Next Article in Journal
Fungal Communities Associated with Bark Beetles in Pinus radiata Plantations in Northern Spain Affected by Pine Pitch Canker, with Special Focus on Fusarium Species
Next Article in Special Issue
Calcium and Potassium Imbalance Favours Leaf Blight and Defoliation Caused by Calonectria pteridis in Eucalyptus Plants
Previous Article in Journal
High Precision Individual Tree Diameter and Perimeter Estimation from Close-Range Photogrammetry
Previous Article in Special Issue
Comparing Methods for Monitoring Establishment of the Emerald Ash Borer (Agrilus planipennis, Coleoptera: Buprestidae) Egg Parasitoid Oobius agrili (Hymenoptera: Encyrtidae) in Maryland, USA
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Use of qPCR Reveals a High Frequency of Phytophthora quercina in Two Spanish Holm Oak Areas

by
Beatriz Mora-Sala
*,
Mónica Berbegal
and
Paloma Abad-Campos
Instituto Agroforestal Mediterráneo, Universitat Politècnica de València, Camino de Vera s/n, 46022 Valencia, Spain
*
Author to whom correspondence should be addressed.
Forests 2018, 9(11), 697; https://doi.org/10.3390/f9110697
Submission received: 17 October 2018 / Revised: 5 November 2018 / Accepted: 8 November 2018 / Published: 10 November 2018
(This article belongs to the Special Issue Impacts, Monitoring and Management of Forest Pests and Diseases)

Abstract

The struggling Spanish holm oak woodland situation associated with Phytophthora root rot has been studied for a long time. Phytophthora cinnamomi is considered the main, but not the only species responsible for the decline scenario. This study verifies the presence and/or detection of Phytophthora species in two holm oak areas of Spain (southwestern “dehesas” and northeastern woodland) using different isolation and detection approaches. Direct isolation and baiting methods in declining and non-declining holm oak trees revealed Phytophthora cambivora, Phytophthora cinnamomi, Phytophthora gonapodyides, Phytophthora megasperma, and Phytophthora pseudocryptogea in the dehesas, while in the northeastern woodland, no Phytophthora spp. were recovered. Statistical analyses indicated that there was not a significant relationship between the Phytophthora spp. isolation frequency and the disease expression of the holm oak stands in the dehesas. Phytophthora quercina and P. cinnamomi TaqMan real-time PCR probes showed that both P. cinnamomi and P. quercina are involved in the holm oak decline in Spain, but P. quercina was detected in a higher frequency than P. cinnamomi in both studied areas. Thus, this study demonstrates that molecular approaches complement direct isolation techniques in natural and seminatural ecosystem surveys to determine the presence and distribution of Phytophthora spp. This is the first report of P. pseudocryptogea in Europe and its role in the holm oak decline should be further studied.

