Rapid Detection of Peste des Petits Ruminants Virus (PPRV) Nucleic Acid Using a Novel Low-Cost Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Assay for Future Use in Nascent PPR Eradication Programme
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics
2.2. Viruses and Clinical Samples for RNA Extraction and Laboratory Evaluation by RT-LAMP
2.3. RNA Extraction
2.4. LAMP Primer Design
2.5. Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP)
2.6. RNA Standards and Dilution Series used to Determine the Analytical Sensitivity of the RT-LAMP Assay
2.7. Real-Time Reverse-Transcription-Polymerase Chain Reaction (RT-qPCR)
2.8. Sample Preparation for RT-LAMP without RNA Extraction
2.9. Statistical Analysis
3. Results
3.1. Optimisation of the RT-LAMP Assay
3.2. Analytical Sensitivity
3.3. Diagnostic Sensitivity and Specificity
3.4. Evaluation of RT-LAMP Assay Using Samples without prior RNA Extraction
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Parida, S.; Muniraju, M.; Mahapatra, M.; Muthuchelvan, D.; Buczkowski, H.; Banyard, A.C. Peste des petits ruminants. Vet. Microbiol. 2015, 181, 90–106. [Google Scholar] [CrossRef] [Scilit]
- Altan, E.; Parida, S.; Mahapatra, M.; Turan, N.; Yilmaz, H. Molecular characterization of Peste des petits ruminants viruses in the Marmara Region of Turkey. Transbound. Emerg. Dis. 2019, 66, 865–872. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahapatra, M.; Parida, S.; Egziabher, B.G.; Diallo, A.; Barrett, T. Sequence analysis of the phosphoprotein gene of peste des petits ruminants (PPR) virus: Editing of the gene transcript. Virus Res. 2003, 96, 85–98. [Google Scholar] [CrossRef] [Scilit]
- Kumar, K.S.; Babu, A.; Sundarapandian, G.; Roy, P.; Thangavelu, A.; Kumar, K.S.; Arumugam, R.; Chandran, N.D.; Muniraju, M.; Mahapatra, M.; et al. Molecular characterisation of lineage IV peste des petits ruminants virus using multi gene sequence data. Vet. Microbiol. 2014, 174, 39–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Forsyth, M.A.; Barrett, T. Evaluation of polymerase chain reaction for the detection and characterisation of rinderpest and peste des petits ruminants viruses for epidemiological studies. Virus Res. 1995, 39, 151–163. [Google Scholar] [CrossRef] [Scilit]
- Couacy-Hymann, E.; Roger, F.; Hurard, C.; Guillou, J.P.; Libeau, G.; Diallo, A. Rapid and sensitive detection of peste des petits ruminants virus by a polymerase chain reaction assay. J. Virol. Methods 2002, 100, 17–25. [Google Scholar] [CrossRef] [Scilit]
