Avian Influenza A Virus Infects Swine Airway Epithelial Cells without Prior Adaptation
Abstract
1. Introduction
2. Materials and Methods
2.1. Viruses
2.2. Immortalized Cells
2.3. Primary Trachea and Bronchus Epithelial Cells
2.4. Establishment of Well-Differentiated Airway Epithelial Cell Cultures
2.5. Swine Precision-Cut Lung Slice Preparation
2.6. Cilia Vitality Assay after Influenza Virus Infection
2.7. Influenza Virus Infection of ALI Cultures
2.8. Lectin Staining
2.9. Immunofluorescence Analysis of Well-Differentiated ALI Cultures
2.10. Determination of Virus Infectivity
2.11. RT-PCR for ISG Transcript Analysis
2.12. JAK/STAT Signal Pathway Inhibition Analysis
Target Gene | Primer Name | Sequence | Reference |
---|---|---|---|
Swine Mx1 | sMX1-F1 | AGCGCAGTGACACCAGCGAC | [40] |
sMX1-R1 | GCCCGGTTCAGCCTGGGAAC | [40] | |
Swine IFNβ | sIFNb-F1 | AGTTGCCTGGGACTCCTCAA | [41] |
sIFNb-R2 | CTGAGAATGCCGAAGATCTG | [42] | |
Swine ISG15 | sISG15-F1 | GGTGCAAAGCTTCAGAGACC | [40] |
sISG15-R1 | GTCAGCCAGACCTCATAGGC | [40] | |
Swine β-Actin | SusBetActin-L | GACATCCGCAAGGACCTCTA | [43] |
SusBetActin-R | ACACGGAGTACTTGCGCTCT | [43] | |
Influenza M gene | M52C | CTTCTAACCGAGGTCGAAACG | [38] |
M254R | AGGGCATTTTGGACAAAKCGTCTA | [38] | |
Uni12 | AGCAAAAGCAGG | [44] |
2.13. Statistical Analysis
3. Results
3.1. Avian Influenza Viruses Infect Swine Airway Epithelium in Different Patterns
3.2. avH1N1 Can Infect Swine Lower Resipartory Epithelial Cells without Prior Adaption
3.3. Sialic Acid Binding Preference Has a Limited Influence on IAV Infection of the Swine Airway Epithelium
3.4. Different Patterns of the Innate Immune Response Alter the Infection by H1N1 Viruses
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Khan, K.; Arino, J.; Hu, W.; Raposo, P.; Sears, J.; Calderon, F.; Heidebrecht, C.; Macdonald, M.; Liauw, J.; Chan, A.; et al. Spread of a novel influenza A (H1N1) virus via global airline transportation. N. Engl. J. Med. 2009, 361, 212–214. [Google Scholar] [CrossRef] [PubMed]
- Kalthoff, D.; Globig, A.; Beer, M. (Highly pathogenic) avian influenza as a zoonotic agent. Vet. Microbiol. 2010, 140, 237–245. [Google Scholar] [CrossRef] [PubMed]
- De Wit, E.; Munster, V.J.; van Riel, D.; Beyer, W.E.; Rimmelzwaan, G.F.; Kuiken, T.; Osterhaus, A.D.; Fouchier, R.A. Molecular determinants of adaptation of highly pathogenic avian influenza H7N7 viruses to efficient replication in the human host. J. Virol. 2010, 84, 1597–1606. [Google Scholar] [CrossRef] [PubMed]
- Gao, R.; Cao, B.; Hu, Y.; Feng, Z.; Wang, D.; Hu, W.; Chen, J.; Jie, Z.; Qiu, H.; Xu, K.; et al. Human infection with a novel avian-origin influenza A (H7N9) virus. N. Engl. J. Med. 2013, 368, 1888–1897. [Google Scholar] [CrossRef] [PubMed]
- WHO. WHO Risk Assessment of Human Infections with Avian Influenza A(H7N9) Virus; WHO: Geneva, Switzerland, 2015. [Google Scholar]
- Peacock, T.H.P.; James, J.; Sealy, J.E.; Iqbal, M. A Global Perspective on H9N2 Avian Influenza Virus. Viruses 2019, 11, 620. [Google Scholar] [CrossRef]
- Sun, X.; Belser, J.A.; Maines, T.R. Adaptation of H9N2 Influenza Viruses to Mammalian Hosts: A Review of Molecular Markers. Viruses 2020, 12, 541. [Google Scholar] [CrossRef]