1. Introduction

Holm oak (Quercus ilex L.) grows spontaneously throughout the Mediterranean basin, from the Iberian Peninsula to Turkey in the North and from Morocco to Tunisia in the South, having its optimum growing conditions in the Western Mediterranean regions [1]. Holm oak is a low nutrient demanding species, which prefers dry soils situated in Spain from sea level up to 2000 m high, although the most dense holm oak forests’ altitude ranges from 200 to 800 m. This species is well adapted to Mediterranean xeric conditions, with an early active taproot development and little branching at the expense of shoot development [2].
In Spain, holm oak is the most abundant evergreen Fagaceae tree species, covering almost all Spanish provinces except the Canary Islands and Galicia regions, where it is scarce [1]. About 2.8 M ha of the Spanish forestry surface are holm oak woodlands and 2.4 M ha are oak rangelands (henceforth called dehesas) (which consist mainly of holm oaks mixed with cork oaks (Quercus suber L.), and even a deciduous oak (Quercus faginea Lam.)) [3].
Holm oak constitutes a fundamental pillar of the Spanish dehesa, an agro–silvo–pastoral system, benefiting from the use of its fruit mainly for livestock during the autumn season and the grass growing underneath the canopy for grazing. Its wood it is also a valuable asset. In addition, it hosts migrant birds from Central and Northern Europe during the winter season. This complex system is suffering a significant decline due to biotic and abiotic factors [4,5]. The Spanish dehesas’ decline associated with Phytophthora root rot has been studied since the end of the 20th century [6,7,8,9,10,11]. Phytophthora cinnamomi Rands. is considered the main pathogen responsible for the decline of this ecosystem [4,7,8,9,10,12,13], but it is not the only Phytophthora species infecting holm oaks [14,15,16].
On the other hand, Spanish natural oak woodlands are also undergoing this decline caused by Phytophthora spp. [17,18]. Several studies across Europe demonstrate the association of declining oak woodlands with Phytophthora quercina T. Jung, among other species, causing root infections [19,20,21,22,23,24]. In addition, abiotic factors, such as increasing temperatures and water stress, are being enhanced by climate changing conditions, which have a negative impact on the tree health status, weakening the stands and making holm oaks more susceptible to Phytophthora and Pythium infection [9,24,25,26,27]. Moreover, in view of the lack of regeneration of the stands, reforestations and afforestations are conducted with nursery material, with the consequent risk of introducing alien Phytophthora species to natural ecosystems [14,28,29,30,31].
Some Phytophthora species infect plants without causing external symptoms and this plant material is transported worldwide, allowing pathogens to be disseminated without generating any alert at the inspection points [30,32]. Denman et al. [33] reported that leaves from holm oak and rhododendron saplings remained asymptomatic when they were infected with Phytophthora ramorum Werres, De Cock, and Man in’t Veld and Phytophthora kernoviae Brasier, Beales, and S.A. Kirk, two invasive species affecting ornamental and natural ecosystems. In 2006, imported ornamental Grevillea plants, which were asymptomatic, were found to be infected with Phytophthora niederhauserii Z.G. Abad and J.A. Abad [30]. Thus, visual screening for monitoring Phytophthora without complementary tests is not an appropriate management tool. The direct isolation of Phytophthora species on semiselective media from affected tissue or baiting techniques do not always generate quick and sensitive results, making it difficult to accurately monitor forest areas [5,20]. Economic and environmental losses caused by Phytophthora worldwide [31,34,35] require the use of all available techniques to detect and identify invasive species as quickly as possible. Combining direct isolation and baiting techniques with molecular tools, such as quantitative real-time PCR, increases the specificity, reproducibility, and sensitivity of the assessments, adding efficiency and accuracy to the diagnosis, an essential part of forest management strategies.
The aim of this study was to verify the presence of Phytophthora species in the holm oak rhizosphere in southwestern Spanish dehesas and in a northeastern Spanish holm oak woodland. In addition, the association between the Phytophthora species and the symptomatology of the holm oaks was studied in the dehesas by taking samples from declining and non-declining stands. For this purpose, different Phytophthora spp. isolation and detection approaches were performed: Direct isolation on semiselective media and apple and soil baiting using leaf material. Moreover, as P. cinnamomi and P. quercina are considered among the main pathogens associated with holm oak decline, their presence and relative abundance were studied in the samples using specific TaqMan real-time PCR probes.

2. Materials and Methods

2.1. Study Sites and Sampling

Studies were conducted in autumn 2012 and 2013 at 10 and 15 mature dehesas, respectively, located in the Extremadura region (southwestern Spain) (Table 1). This region has siliceous soils with Pyro bourgaeanae-Querceto rotundifoliae sigmetum vegetation series, and calcareous soils with Paeonio coriaceae-Querceto rotundifoliae sigmetum vegetation series, within an altitude ranging from 300 to 600 m [36]. At each site, two different areas were studied: A declining area where three symptomatic trees were randomly selected and a non-declining area with three randomly selected asymptomatic trees. Trees severely affected by aerial pathogens or insect pests were discarded. In the 2012 survey, one soil sample including fine roots from the rhizosphere around the base of each tree was collected (60 samples in total) by making three 20–30 cm deep holes at approximately 1 m distance from the trunk and bulked, obtaining a representative 0.5 kg sample, as described by Pérez-Sierra et al. [18] (Table 1). In the 2013 survey, sites 1 to 5 were sampled as described above, but in the remaining ten sites, two pooled samples per site were collected (Table 1). In sites 6 to 15 from 2013, one pooled sample from 3 declining trees and one pooled sample from 3 non-declining trees were collected at approximately 1 m distance from the trunk of each tree at 20–30 cm depth. Fifty samples in total were collected in 2013.
As differences in the Phytophthora spp. have been identified in eastern Spanish holm oak surveys [18], a study area located in northeastern Spain was included in the study. Montseny mountains is a 31,063 ha area located in Catalonia that since 1978 has been a biosphere reserve. It is made up of primarily siliceous rocks, with limestone rocks located on the western slopes of the mountains [37,38]. Quercus ilex is located in the lower altitudes among a Quercetum-ilicis-galloprovinciale vegetation series [38,39]. Fifteen holm oak declining stands showing defoliation, dead branches, and dieback symptoms and whose altitude ranged from 293 to 868 m were sampled as described above for 2012 just after a precipitation period in autumn 2013 (Table 1).
All the samples from the different surveys were transported to the laboratory, where roots were separated from soil for processing and soil was conserved at 5 °C until processing.