- Bao, J.; Li, L.; Wang, Z.; Barrett, T.; Suo, L.; Zhao, W.; Liu, Y.; Liu, C.; Li, J. Development of one-step real-time RT-PCR assay for detection and quantitation of peste des petits ruminants virus. J. Virol. Methods 2008, 148, 232–236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwiatek, O.; Keita, D.; Gil, P.; Fernandez-Pinero, J.; Clavero, M.A.; Albina, E.; Libeau, G. Quantitative one-step real-time RT-PCR for the fast detection of the four genotypes of PPRV. J. Virol. Methods 2010, 165, 168–177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Batten, C.A.; Banyard, A.C.; King, D.P.; Henstock, M.R.; Edwards, L.; Sanders, A.; Buczkowski, H.; Oura, C.C.; Barrett, T. A real time RT-PCR assay for the specific detection of Peste des petits ruminants virus. J. Virol. Methods 2011, 171, 401–404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashraf, W.; Unger, H.; Haris, S.; Mobeen, A.; Farooq, M.; Asif, M.; Khan, Q.M. Genetic detection of peste des petits ruminants virus under field conditions: A step forward towards disease eradication. BMC Vet. Res. 2017, 13, 34. [Google Scholar] [CrossRef] [Scilit]
- Cho, H.S.; Park, N.Y. Detection of canine distemper virus in blood samples by reverse transcription loop-mediated isothermal amplification. J. Vet. Med. B Infect. Dis. Vet. Public Health 2005, 52, 410–413. [Google Scholar] [CrossRef] [Scilit]
- Fowler, V.L.; Howson, E.L.; Madi, M.; Mioulet, V.; Caiusi, C.; Pauszek, S.J.; Rodriguez, L.L.; King, D.P. Development of a reverse transcription loop-mediated isothermal amplification assay for the detection of vesicular stomatitis New Jersey virus: Use of rapid molecular assays to differentiate between vesicular disease viruses. J. Virol. Methods 2016, 234, 123–131. [Google Scholar] [CrossRef] [Scilit]
- Fowler, V.L.; Howson, E.L.A.; Flannery, J.; Romito, M.; Lubisi, A.; Aguero, M.; Mertens, P.; Batten, C.A.; Warren, H.R.; Castillo-Olivares, J. Development of a Novel Reverse Transcription Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of African Horse Sickness Virus. Transbound. Emerg. Dis. 2017, 64, 1579–1588. [Google Scholar] [CrossRef] [Scilit]
- Fujino, M.; Yoshida, N.; Yamaguchi, S.; Hosaka, N.; Ota, Y.; Notomi, T.; Nakayama, T. A simple method for the detection of measles virus genome by loop-mediated isothermal amplification (LAMP). J. Med. Virol. 2005, 76, 406–413. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Bao, J.; Wu, X.; Wang, Z.; Wang, J.; Gong, M.; Liu, C.; Li, J. Rapid detection of peste des petits ruminants virus by a reverse transcription loop-mediated isothermal amplification assay. J. Virol. Methods 2010, 170, 37–41. [Google Scholar] [CrossRef] [Scilit]
- Waters, R.A.; Fowler, V.L.; Armson, B.; Nelson, N.; Gloster, J.; Paton, D.J.; King, D.P. Preliminary validation of direct detection of foot-and-mouth disease virus within clinical samples using reverse transcription loop-mediated isothermal amplification coupled with a simple lateral flow device for detection. PLoS ONE 2014, 9, e105630. [Google Scholar] [CrossRef] [Scilit]
- Mahapatra, M.; Sayalel, K.; Muniraju, M.; Eblate, E.; Fyumagwa, R.; Shilinde, L.; Mdaki, M.; Keyyu, J.; Parida, S.; Kock, R. Spillover of Peste des Petits Ruminants Virus from Domestic to Wild Ruminants in the Serengeti Ecosystem, Tanzania. Emerg. Infect. Dis. 2015, 21, 2230–2234. [Google Scholar] [CrossRef] [Scilit]