- Yamaji, R.; Saad, M.D.; Davis, C.T.; Swayne, D.E.; Wang, D.; Wong, F.Y.K.; McCauley, J.W.; Peiris, J.S.M.; Webby, R.J.; Fouchier, R.A.M.; et al. Pandemic potential of highly pathogenic avian influenza clade 2.3.4.4 A(H5) viruses. Rev. Med. Virol. 2020, 30, e2099. [Google Scholar] [CrossRef]
- Short, K.R.; Richard, M.; Verhagen, J.H.; van Riel, D.; Schrauwen, E.J.; van den Brand, J.M.; Manz, B.; Bodewes, R.; Herfst, S. One health, multiple challenges: The inter-species transmission of influenza A virus. One Health 2015, 1, 1–13. [Google Scholar] [CrossRef]
- Shin, D.L.; Siebert, U.; Lakemeyer, J.; Grilo, M.; Pawliczka, I.; Wu, N.H.; Valentin-Weigand, P.; Haas, L.; Herrler, G. Highly Pathogenic Avian Influenza A(H5N8) Virus in Gray Seals, Baltic Sea. Emerg. Infect. Dis. 2019, 25, 2295–2298. [Google Scholar] [CrossRef]
- Rogers, G.N.; Paulson, J.C. Receptor determinants of human and animal influenza virus isolates: Differences in receptor specificity of the H3 hemagglutinin based on species of origin. Virology 1983, 127, 361–373. [Google Scholar] [CrossRef]
- Couceiro, J.N.; Paulson, J.C.; Baum, L.G. Influenza virus strains selectively recognize sialyloligosaccharides on human respiratory epithelium; the role of the host cell in selection of hemagglutinin receptor specificity. Virus Res. 1993, 29, 155–165. [Google Scholar] [CrossRef]
- Ito, T.; Couceiro, J.N.; Kelm, S.; Baum, L.G.; Krauss, S.; Castrucci, M.R.; Donatelli, I.; Kida, H.; Paulson, J.C.; Webster, R.G.; et al. Molecular basis for the generation in pigs of influenza A viruses with pandemic potential. J. Virol. 1998, 72, 7367–7373. [Google Scholar] [CrossRef] [PubMed]
- Ma, W.; Kahn, R.E.; Richt, J.A. The pig as a mixing vessel for influenza viruses: Human and veterinary implications. J. Mol. Genet. Med. 2008, 3, 158–166. [Google Scholar] [CrossRef] [PubMed]
- Krumbholz, A.; Lange, J.; Sauerbrei, A.; Groth, M.; Platzer, M.; Kanrai, P.; Pleschka, S.; Scholtissek, C.; Buttner, M.; Durrwald, R.; et al. Origin of the European avian-like swine influenza viruses. J. Gen. Virol. 2014, 95, 2372–2376. [Google Scholar] [CrossRef]
- Scholtissek, C.; Burger, H.; Bachmann, P.A.; Hannoun, C. Genetic relatedness of hemagglutinins of the H1 subtype of influenza A viruses isolated from swine and birds. Virology 1983, 129, 521–523. [Google Scholar] [CrossRef]
- Smith, G.J.; Vijaykrishna, D.; Bahl, J.; Lycett, S.J.; Worobey, M.; Pybus, O.G.; Ma, S.K.; Cheung, C.L.; Raghwani, J.; Bhatt, S.; et al. Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza A epidemic. Nature 2009, 459, 1122–1125. [Google Scholar] [CrossRef]
- Welsh, M.D.; Baird, P.M.; Guelbenzu-Gonzalo, M.P.; Hanna, A.; Reid, S.M.; Essen, S.; Russell, C.; Thomas, S.; Barrass, L.; McNeilly, F.; et al. Initial incursion of pandemic (H1N1) 2009 influenza A virus into European pigs. Vet. Rec. 2010, 166, 642–645. [Google Scholar] [CrossRef]
- Vareille, M.; Kieninger, E.; Edwards, M.R.; Regamey, N. The Airway Epithelium: Soldier in the Fight against Respiratory Viruses. Clin. Microbiol. Rev. 2011, 24, 210–229. [Google Scholar] [CrossRef]
