, 31, 2305–2312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, B.; Yao, B.; Li, J.L.; Fields, C.R.; Delmas, A.L.; Liu, C.; Robertson, K.D. DNMT1 and DNMT3B modulate distinct polycomb-mediated histone modifications in colon cancer. Cancer Res. 2009, 69, 7412–7421. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hervouet, E.; Peixoto, P.; Delage-Mourroux, R.; Boyer-Guittaut, M.; Cartron, P.F. Specific or not specific recruitment of DNMTs for DNA methylation, an epigenetic dilemma. Clin. Epigenet. 2018, 10, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pasini, D.; Hansen, K.H.; Christensen, J.; Agger, K.; Cloos, P.A.; Helin, K. Coordinated regulation of transcriptional repression by the RBP2 H3K4 demethylase and Polycomb-Repressive Complex 2. Genes Dev. 2008, 22, 1345–1355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Oevelen, C.; Wang, J.; Asp, P.; Yan, Q.; Kaelin, W.G., Jr.; Kluger, Y.; Dynlacht, B.D. A role for mammalian Sin3 in permanent gene silencing. Mol. Cell 2008, 32, 359–370. [Google Scholar] [CrossRef] [Scilit]
- Emiliani, S.; Fischle, W.; Ott, M.; van Lint, C.; Amella, C.A.; Verdin, E. Mutations in the Tat gene are responsible for human immunodeficiency virust type 1 postintegration latency in the U1 cell line. J. Virol. 1998, 72, 1666–1670. [Google Scholar] [CrossRef] [Scilit]
- Yukl, S.; Pillai, S.; Li, P.; Chang, K.; Pasutti, W.; Ahlgren, C.; Havlir, D.; Strain, M.; Gunthard, H.; Richman, D.; et al. Latently-infected CD4+ T cells are enriched for HIV-1 Tat variants with impaired transactivation activity. Virology 2009, 387, 98–108. [Google Scholar] [CrossRef] [Scilit]
- Verdin, E.; Becker, N.; Bex, F.; Droogmans, L.; Burny, A. Identification and characterization of an enhancer in the coding region of the genome of human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. USA 1990, 87, 4874–4878. [Google Scholar] [CrossRef] [Scilit]
- Verdin, E.; Paras, P.J.; Van Lint, C. Chromatin disruption in the promoter of human immunodeficiency virus type 1 during transcriptional activation. EMBO J. 1993, 12, 3249–3259. [Google Scholar] [CrossRef] [Scilit]
- Chittock, E.C.; Latwiel, S.; Miller, T.C.; Muller, C.W. Molecular architecture of polycomb repressive complexes. Biochem. Soc. Trans. 2017, 45, 193–205. [Google Scholar] [CrossRef] [Scilit]
- Connelly, K.E.; Dykhuizen, E.C. Compositional and functional diversity of canonical PRC1 complexes in mammals. Biochim. Biophys. Acta Gene Regul. Mech. 2017, 1860, 233–245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Margueron, R.; Reinberg, D. Chromatin structure and the inheritance of epigenetic information. Nat. Rev. Genet. 2010, 11, 285–296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoon, C.H.; Jang, D.H.; Kim, K.C.; Park, S.Y.; Kim, H.Y.; Kim, S.S.; Chi, S.G.; Choi, B.S. Disruption of polycomb repressor complex-mediated gene silencing reactivates HIV-1 provirus in latently infected cells. Intervirology 2014, 57, 116–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boyer, L.A.; Plath, K.; Zeitlinger, J.; Brambrink, T.; Medeiros, L.A.; Lee, T.I.; Levine, S.S.; Wernig, M.; Tajonar, A.; Ray, M.K.; et al. Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 2006, 441, 349–353. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Paucek, R.D.; Gooding, A.R.; Brown, Z.Z.; Ge, E.J.; Muir, T.W.; Cech, T.R. Molecular analysis of PRC2 recruitment to DNA in chromatin and its inhibition by RNA. Nat. Struct. Mol. Biol. 2017, 24, 1028–1038. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Name of Target Gene | Sequence (5′-3′) |
|---|---|
| SUZ12 | GCTGACAATCAAATGAATCAT |
| CCAAACCTCTTGCCACTAGAA | |
| GCTTACGTTTACTGGTTTCTT | |
| CGAAACTTCATGCTTCATCTA | |
| EED | GACACTCTGGTGGCAATATTT |
| CCTATAACAATGCAGTGTATA | |
| GTGCGATGGTTAGGCGATTTG | |
| CTGGATCTAGAGGCATAATTA | |
| EZH2 | CGGCTCCTCTAACCATGTTTA |
| CCCAACATAGATGGACCAAAT | |
| GCTGACCATTGGGACAGTAAA | |
| CAACACAAGTCATCCCATTAA | |
| BMI1 | ATTGATGCCACAACCATAATA |
| GGAACCTTTAAAGGATTATTA | |
| CAGCAAGTATTGTCCTATTTG | |
| TAATGGATATTGCCTACATTT | |
| Scrambled | TTGATGCACTTACTAGATTAC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sharma, A.L.; Hokello, J.; Sonti, S.; Zicari, S.; Sun, L.; Alqatawni, A.; Bukrinsky, M.; Simon, G.; Chauhan, A.; Daniel, R.; et al. CBF-1 Promotes the Establishment and Maintenance of HIV Latency by Recruiting Polycomb Repressive Complexes, PRC1 and PRC2, at HIV LTR. Viruses 2020, 12, 1040. https://doi.org/10.3390/v12091040
Sharma AL, Hokello J, Sonti S, Zicari S, Sun L, Alqatawni A, Bukrinsky M, Simon G, Chauhan A, Daniel R, et al. CBF-1 Promotes the Establishment and Maintenance of HIV Latency by Recruiting Polycomb Repressive Complexes, PRC1 and PRC2, at HIV LTR. Viruses. 2020; 12(9):1040. https://doi.org/10.3390/v12091040
Chicago/Turabian StyleSharma, Adhikarimayum Lakhikumar, Joseph Hokello, Shilpa Sonti, Sonia Zicari, Lin Sun, Aseel Alqatawni, Michael Bukrinsky, Gary Simon, Ashok Chauhan, Rene Daniel, and et al. 2020. "CBF-1 Promotes the Establishment and Maintenance of HIV Latency by Recruiting Polycomb Repressive Complexes, PRC1 and PRC2, at HIV LTR" Viruses 12, no. 9: 1040. https://doi.org/10.3390/v12091040
APA StyleSharma, A. L., Hokello, J., Sonti, S., Zicari, S., Sun, L., Alqatawni, A., Bukrinsky, M., Simon, G., Chauhan, A., Daniel, R., & Tyagi, M. (2020). CBF-1 Promotes the Establishment and Maintenance of HIV Latency by Recruiting Polycomb Repressive Complexes, PRC1 and PRC2, at HIV LTR. Viruses, 12(9), 1040. https://doi.org/10.3390/v12091040