2.2. Phytophthora spp. Isolation

Roots from each sample were carefully washed under tap water and blotted on filter paper and direct isolation was performed on CMA-PARPB, as described by Jeffers and Martin [40], with and without the addition of hymexazol. Green apple baits were used for soil isolation. Granny Smith apples were surface disinfested with 95% ethanol. Four perpendicular 1 cm2 holes were cut, filled with soil and remains of fine roots, and moistened with sterile water. These filled holes were sealed with tape and incubated in covered trays at 20 °C. The apples were examined daily until lesions developed. Small tissue fragments from the edge of the lesions were plated on CMA-PARPB with and without hymexazol and incubated at 20 °C in the dark. Oomycete-like colonies grown both from root and soil samples were transferred to potato dextrose agar (PDA) (Biokar-Diagnostics, Beauvais, France) and incubated at 20 °C in the dark for 7 days for further identification. Pure cultures of all putative Phytophthora isolates were obtained by transferring single hyphal tips to PDA plates.
Additionally, in the 2013 surveys, soils were also baited using leaflets of Camellia sp., Rhododendron sp., and Viburnum sp., following the methods described by Jung et al. [41,42]. Isolations were made using CMA-PARBPH as the selective agar medium [40] and processed as described above.

2.3. Culture DNA Extraction, Sequencing, and Statistical Analyses

DNA was extracted from pure cultures of putative Phytophthora grown on PDA by scraping the mycelium and grinding to a fine powder under liquid nitrogen, using the commercial kit EZNA Plant Miniprep Kit (Omega Bio-Tek, Doraville, GA, USA) following the manufacturer’s instructions. Ribosomal DNA ITS amplifications were carried out using the universal primers ITS6 and ITS4 [43,44]. The PCR reaction final volume was 25 µL: PCR buffer 1×, 2.5 mM MgCl2, 200 µM each dNTP, 0.4 µM of each primer, 1 U of DNA Taq polymerase (Dominion MBL, Córdoba, Spain), and 1 µL of template DNA. All PCR reactions were performed in a PTC 200 thermocycler (MJ Research Inc., Waltham, MA, USA) with the following parameters: 94 °C for 3 min; 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 45 s; and 72 °C for 10 min. Amplified products were sequenced at Macrogen Europe (Amsterdam, The Netherlands). The isolates were identified to the species level by conducting Basic Local Alignment Search Tool (BLAST) and comparing with the sequence data on international collection databases (Phytophthora Database, https://www.phytophthoradb.org and GenBank, https://www.ncbi.nlm.nih.gov/genbank/).
The total number of Phytophthora spp. isolates (Phytophthora pool) obtained and the number of isolates from each Phytophthora species were converted into frequencies relative to the total number of Phytophthora isolates recovered in the dehesas surveys. An analysis of variance (ANOVA) was performed with the 2012 and 2013 dehesas’ data using a general linear model (GLM) in SAS version 9.0 (SAS Institute, Cary, NC, USA), in order to study the relationship between the frequency and diversity of Phytophthora spp. and the symptomatology shown by the trees in the dehesas. Mean values were compared using the Fischer’s least significant difference (LSD) procedure at p-value = 0.05.

2.4. Environmental Samples: DNA Extraction and P. cinnamomi and P. quercina qPCRs

Roots and soil from both types of holm oak stands were tested with specific TaqMan probes for the main two oak Phytophthora pathogens, P. cinnamomi and P. quercina [16,45]. Each soil sample was passed through a 2 mm sieve to remove the organic matter and gravel. Once it was homogenized, 50–80 g per sample was lyophilized overnight and pulverized using FRITSCH Variable Speed Rotor Mill-PULVERISETTE 14 (ROSH, Oberstein, Germany). DNA was extracted in duplicate with the Power Soil DNA Isolation Kit (MO BIO Laboratories, Carlsbad, CA, USA) following the manufacturer’s protocol. The root samples were first ground using a mortar and pestle under liquid nitrogen and then extraction was performed from 60 to 80 mg using the Power Plant Pro DNA Isolation Kit (MO BIO Laboratories, Carlsbad, CA, USA).
Real-time PCR was performed on a Rotor-Gene Q 5plex HRM (QIAGEN, Hilden, Germany) and data were analyzed with the Software Version 2.0.2. (QIAGEN) following the MIQE guidelines [46]. The primers quercina_F (GGTCTTGTCTGGCGTATGG), quercina_R (AGCTACTTGTTCAGACCGAAG), and the hydrolysis probe (6-FAM/GCTGTAAAA/ZEN/GGCGGCGGCTGTTGC/IaBlk-FQ/) designed by Català et al. [16] were used to detect P. quercina in DNA from all the soil and root samples collected in the study. In addition, P. cinnamomi was also tested with the primers P cin FF (CAATTAGTTGGGGGCCTGCT), P cin RF (GCAGCAGCAGCCGTCG), and the P cin hydrolysis probe (TTGACATCGACAGCCGCCGC) [45]. The qPCRs were performed in a total volume of 25 µL using Premix Ex TAQ (Probe qPCR; Takara Biotechnology (Dalian), Co., Ltd., China). Reactions consisted of 12.5 µL Premix Ex Taq (2×), 2.5 µL of primers–probe mix (500 nM of each primer and 250 nM probe), 1 µL of BSA (5 mg/mL) and 2 µL of template DNA. Two-step PCR was performed with the following cycling conditions: 95 °C for 1 min; 45 cycles of 95 °C for 5 s and 60 °C for 45 s for P. quercina, while for P. cinnamomi, 45 cycles of 95 °C for 5 s and 60 °C for 60 s. Two replicates were performed alongside standard dilution curves of P. quercina (isolate Ps-982 from Mediterranean Agroforestry Institute–UPV collection) and P. cinnamomi (isolate Ps-727 from Mediterranean Agroforestry Institute–UPV collection). Probe sensitivity was tested with serial dilution of each DNA ranging from 0.2 ng/µL to 2 fg/µL for P. quercina DNA; 2 ng/µL P. cinnamomi DNA (2 ng/µL) was serially diluted (1:10, 1:102, 1:103, 1:104, 1:105, 2:106). Negative samples were diluted and tested again to avoid false negatives.