- Goris, K.; Uhlenbruck, S.; Schwegmann-Wessels, C.; Köhl, W.; Niedorf, F.; Stern, M.; Hewicker-Trautwein, M.; Bals, R.; Taylor, G.; Braun, A.; et al. Differential Sensitivity of Differentiated Epithelial Cells to Respiratory Viruses Reveals Different Viral Strategies of Host Infection. J. Virol. 2009, 83, 1962–1968. [Google Scholar] [CrossRef]
- Kirchhoff, J.; Uhlenbruck, S.; Goris, K.; Keil, G.M.; Herrler, G. Three viruses of the bovine respiratory disease complex apply different strategies to initiate infection. Vet. Res. 2014, 45, 20. [Google Scholar] [CrossRef]
- Meng, F.; Wu, N.H.; Nerlich, A.; Herrler, G.; Valentin-Weigand, P.; Seitz, M. Dynamic Virus-Bacterium Interactions in a Porcine Precision-Cut Lung Slice Coinfection Model: Swine Influenza Virus Paves the Way for Streptococcus suis Infection in a Two-Step Process. Infect. Immun. 2015, 83, 2806–2815. [Google Scholar] [CrossRef] [PubMed]
- Punyadarsaniya, D.; Liang, C.-H.; Winter, C.; Petersen, H.; Rautenschlein, S.; Hennig-Pauka, I.; Schwegmann-Wessels, C.; Wu, C.-Y.; Wong, C.-H.; Herrler, G. Infection of Differentiated Porcine Airway Epithelial Cells by Influenza Virus: Differential Susceptibility to Infection by Porcine and Avian Viruses. PLoS ONE 2011, 6, e28429. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Punyadarsaniya, D.; Lambertz, R.L.O.; Lee, D.C.C.; Liang, C.H.; Höper, D.; Leist, S.R.; Hernández-Cáceres, A.; Stech, J.; Beer, M.; et al. Mutations during the Adaptation of H9N2 Avian Influenza Virus to the Respiratory Epithelium of Pigs Enhance Sialic Acid Binding Activity and Virulence in Mice. J. Virol. 2017, 91, e02125-16. [Google Scholar] [CrossRef] [PubMed]
- Powell, J.; Straub, T. Advances and Remaining Challenges in the Study of Influenza and Anthrax Infection in Lung Cell Culture. Challenges 2018, 9, 2. [Google Scholar] [CrossRef]
- Dijkman, R.; Jebbink, M.F.; Koekkoek, S.M.; Deijs, M.; Jónsdóttir, H.R.; Molenkamp, R.; Ieven, M.; Goossens, H.; Thiel, V.; van der Hoek, L. Isolation and Characterization of Current Human Coronavirus Strains in Primary Human Epithelial Cell Cultures Reveal Differences in Target Cell Tropism. J. Virol. 2013, 87, 6081–6090. [Google Scholar] [CrossRef]
- Antunes, M.B.; Woodworth, B.A.; Bhargave, G.; Xiong, G.; Aguilar, J.L.; Ratner, A.J.; Kreindler, J.L.; Rubenstein, R.C.; Cohen, N.A. Murine nasal septa for respiratory epithelial air-liquid interface cultures. BioTechniques 2007, 43, 195–204. [Google Scholar] [CrossRef]
- Matrosovich, M.N.; Matrosovich, T.Y.; Gray, T.; Roberts, N.A.; Klenk, H.-D. Human and avian influenza viruses target different cell types in cultures of human airway epithelium. Proc. Natl. Acad. Sci. USA 2004, 101, 4620–4624. [Google Scholar] [CrossRef]
- Zeng, H.; Goldsmith, C.S.; Maines, T.R.; Belser, J.A.; Gustin, K.M.; Pekosz, A.; Zaki, S.R.; Katz, J.M.; Tumpey, T.M. Tropism and infectivity of influenza virus, including highly pathogenic avian H5N1 virus, in ferret tracheal differentiated primary epithelial cell cultures. J. Virol. 2013, 87, 2597–2607. [Google Scholar] [CrossRef]