- Baazizi, R.; Mahapatra, M.; Clarke, B.D.; Ait-Oudhia, K.; Khelef, D.; Parida, S. Peste des petits ruminants (PPR): A neglected tropical disease in Maghreb region of North Africa and its threat to Europe. PLoS ONE 2017, 12, e0175461. [Google Scholar] [CrossRef] [Scilit]
- Clarke, B.; Mahapatra, M.; Friedgut, O.; Bumbarov, V.; Parida, S. Persistence of Lineage IV Peste-des-petits ruminants virus within Israel since 1993: An evolutionary perspective. PLoS ONE 2017, 12, e0177028. [Google Scholar] [CrossRef] [Scilit]
- Clarke, B.D.; Islam, M.R.; Yusuf, M.A.; Mahapatra, M.; Parida, S. Molecular detection, isolation and characterization of Peste-des-petits ruminants virus from goat milk from outbreaks in Bangladesh and its implication for eradication strategy. Transbound. Emerg. Dis. 2018, 65, 1597–1604. [Google Scholar] [CrossRef] [Scilit]
- Parida, S.; Selvaraj, M.; Gubbins, S.; Pope, R.; Banyard, A.; Mahapatra, M. Quantifying Levels of Peste Des Petits Ruminants (PPR) Virus in Excretions from Experimentally Infected Goats and Its Importance for Nascent PPR Eradication Programme. Viruses 2019, 11, 249. [Google Scholar] [CrossRef] [Scilit]
- Libeau, G.; Prehaud, C.; Lancelot, R.; Colas, F.; Guerre, L.; Bishop, D.H.; Diallo, A. Development of a competitive ELISA for detecting antibodies to the peste des petits ruminants virus using a recombinant nucleoprotein. Res. Vet. Sci. 1995, 58, 50–55. [Google Scholar] [CrossRef] [Scilit]
- Katayama, S.; Yamanaka, M.; Ota, S.; Shimizu, Y. A new quantitative method for rabies virus by detection of nucleoprotein in virion using ELISA. J. Vet. Med. Sci. 1999, 61, 411–416. [Google Scholar] [CrossRef] [Scilit]
- Warnes, A.; Fooks, A.R.; Stephenson, J.R. Production of measles nucleoprotein in different expression systems and its use as a diagnostic reagent. J. Virol. Methods 1994, 49, 257–268. [Google Scholar] [CrossRef] [Scilit]
- Errington, W.; Steward, M.; Emmerson, P.T. A diagnostic immunoassay for Newcastle disease virus based on the nucleocapsid protein expressed by a recombinant baculovirus. J. Virol. Methods 1995, 55, 357–365. [Google Scholar] [CrossRef] [Scilit]
- Dechamma, H.J.; Dighe, V.; Kumar, C.A.; Singh, R.P.; Jagadish, M.; Kumar, S. Identification of T-helper and linear B epitope in the hypervariable region of nucleocapsid protein of PPRV and its use in the development of specific antibodies to detect viral antigen. Vet. Microbiol. 2006, 118, 201–211. [Google Scholar] [CrossRef] [Scilit]
- Parida, S.; Mahapatra, M.; Kumar, S.; Das, S.C.; Baron, M.D.; Anderson, J.; Barrett, T. Rescue of a chimeric rinderpest virus with the nucleocapsid protein derived from peste-des-petits-ruminants virus: Use as a marker vaccine. J. Gen. Virol. 2007, 88, 2019–2027. [Google Scholar] [CrossRef] [Scilit]
- Santhamani, R.; Singh, R.P.; Njeumi, F. Peste des petits ruminants diagnosis and diagnostic tools at a glance: Perspectives on global control and eradication. Arch. Virol. 2016, 161, 2953–2967. [Google Scholar] [CrossRef] [Scilit]