3. Results

3.1. Phytophthora spp. Isolation

In the 2012 survey, Phytophthora spp. were detected in three dehesas, which represented 30% of the sampled sites. Three isolates of Phytophthora were recovered through the apple baiting method, one of each of: Phytophthora cambivora (Petri) Buisman (from a non-declining site), P. cinnamomi, and Phytophthora gonapodyides (H.E. Petersen) Buisman (from declining sites) (Table 2).
In 2013, the dehesas were surveyed and the soils baited in addition to the other methods already described for 2012. Phytophthora spp. were recovered in the 2013 dehesas survey from 21 holm oak samples, which represented 42% of the total samples, with 20% from declining samples and the remaining 22% from non-declining samples. A total of 165 Oomycetes isolates were obtained in 2013: 59 Phytophthora spp. isolates (clustered into four species) and 107 Pythium spp. isolates. In 2013, 39% of the Phytophthora spp. isolates were recovered from declining sites, and 61% were recovered from non-declining sites (Table 3). Regarding the isolation method, 13.4% of the Phytophthora spp. isolates were isolated directly from roots, 5.1% from apple baits, and 81.3% from leaf baits. As for the diversity of species obtained in 2013, P. cinnamomi, P. gonapodyides, Phytophthora megasperma Drechsler and Phytophthora pseudocryptogea Safaiefarahani, Mostowfizadeh, G.E. Hardy, and T.I. Burgess were isolated (Table 3). The range of abundance according to isolation was 39% P. cinnamomi, 35.6% P. gonapodyides, 20.3% P. megasperma, and 5.1% P. pseudocryptogea.
Twenty-three isolates of P. cinnamomi were isolated from eight samples in the dehesas in 2013 (Table 3); percentages from declining and non-declining samples are shown in Figure 1. Twenty-one cultures of P. gonapodyides were isolated from five samples, with most of the samples from non-declining sites (Table 3, Figure 1). Twelve P. megasperma isolates were isolated from five samples (Table 3), and most of these samples were from non-declining trees (Figure 1). Three P. pseudocryptogea cultures were isolated from two samples (Table 3, Figure 1).
The statistical analysis showed that the factors’ symptomatology (p-value = 0.3626) and dehesa (p-value = 0.3087) were not significant for the frequency of the different Phytophthora species present in the dehesas in 2013. Considering the different species isolated separately, only the presence of P. gonapodyides was significantly higher in non-declining samples (p-value = 0.0366). The presence of either one species or another was not significantly associated with the dehesa factor (P. cinnamomi p-value = 0.2277, P. gonapodyides p-value = 0.9176 and P. megasperma p-value = 0.7029). P. pseudocryptogea was only isolated in one dehesa, but from both declining and non-declining sites.
No Phytophthora isolates were recovered from the 15 samples of the Montseny Biosphere Reserve by direct isolation on semiselective media from affected tissues and/or the baiting.