- Wu, N.-H.; Yang, W.; Beineke, A.; Dijkman, R.; Matrosovich, M.; Baumgärtner, W.; Thiel, V.; Valentin-Weigand, P.; Meng, F.; Herrler, G. The differentiated airway epithelium infected by influenza viruses maintains the barrier function despite a dramatic loss of ciliated cells. Sci. Rep. 2016, 6, 39668. [Google Scholar] [CrossRef]
- Walters, M.S.; Gomi, K.; Ashbridge, B.; Moore, M.A.; Arbelaez, V.; Heldrich, J.; Ding, B.S.; Rafii, S.; Staudt, M.R.; Crystal, R.G. Generation of a human airway epithelium derived basal cell line with multipotent differentiation capacity. Respir. Res. 2013, 14, 135. [Google Scholar] [CrossRef]
- Haller, O.; Staeheli, P.; Schwemmle, M.; Kochs, G. Mx GTPases: Dynamin-like antiviral machines of innate immunity. Trends Microbiol. 2015, 23, 154–163. [Google Scholar] [CrossRef] [PubMed]
- Shin, D.L.; Hatesuer, B.; Bergmann, S.; Nedelko, T.; Schughart, K. Protection from Severe Influenza Virus Infections in Mice Carrying the Mx1 Influenza Virus Resistance Gene Strongly Depends on Genetic Background. J. Virol. 2015, 89, 9998–10009. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Kruger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181. [Google Scholar] [CrossRef] [PubMed]
- Meng, F.; Punyadarsaniya, D.; Uhlenbruck, S.; Hennig-Pauka, I.; Schwegmann-Wessels, C.; Ren, X.; Dürrwald, R.; Herrler, G. Replication characteristics of swine influenza viruses in precision-cut lung slices reflect the virulence properties of the viruses. Vet. Res. 2013, 44, 110. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, H.; Braubach, P.; Schilpp, C.; Lochbaum, R.; Neuland, K.; Thompson, K.; Jonigk, D.; Frick, M.; Dietl, P.; Wittekindt, O.H. IL-13 Impairs Tight Junctions in Airway Epithelia. Int. J. Mol. Sci. 2019, 20, 3222. [Google Scholar] [CrossRef] [PubMed]
- Fouchier, R.A.; Bestebroer, T.M.; Herfst, S.; Van Der Kemp, L.; Rimmelzwaan, G.F.; Osterhaus, A.D. Detection of influenza A viruses from different species by PCR amplification of conserved sequences in the matrix gene. J. Clin. Microbiol. 2000, 38, 4096–4101. [Google Scholar] [CrossRef]
- Trevennec, K.; Leger, L.; Lyazrhi, F.; Baudon, E.; Cheung, C.Y.; Roger, F.; Peiris, M.; Garcia, J.M. Transmission of pandemic influenza H1N1 (2009) in Vietnamese swine in 2009–2010. Influenza Other Respir. Viruses 2012, 6, 348–357. [Google Scholar] [CrossRef]
- Patel, D.; Nan, Y.; Shen, M.; Ritthipichai, K.; Zhu, X.; Zhang, Y.J. Porcine reproductive and respiratory syndrome virus inhibits type I interferon signaling by blocking STAT1/STAT2 nuclear translocation. J. Virol. 2010, 84, 11045–11055. [Google Scholar] [CrossRef]
- Zanotti, C.; Razzuoli, E.; Crooke, H.; Soule, O.; Pezzoni, G.; Ferraris, M.; Ferrari, A.; Amadori, M. Differential Biological Activities of Swine Interferon-alpha Subtypes. J. Interferon Cytokine Res. 2015, 35, 990–1002. [Google Scholar] [CrossRef]
- Xie, S.; Chen, X.X.; Qiao, S.; Li, R.; Sun, Y.; Xia, S.; Wang, L.J.; Luo, X.; Deng, R.; Zhou, E.M.; et al. Identification of the RNA Pseudoknot within the 3′ End of the Porcine Reproductive and Respiratory Syndrome Virus Genome as a Pathogen-Associated Molecular Pattern to Activate Antiviral Signaling via RIG-I and Toll-Like Receptor 3. J. Virol. 2018, 92, e00097-18. [Google Scholar] [CrossRef] [PubMed]