- Bataille, A.; Kwiatek, O.; Belfkhi, S.; Mounier, L.; Parida, S.; Mahapatra, M.; Caron, A.; Chubwa, C.C.; Keyyu, J.; Kock, R.; et al. Optimization and evaluation of a non-invasive tool for peste des petits ruminants surveillance and control. Sci. Rep. 2019, 9, 4742. [Google Scholar] [CrossRef] [Scilit]
- Luka, P.D.; Ayebazibwe, C.; Shamaki, D.; Mwiine, F.N.; Erume, J. Sample type is vital for diagnosing infection with peste des petits ruminants virus by reverse transcription PCR. J. Vet. Sci. 2012, 13, 323–325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Howson, E.L.A.; Armson, B.; Madi, M.; Kasanga, C.J.; Kandusi, S.; Sallu, R.; Chepkwony, E.; Siddle, A.; Martin, P.; Wood, J.; et al. Evaluation of Two Lyophilized Molecular Assays to Rapidly Detect Foot-and-Mouth Disease Virus Directly from Clinical Samples in Field Settings. Transbound. Emerg. Dis. 2017, 64, 861–871. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blomstrom, A.L.; Hakhverdyan, M.; Reid, S.M.; Dukes, J.P.; King, D.P.; Belak, S.; Berg, M. A one-step reverse transcriptase loop-mediated isothermal amplification assay for simple and rapid detection of swine vesicular disease virus. J. Virol. Methods 2008, 147, 188–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Sample No. | Sample Details | RT-qPCR Mean CT | RT-LAMP Mean Tp | RT-LAMP Mean Ta |
|---|---|---|---|---|
| 1 | Occular swab-G4 | no CT | No Tp | No Ta |
| 2 | Occular swab-G10 | 22.96 | 48.32 | 84.25 |
| 3 | Occular swab-G11 | 36.96 | 53.29 | 84.06 |
| 4 | Occular swab-G16 | 26.37 | 51.204 | 84.08 |
| 5 | Occular swab-S14* | no CT | No Tp | No Ta |
| 6 | Occular swab-S19* | no CT | No Tp | No Ta |
| 7 | Occular swab-S20* | no CT | No Tp | No Ta |
| 8 | Nasal swab-goat-1 | 37 | 55.24 | 84.11 |
| 9 | Nasal swab-goat-2 | 32 | 52.03 | 84 |
| 10 | Nasal swab-sheep-1* | 34.36 | 52.82 | 84.06 |
| 11 | Nasal swab-sheep-2* | no CT | No Tp | No Ta |
| 12 | Nasal swab-sheep-5* | 31.04 | 51.93 | 84.1 |
| 13 | Farm 1-blood 1 | 25.23 | 49.35 | 84 |
| 14 | Farm 1-blood 2 | 22.05 | 47.31 | 84.13 |
| 15 | Farm 1-blood 3 | 19.36 | 45.63 | 84.1 |
| 16 | Farm 1-blood 4 | no CT | No Tp | No Ta |
| 17 | Farm 1-blood 5 | 26.34 | 49.91 | 84.17 |
| 18 | Farm 1-blood 6 | 33.27 | 56.65 | 84.05 |
| 19 | Farm 1-blood 7 | 20.95 | 44.39 | 84.11 |
| 20 | Farm 1-blood 8 | 31.27 | 52.43 | 84.09 |
| 21 | Milk-B52/Chuadanga/2015 | 24.76 | 48.69 | 84 |
| 22 | Milk-B53/Savara/2015 | 30.1 | 50.63 | 84.06 |
| 23 | Milk-B18/Nihkanchari/2015 | 24.61 | 49.03 | 84.1 |
| 24 | Milk-B19/Nihkanchari/2015 | 23.54 | 47.17 | 84 |
| 25 | Field lung tissue-1 | 20.62 | 41.73 | 84.2 |
| 26 | Field lung tissue-2 | 28.26 | 47.23 | 84.15 |
| 27 | Field lung tissue-3 | no CT | No Tp | No Ta |
| 28 | Faecal sample-1 | noCTt | No Tp | No Ta |
| 29 | Faecal sample-2 | no CT | No Tp | No Ta |