3.2. Environmental Samples: Hydrolysis Probes—P. cinnamomi and P. quercina qPCRs

The Phytophthora quercina standard curve plot showed that the correlation between the Cq-value and the DNA concentration was high (r2 = 0.99966), with an efficiency of 0.90389. For P. quercina, the limit of detection (LOD) was established at a DNA concentration of 2 fg/µL.
Phytophthora quercina was detected in all the surveyed dehesas in 2012 (65.1% of the samples). Of these, 31.8% came from declining holm oak trees and 33.3% from non-declining trees (Table 2). In 2013, P. quercina was detected in all the surveyed dehesas (79.6% of the samples) (Table 3). A total of 66.7% of the soil samples were positive for P. quercina: 27.8% were from declining soil samples, while 38.9% were from non-declining soil samples. A total of 55.6% of the root samples were positive for P. quercina: 24.1% were from declining holm oak fine roots, while 31.5% were from non-declining holm oak roots. In the survey conducted in Montseny Biosphere Reserve in 2013, 66.7% of the samples were positive for P. quercina, of which 40% were from root samples and 53.3% from soil samples (Table 4).
The Phytophthora cinnamomi standard curve revealed a high correlation between the Cq-value and the DNA concentration (r2 = 0.99731), with a reaction efficiency of 0.92014. The LOD was established at 4 fg/μL.
Phytophthora cinnamomi was detected in seven out of the ten surveyed dehesas in 2012 (19.7% of the samples) (Table 2). A total of 12.1% of the soil detections came from declining holm oak trees and 7.6% from non-declining. In 2013, P. cinnamomi was detected in 11 dehesas (57.4% of the samples) (Table 3). A total of 38.9% of the soil samples were positive for P. cinnamomi; 22.2% were from declining trees, while 16.7% were from non-declining trees. A total of 33.9% of the root samples were positive for P. cinnamomi, with 22.2% from declining oak fine roots and 14.8% from non-declining oak roots. In Montseny Biosphere Reserve, 53.3% of the samples were positive for P. cinnamomi, of which 46.7% were from root samples and 33.3% from soil samples (Table 4).

4. Discussion

This study provides evidence that molecular approaches complement direct isolation methods of Phytophthora species from fine roots from holm oak in natural (Montseny Biosphere Reserve) and seminatural (dehesas) ecosystems, confirming that it is not only P. cinnamomi that is involved in the holm oak decline in Spain, but P. quercina is also present. Moreover, this is the first report of P. pseudocryptogea in Europe.
Regarding traditional isolation methods, an increase in Phytophthora isolation was observed in the dehesas in 2013 compared with the sampling conducted in the dehesas in 2012. This was probably not only due to the implementation of the leaf baiting technique, but also because in 2013, isolation of Phytophthora spp. from fine roots was more successful. This could be explained by the fact that under favorable environmental conditions, Phytophthora spp. infected the tree root systems and rotted fine roots containing the pathogens detached from the plant, so the pathogens can establish again in the soil [47]. Phytophthora spp. dispersion requires warm temperatures and free water to produce infective zoospores; if not, they remain as resistant structures in the soil [34]. Furthermore, the efficiency of Phytophthora isolation techniques can be compromised by the climatic conditions suffered during the period previous to the survey and by the presence of other microorganisms [8,34]. In fact, the dehesa regions where the surveys were conducted received less precipitation in 2012 than in 2013 [48]. Thus, according to this, the environmental conditions for Phytophthora spp. isolation were more favorable in 2013 than in 2012 in the southwestern Spanish dehesas, as they were recovered in 2013 from fresh lesions [49]. Another possible explanation for the low efficiency of Phytophthora recovery in Montseny Biosphere Reserve is the presence of other fast-growing species in the samples, such as Pythium spp., making the isolation difficult. Pythium spp. were recorded in very low numbers in dehesas in 2012 (explained by the absence of favorable environmental conditions), but their presence was very relevant in the 2013 dehesas and in the Montseny Biosphere Reserve surveys. The genus Pythium is present in almost all soils and, as the isolation medium used for Phytophthora isolation is semiselective [34,40], Pythium spp. were also isolated with a high frequency in our study and were able to mask Phytophthora spp. presence.