- Galindo, R.C.; Ayllón, N.; Smrdel, K.S.; Boadella, M.; Beltrán-Beck, B.; Mazariegos, M.; García, N.; de la Lastra, J.M.P.; Avsic-Zupanc, T.; Kocan, K.M.; et al. Gene expression profile suggests that pigs (Sus scrofa) are susceptible to Anaplasma phagocytophilum but control infection. Parasit Vectors 2012, 5, 181. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, E.; Stech, J.; Guan, Y.; Webster, R.G.; Perez, D.R. Universal primer set for the full-length amplification of all influenza A viruses. Arch. Virol. 2001, 146, 2275–2289. [Google Scholar] [CrossRef] [PubMed]
- Ito, T.; Suzuki, Y.; Mitnaul, L.; Vines, A.; Kida, H.; Kawaoka, Y. Receptor specificity of influenza A viruses correlates with the agglutination of erythrocytes from different animal species. Virology 1997, 227, 493–499. [Google Scholar] [CrossRef]
- Pillai, S.P.; Lee, C.W. Species and age related differences in the type and distribution of influenza virus receptors in different tissues of chickens, ducks and turkeys. J. Virol. 2010, 7, 5. [Google Scholar] [CrossRef]
- Taubenberger, J.K.; Kash, J.C. Influenza virus evolution, host adaptation, and pandemic formation. Cell Host Microbe 2010, 7, 440–451. [Google Scholar] [CrossRef]
- Nelli, R.K.; Kuchipudi, S.V.; White, G.A.; Perez, B.B.; Dunham, S.P.; Chang, K.C. Comparative distribution of human and avian type sialic acid influenza receptors in the pig. BMC Vet. Res. 2010, 6, 4. [Google Scholar] [CrossRef]
- Van Poucke, S.G.; Nicholls, J.M.; Nauwynck, H.J.; Van Reeth, K. Replication of avian, human and swine influenza viruses in porcine respiratory explants and association with sialic acid distribution. J. Virol. 2010, 7, 38. [Google Scholar] [CrossRef]
- Imai, M.; Watanabe, T.; Hatta, M.; Das, S.C.; Ozawa, M.; Shinya, K.; Zhong, G.; Hanson, A.; Katsura, H.; Watanabe, S.; et al. Experimental adaptation of an influenza H5 HA confers respiratory droplet transmission to a reassortant H5 HA/H1N1 virus in ferrets. Nature 2012, 486, 420–428. [Google Scholar] [CrossRef]
- Herfst, S.; Schrauwen, E.J.; Linster, M.; Chutinimitkul, S.; de Wit, E.; Munster, V.J.; Sorrell, E.M.; Bestebroer, T.M.; Burke, D.F.; Smith, D.J.; et al. Airborne transmission of influenza A/H5N1 virus between ferrets. Science 2012, 336, 1534–1541. [Google Scholar] [CrossRef]
- Maines, T.R.; Jayaraman, A.; Belser, J.A.; Wadford, D.A.; Pappas, C.; Zeng, H.; Gustin, K.M.; Pearce, M.B.; Viswanathan, K.; Shriver, Z.H.; et al. Transmission and pathogenesis of swine-origin 2009 A(H1N1) influenza viruses in ferrets and mice. Science 2009, 325, 484–487. [Google Scholar] [CrossRef] [PubMed]
- Zanin, M.; Wong, S.S.; Barman, S.; Kaewborisuth, C.; Vogel, P.; Rubrum, A.; Darnell, D.; Marinova-Petkova, A.; Krauss, S.; Webby, R.J.; et al. Molecular basis of mammalian transmissibility of avian H1N1 influenza viruses and their pandemic potential. Proc. Natl. Acad. Sci. USA 2017, 114, 11217–11222. [Google Scholar] [CrossRef] [PubMed]
- Kocer, Z.A.; Krauss, S.; Zanin, M.; Danner, A.; Gulati, S.; Jones, J.C.; Friedman, K.; Graham, A.; Forrest, H.; Seiler, J.; et al. Possible basis for the emergence of H1N1 viruses with pandemic potential from avian hosts. Emerg. Microbes Infect. 2015, 4, e40. [Google Scholar] [CrossRef] [PubMed]