| 30 | Faecal sample-3 | no CT | No Tp | No Ta |
| 31 | Faecal sample-4 | 19.6 | 56.575 | 84.1 |
| 32 | Faecal sample-5 | 22.45 | 58.565 | 83.94 |
| 33 | Nasal swab-1 | no CT | No Tp | No Ta |
| 34 | Nasal swab-2 | 32.65 | 58:21:00 | 83.99 |
| 35 | Nasal swab-3 | 31.22 | 58:41:00 | 84.06 |
| 36 | Nasal swab-4 | 25.18 | 48.35.00 | 84 |
| 37 | Nasal swab-5 | 28.35 | 51:06:00 | 84.19 |
| 38 | Lymp node—bronchial-1 | noCT | No Tp | No Ta |
| 39 | Lymp node—bronchial-2 | no CT | No Tp | No Ta |
| 40 | Lymp node—bronchial-3 | no CT | No Tp | No Ta |
| 41 | Lymp node—bronchial-4 | 33.24 | 54.45 | 84.18 |
| 42 | Lymp node—bronchial-5 | no CT | No Tp | No Ta |
| 43 | Lymp node—bronchial-6 | no CT | No Tp | No Ta |
| 44 | Spleen | no CT | No Tp | No Ta |
| 45 | Lymp node—mandibular | 33.92 | 50.05 | 84.09 |
| 46 | Lymp node—prescapular | no CT | No Tp | No Ta |
| 47 | Tonsil—pharyngeal | 31.08 | 45.8 | 84.05 |
| 48 | Tonsil—palatine | 32.37 | 51.73 | 84.08 |
| 49 | Ileum | no CT | No Tp | No Ta |
| 50 | Colon | no CT | No Tp | No Ta |
| 51 | Rectum | no CT | No Tp | No Ta |
| 52 | Filter paper impregnated with virus-1 | 36.12 | 56.73 | 83.99 |
| 53 | Filter paper impregnated with virus-2 | 37.23 | 58.58 | 83.94 |
| 54 | Filter paper impregnated with virus-3 | 31.92 | 54.8 | 84.08 |
| 55 | PPRV/Nigeria/75/1 (L-II) | 19.24 | 35.02 | 84.07 |
| 56 | PPRV/Nigeria/76/1 (L-II) | 23.68 | 41.09 | 84.12 |
| 57 | PPRV/Sungri/96 (L-IV) | 13.45 | 37.15 | 84.15 |
| 58 | PPRV/Ivory coast (L-I) | 20.30 | 36.8 | 84.1 |
| 59 | PPRV/IBRI-Oman (L-III) | 19.84 | 40.08 | 84 |
| 60 | PPRV/Morocco/2008 (L-IV) | 16.85 | 33.28 | 84.1 |
| 61 | PPRV/Bangladesh/170/2012 (L-IV) | 25.96 | 46.39 | 84 |
| 62 | PPRV/Ghana/78 (L-II) | 21.29 | 35.86 | 84.1 |
| 63 | Nuclease-free water (negative control) | no CT | No Tp | No Ta |
| 64 | Dolphin Morbillivirus (DMV) | no CT | No Tp | No Ta |
| 65 | Measles virus (MV) | no CT | No Tp | No Ta |
| 66 | FMDV/O/PanAsia-2 | no CT | No Tp | No Ta |
| 67 | FMDV/A/A22/Iraq 24/64 | no CT | No Tp | No Ta |
| 68 | Swine Vesicular Disease virus (SVDV) | no CT | No Tp | No Ta |
| Primer Name | Type | Sequence (5ʹ–3ʹ) | Position | Final Concentration |
|---|---|---|---|---|
| F3 | Forward outer | TCATACTTGACATCAAGAGGAC | 814–835 | 0.2 µM (5 pmol) |
| B3 | Reverse outer | GAGTTCTCTAGAATTACCATGTAGG | 1039–1063 | 0.2 µM (5 pmol) |
| FIP(F1c+F2) | Forward inner | GTTTCAATACCAAACTTGATAGTAAGGATG | 867–884 | 1.6 µM (40 pmol) |
| ATCTGCGACATTGACAAC | 914–943 | |||
| BIP(B1c+B2) | Reverse inner | GTATCCTGCATTAGGTCTTCACGAG | 947–971 | 1.6 µM (40 pmol) |
| CCTAGTTGTTGATACAAGTTCATC | 1004–1027 | |||
| Floop | Forward Loop | CAAGTCCGGCTTCGACAATA | 887–906 | 0.8 µM (20 pmol) |
| Bloop | Reverse Loop | GGAATTGTCCACTATAGAATCCCT | 980–1003 | 0.8 µM (20 pmol) |
| Primer Name | Reaction A | Reaction B | Reaction C | Reaction D | ||||
|---|---|---|---|---|---|---|---|---|