Oak decline, associated with abiotic and biotic factors, has been occurring across Europe during the past decades [4,11,22,28,42,50]. Among the several Phytophthora species that have been associated with this decline, P. cinnamomi has been considered the main biotic factor responsible for oak mortality in Spain since the 1990s [8,9,51]. In 2013, P. cinnamomi was the most frequent species isolated in the infested dehesas, as was expected according to previous studies [7,52]. In addition to P. cinnamomi, Corcobado et al. [15] reported that P. gonapodyides was also involved in oak decline in this region. In our surveys, P. gonapodyides, P. megasperma, and P. pseudocryptogea were recovered at low frequencies, and these species may play an important role as causal agents of the disease, as reported in other studies, where they were also recovered at low frequencies [14,25,28,52]. There is no statistical evidence to support a differential distribution of Phytophthora species among the dehesas in 2013. Moreover, statistical results indicated that there was not a significant relationship between the Phytophthora spp. isolation frequency and the symptomatology of the holm oak stands. Our results showed a higher percentage of Phytophthora spp. recovery in 2013 from non-declining sites than from declining sites. Phytophthora cinnamomi, which was found in six dehesas, either from declining or from non-declining trees, is a primary root pathogen of woody species, considered a hemibiotrophic organism with life strategies which can change from biotrophic to necrotrophic, according to the environmental conditions [53,54,55]. This species is also present in plant reservoirs and, depending on its behavior, will determine if the plant remains asymptomatic or not [54,55,56,57]. Furthermore, P. cinnamomi is highly aggressive to holm oaks, as demonstrated previously [11,12,25,58,59,60]. Tsao [61] stated that a certain percentage of lost roots is required for symptoms to emerge and our results in the 2013 survey provide evidence that a tree symptomatology is not always an indication about the conditions of its root system. Statistical analyses showed that P. gonapodyides is more frequent in non-declining stands, in agreement with the results of Vettraino et al. [28], while the other species found did not show any statistical pattern. Phytophthora gonapodyides is known to attack the small or fine feeder roots [62] and to produce a wilting toxin [41]. Nevertheless, Brasier et al. [62] stated that P. gonapodyides is often in balance with the unstressed oak root system, but this can change under stress conditions, contributing to a rapid decline. Hansen et al. [63] suggested that some Phytophthora spp. from clade 6 ecologically related to Phytophthora chlamydospora could cause limited root damage with no above ground disease symptoms contributing to the oak decline. Phytophthora megasperma isolated in the present study had been previously associated with oak decline [28,42]. Although it is considered a pathogen of herbaceous plants and agricultural trees, it can become a serious problem when the oak balance is broken due to other factors, such as droughts or waterlogging [34]. A similar behavior has been indicated for other Phytophthora spp. such as P. gonapodyides [10]. Phytophthora megasperma, P. quercina, P. psychrophila, Phytophthora drechsleri, and Phytophthora syringae have also been associated with oak decline [18,19,25], although these species were not found in our samples. Nevertheless, P. pseudocryptogea in the present study was isolated for the first time in Europe and from a holm oak-rangeland in Spain. This species was described by Safaiefarahani et al., who re-evaluated the P. cryptogea complex [64]. Although it was isolated from three soil samples in the present study, from three soil samples, the role of P. pseudocryptogea in holm oak decline remains unknown. The pathogenicity of this species in holm oak should be further studied.
The results obtained with the P. quercina probe are relevant, since it has always been thought that the holm oak decline in acidic soils in Spain is caused primarily by P. cinnamomi. Phytophthora cinnamomi was present in a high number of samples in both study locations, as was expected, but surprisingly it was not the most frequent species detected. Phytophthora quercina was shown as the most frequent species in this study, and the number of positive samples was higher in both studied areas. Molecular diagnoses provide faster and more sensitive detection of Phytophthora spp. [16,45,65,66,67,68,69,70,71,72].