- Starick, E.; Fereidouni, S.R.; Lange, E.; Grund, C.; Vahlenkamp, T.; Beer, M.; Harder, T.C. Analysis of influenza A viruses of subtype H1 from wild birds, turkeys and pigs in Germany reveals interspecies transmission events. Influenza Other Respir. Viruses 2011, 5, 276–284. [Google Scholar] [CrossRef] [PubMed]
- Hatesuer, B.; Bertram, S.; Mehnert, N.; Bahgat, M.M.; Nelson, P.S.; Pohlmann, S.; Schughart, K. Tmprss2 is essential for influenza H1N1 virus pathogenesis in mice. PLoS Pathog. 2013, 9, e1003774. [Google Scholar] [CrossRef]
- Peitsch, C.; Klenk, H.D.; Garten, W.; Bottcher-Friebertshauser, E. Activation of influenza A viruses by host proteases from swine airway epithelium. J. Virol. 2014, 88, 282–291. [Google Scholar] [CrossRef]
- Kühn, N.; Bergmann, S.; Kösterke, N.; Lambertz, R.L.O.; Keppner, A.; van den Brand, J.M.A.; Pöhlmann, S.; Weiß, S.; Hummler, E.; Hatesuer, B.; et al. The Proteolytic Activation of (H3N2) Influenza A Virus Hemagglutinin Is Facilitated by Different Type II Transmembrane Serine Proteases. J. Virol. 2016, 90, 4298. [Google Scholar] [CrossRef]
- Dornfeld, D.; Petric, P.P.; Hassan, E.; Zell, R.; Schwemmle, M. Eurasian Avian-Like Swine Influenza A Viruses Escape Human MxA Restriction through Distinct Mutations in Their Nucleoprotein. J. Virol. 2019, 93, e00997-18. [Google Scholar] [CrossRef]
- Ciancanelli, M.J.; Abel, L.; Zhang, S.Y.; Casanova, J.L. Host genetics of severe influenza: From mouse Mx1 to human IRF7. Curr. Opin. Immunol. 2016, 38, 109–120. [Google Scholar] [CrossRef]
- Haller, O.; Kochs, G.; Weber, F. The interferon response circuit: Induction and suppression by pathogenic viruses. Virology 2006, 344, 119–130. [Google Scholar] [CrossRef]
- Hauser, M.J.; Dlugolenski, D.; Culhane, M.R.; Wentworth, D.E.; Tompkins, S.M.; Tripp, R.A. Antiviral Responses by Swine Primary Bronchoepithelial Cells Are Limited Compared to Human Bronchoepithelial Cells Following Influenza Virus Infection. PLoS ONE 2013, 8, e70251. [Google Scholar] [CrossRef] [PubMed]
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shin, D.-L.; Yang, W.; Peng, J.-Y.; Sawatsky, B.; von Messling, V.v.; Herrler, G.; Wu, N.-H. Avian Influenza A Virus Infects Swine Airway Epithelial Cells without Prior Adaptation. Viruses 2020, 12, 589. https://doi.org/10.3390/v12060589
Shin D-L, Yang W, Peng J-Y, Sawatsky B, von Messling Vv, Herrler G, Wu N-H. Avian Influenza A Virus Infects Swine Airway Epithelial Cells without Prior Adaptation. Viruses. 2020; 12(6):589. https://doi.org/10.3390/v12060589
Chicago/Turabian StyleShin, Dai-Lun, Wei Yang, Ju-Yi Peng, Bevan Sawatsky, Veronika von von Messling, Georg Herrler, and Nai-Huei Wu. 2020. "Avian Influenza A Virus Infects Swine Airway Epithelial Cells without Prior Adaptation" Viruses 12, no. 6: 589. https://doi.org/10.3390/v12060589
APA StyleShin, D.-L., Yang, W., Peng, J.-Y., Sawatsky, B., von Messling, V. v., Herrler, G., & Wu, N.-H. (2020). Avian Influenza A Virus Infects Swine Airway Epithelial Cells without Prior Adaptation. Viruses, 12(6), 589. https://doi.org/10.3390/v12060589