| Concentration | Average TP | Concentration | Average TP | Concentration | Average TP | Concentration | Average TP | |
| F3 | 0.2 µM | 23.32 | 0.2 µM | 20.4 | 0.2 µM | 22.6 | 0.2 µM | 23.78 |
| B3 | 0.2 µM | 0.2 µM | 0.2 µM | 0.2 µM | ||||
| FIP(F1c+F2) | 2.0 µM | 1.6 µM | 1.2 µM | 0.8 µM | ||||
| BIP(B1c+B2) | 2.0 µM | 1.6 µM | 1.2 µM | 0.8 µM | ||||
| Floop | 1.0 µM | 0.8 µM | 0.6 µM | 0.4 µM | ||||
| Bloop | 1.0 µM | 0.8 µM | 0.6 µM | 0.4 µM | ||||
| Sample Details | Dilution | Average Tp | Average Ta | CT-Values |
|---|---|---|---|---|
| PPRV/Morocco/2008 diluted in nuclease-free water | 10−1 | 46.3 | 84.25 | No CT |
| 10−2 | 46.65 | 84.25 | No CT | |
| 10−3 | 52.3 | 84.2 | No CT | |
| 10−4 | 56.45 | 84.3 | No CT | |
| 10−5 | No Tp | No Ta | No CT |
| Sample No. | Sample Details | dpc | Average Tp | Average Ta |
|---|---|---|---|---|
| 1 | Nasal-G1 | 0 | 0 | 0 |
| 2 | Nasal-G1 | 9 | 38.15 | 84.4 |
| 3 | Nasal-G1 | 10 | 36.63 | 84.55 |
| 4 | Nasal-G2 | 8 | 51.15 | 84.9 |
| 5 | Nasal-G2 | 10 | 0 | 0 |
| 6 | Eye-G3 | 0 | 0 | 0 |
| 7 | Eye-G3 | 8 | 51.15 | 84.9 |
| 8 | Saliva-G1 | 0 | 0 | 0 |
| 9 | Saliva-G1 | 9 | 29 | 84.5 |
| 10 | Saliva-G2 | 9 | 30 | 84.6 |
| 11 | Saliva-G2 | 10 | 0 | 0 |
| 12 | IBRI-Oman ( L-III)* | TCS | 36.375 | 84.75 |
| 13 | Nigeria 75/1 (L-II)* | TCS | 25.8 | 84.35 |
| 14 | Ivory Coast (L-I)* | TCS | 16.07 | 84.35 |
| 15 | Sungri/96 ( L-IV)* | TCS | 38.08 | 84.25 |
| 16 | Nasal- G10** | Field sample | 38.3 | 84.35 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mahapatra, M.; Howson, E.; Fowler, V.; Batten, C.; Flannery, J.; Selvaraj, M.; Parida, S. Rapid Detection of Peste des Petits Ruminants Virus (PPRV) Nucleic Acid Using a Novel Low-Cost Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Assay for Future Use in Nascent PPR Eradication Programme. Viruses 2019, 11, 699. https://doi.org/10.3390/v11080699
Mahapatra M, Howson E, Fowler V, Batten C, Flannery J, Selvaraj M, Parida S. Rapid Detection of Peste des Petits Ruminants Virus (PPRV) Nucleic Acid Using a Novel Low-Cost Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Assay for Future Use in Nascent PPR Eradication Programme. Viruses. 2019; 11(8):699. https://doi.org/10.3390/v11080699
Chicago/Turabian StyleMahapatra, Mana, Emma Howson, Veronica Fowler, Carrie Batten, John Flannery, Muneeswaran Selvaraj, and Satya Parida. 2019. "Rapid Detection of Peste des Petits Ruminants Virus (PPRV) Nucleic Acid Using a Novel Low-Cost Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Assay for Future Use in Nascent PPR Eradication Programme" Viruses 11, no. 8: 699. https://doi.org/10.3390/v11080699
APA StyleMahapatra, M., Howson, E., Fowler, V., Batten, C., Flannery, J., Selvaraj, M., & Parida, S. (2019). Rapid Detection of Peste des Petits Ruminants Virus (PPRV) Nucleic Acid Using a Novel Low-Cost Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Assay for Future Use in Nascent PPR Eradication Programme. Viruses, 11(8), 699. https://doi.org/10.3390/v11080699