5. Conclusions

Different Phytophthora species were detected and identified in the study areas, regardless of whether they cause symptoms of decline or not. Further research is needed to clarify the effect of these pathogens in combination and abiotic factors in the oak stands. The implementation of the different direct and baiting isolation techniques for the isolation of Phytophthora spp., along with the available molecular detection techniques, allows a better diagnosis and understanding of the role of Phytophthora spp. in the holm oak forest areas.

Author Contributions

B.M.-S. conducted field sampling, performed experimental work and data analysis in lab experiments, discussed the results, and wrote the paper. M.B. participated in the data analyses, discussed the results, and revised the manuscript. P.A.-C. designed the study and revised the manuscript.

Funding

This research was supported by funding from the project AGL2011-30438-C02-01 (Ministerio de Economía y Competitividad, Spain).

Acknowledgments

We would like to thank M. León from the Instituto Agroforestal Mediterráneo–UPV (Spain) for technical assistance. The authors are grateful to A. Solla and his team from the Centro Universitario de Plasencia–Universidad de Extremadura (Spain) for helping in the southwestern sample collection.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Romane, F.; Terradas, J. Quercus ilex L. Ecosystems: Function, Dynamics and Management; Kluwer Academic Publishers: Dordrecht, The Netherlands, 1992; p. 377. ISBN 0-79231-764-5. [Google Scholar]
  2. Moro, R. Guía de los árboles de España; Omega: Barcelona, Spain, 2007; p. 407. ISBN 8-42821-043-8. [Google Scholar]
  3. MAGRAMA. Diagnóstico del Sector Forestal Español. Análisis y Prospectiva. Serie Agrinfo/Medioambiente nº 8. Ed. Ministerio de Agricultura, Alimentación y Medio Ambiente. Madrid, Spain, 2014. Available online: https://www.mapa.gob.es/ministerio/pags/Biblioteca/Revistas/pdf_AAYPP%2FAPMA_2014_8.pdf (accessed on 30 August 2016).
  4. Camilo-Alves, C.S.P.; da Clara, M.I.E.; de Almeida Ribeiro, N.M.C. Decline of Mediterranean oak trees and its association with Phytophthora cinnamomi: A review. Eur. J. For. Res. 2013, 132, 411–432. [Google Scholar] [CrossRef] [Scilit]
  5. Sena, K.; Crocker, E.; Vincelli, P.; Barton, C. Phytophthora cinnamomi as a driver of forest change: Implications for conservation and management. For. Ecol. Manag. 2018, 409, 799–807. [Google Scholar] [CrossRef] [Scilit]
  6. Cobos, J.M.; Montoya, R.; Tuset, J.J. New damages to the oak woodlands in Spain—Preliminary evaluation of the possible implication of Phytophthora cinnamomi. In Recent Advances in Studies on Oak Decline, Proceedings of the International Congress Recent Advances in Studies on Oak Decline, Selva di Fasano, Brindisi, Italy, 13–18 Septemper 1992; Luisi, N., Lerario, P., Vannini, A., Eds.; Dipartamento di Patología Vegetóle, Universitá degli Studi: Bari, Italy, 1992; pp. 163–169. [Google Scholar]
  7. Tuset, J.J.; Hinarejos, C.; Mira, J.L.; Cobos, M. Implicación de Phytophthora cinnamomi Rands en la enfermedad de la seca de encinas y alcornoques. Bol. Sanid. Veg. Plagas 1996, 22, 491–499. [Google Scholar]
  8. Brasier, C.M. Oak tree mortality in Iberia. Nature 1992, 360, 539. [Google Scholar] [CrossRef] [Scilit]
  9. Brasier, C.M. Phytophthora cinnamomi and oak decline in southern Europe—Environmental constraints including climate change. Ann. Sci. For. 1996, 53, 347–358. [Google Scholar] [CrossRef] [Scilit]
  10. Brasier, C.M.; Robredo, F.; Ferraz, J.F.P. Evidence for Phytophthora cinnamomi involvement in Iberian oak decline. Plant Pathol. 1993, 42, 140–145. [Google Scholar] [CrossRef] [Scilit]
  11. Gallego, F.J.; Perez de Algaba, A.; Fernandez-Escobar, R. Etiology of oak decline in Spain. Eur. J. For. Pathol. 1999, 29, 17–27. [Google Scholar] [CrossRef] [Scilit]
  12. Sánchez, M.E.; Caetano, P.; Ferraz, J.; Trapero, A. Phytophtora disease of Quercus ilex in south-western Spain. For. Pathol. 2002, 32, 5–18. [Google Scholar] [CrossRef] [Scilit]
  13. Sánchez, M.E.; Sánchez, J.E.; Navarro, R.M.; Fernández, P.; Trapero, A. Incidencia de la podredumbre radical causada por Phytophthora cinnamomi en masas de Quercus en Andalucía. Bol. Sanid. Veg. Plagas 2003, 29, 87–108. [Google Scholar]
  14. Sanchez, M.E.; Andicoberry, S.; Trapero, A. Pathogenicity of three Phytophthora spp. causing late seedling rot of Quercus ilex ssp. ballota. For. Pathol. 2005, 35, 115–125. [Google Scholar] [CrossRef] [Scilit]
  15. Corcobado, T.; Cubera, E.; Pérez-Sierra, A.; Jung, T.; Solla, A. First report of Phytophthora gonapodyides involved in the decline of Quercus ilex in xeric conditions in Spain. New Dis. Rep. 2010, 22, 33. [Google Scholar] [CrossRef] [Scilit]
  16. Català, S.; Berbegal, M.; Pérez-Sierra, A.; Abad-Campos, P. Metabarcoding and development of new real-time specific assays reveal Phytophthora species diversity in Holm Oak forests in eastern Spain. Plant Pathol. 2017, 66, 115–123. [Google Scholar] [CrossRef] [Scilit]
  17. Luque, J.; Parladé, J.; Pera, J. Pathogenicity of fungi isolated from Quercus suber in Catalonia (NE Spain). For. Pathol. 2000, 30, 247–263. [Google Scholar] [CrossRef] [Scilit]
  18. Pérez-Sierra, A.; López-García, C.; León, M.; García-Jiménez, J.; Abad-Campos, P.; Jung, T. Previously unrecorded low-temperature Phytophthora species associated with Quercus decline in a Mediterranean forest in eastern Spain. For. Pathol. 2013, 43, 331–339. [Google Scholar] [CrossRef] [Scilit]
  19. Jung, T.; Cooke, D.E.L.; Blaschke, H.; Duncan, J.M.; Oßwald, W. Phytophthora quercina sp. nov., causing root rot of European oaks. Mycol. Res. 1999, 103, 785–798. [Google Scholar] [CrossRef] [Scilit]
  20. Nechwatal, J.; Schlenzig, A.; Jung, T.; Cooke, D.E.L.; Duncan, J.M.; Oßwald, W.F. A combination of baiting and PCR techniques for the detection of Phytophthora quercina and P. citricola in soil samples from oak stands. For. Pathol. 2001, 31, 85–97. [Google Scholar] [CrossRef] [Scilit]
  21. Balci, Y.; Halmschlager, E. Phytophthora species in oak ecosystems in Turkey and their association with declining oak trees. Plant Pathol. 2003, 52, 694–702. [Google Scholar] [CrossRef] [Scilit]
  22. Balci, Y.; Balci, S.; MacDonald, W.L.; Gottschalk, K.W. Relative susceptibility of oaks to seven species of Phytophthora isolated from oak forest soils. For. Pathol. 2008, 38, 394–409. [Google Scholar] [CrossRef] [Scilit]
  23. Jönsson, U.; Jung, T.; Rosengren, U.; Nihlgard, B.; Sonesson, K. Pathogenicity of Swedish isolates of Phytophthora quercina to Quercus robur in two different soils. New Phytol. 2003, 158, 355–364. [Google Scholar] [CrossRef] [Scilit]
  24. Martín-García, J.; Solla, A.; Corcobado, T.; Siasou, E.; Woodward, S. Influence of temperature on germination of Quercus ilex in Phytophthora cinnamomi, P. gonapodyides, P. quercina and P. psychrophila infested soils. For. Pathol. 2015, 45, 215–223. [Google Scholar] [CrossRef] [Scilit]
  25. Sánchez, M.E.; Caetano, P.; Romero, M.A.; Navarro, R.M.; Trapero, A. Phytophthora root rot as the main factor of oak decline in southern Spain. In Progress in Research on Phytophthora Diseases of Forest Trees, Proceedings of the Third International IUFRO Working Party S07.02.09, Freising, Germany, 11–18 September 2004; Brasier, C.M., Jung, T., Oßwald, W., Eds.; Forest Research: Farnham, UK, 2006; pp. 149–154. ISBN 0-85538-721-1. [Google Scholar]
  26. Romero, M.A.; Sánchez, J.E.; Jiménez, J.J.; Belbahri, L.; Trapero, A.; Lefort, F.; Sánchez, M.E. New Pythium taxa causing root rot in Mediterranean Quercus species in southwest Spain and Portugal. J. Phytopathol. 2007, 115, 289–295. [Google Scholar] [CrossRef] [Scilit]
  27. Jiménez, A.J.; Sánchez, E.J.; Romero, M.A.; Belbahri, L.; Trapero, A.; Lefort, F.; Sánchez, M.E. Pathogenicity of Pythium spiculum and P. sterilum on feeder roots of Quercus rotundifolia. Plant Pathol. 2008, 57, 369. [Google Scholar] [CrossRef] [Scilit]
  28. Vettraino, A.M.; Barzanti, G.P.; Bianco, M.C.; Ragazzi, A.; Capretti, P.; Paoletti, E.; Vannini, A. Occurrence of Phytophthora species in oak stands in Italy and their association with declining oak trees. For. Pathol. 2002, 32, 19–28. [Google Scholar] [CrossRef] [Scilit]
  29. Rizzo, D.M.; Garbelotto, M.; Hansen, E.M. Phytophthora ramorum: Integrative research and management of an emerging pathogen in California and Oregon forests. Ann. Rev. Phytopathol. 2005, 43, 309–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Brasier, C.M. The biosecurity threat to the UK and global environment from international trade in plants. Plant Pathol. 2008, 57, 792–808. [Google Scholar] [CrossRef] [Scilit]
  31. Jung, T.; Orlikowski, L.; Henricot, B.; Abad-Campos, P.; Aday, A.G.; Aguín Casal, O.; Bakonyi, J.; Cacciola, S.O.; Cech, T.; Chavarriaga, D.; et al. Widespread Phytophthora infestations in European nurseries put forest, semi-natural and horticultural ecosystems at high risk of Phytophthora diseases. For. Pathol. 2016, 46, 134–163. [Google Scholar] [CrossRef] [Scilit]
  32. Hullbert, J.M.; Agne, M.C.; Burgess, T.I.; Roets, F.; Wingfield, M.J. Urban environments provide opportunities for early detections of Phytophthora invasions. Biol. Invasions 2017, 19, 3629–3644. [Google Scholar] [CrossRef] [Scilit]
  33. Denman, S.; Kirk, S.A.; Moralejo, E.; Webber, J.F. Phytophthora ramorum and Phytophthora kernoviae on naturally infected asymptomatic foliage. Bull. OEPP 2009, 39, 105–111. [Google Scholar] [CrossRef] [Scilit]
  34. Erwin, D.C.; Ribeiro, O.K. Phytophthora Diseases Worldwide; APS Press: St. Paul, MN, USA, 1996; p. 562. ISBN 0-89054-212-0. [Google Scholar]
  35. Hernández-Lambraño, R.E.; González-Moreno, P.; Sánchez-Agudo, J.A. Environmental factors associated with the spatial distribution of invasive plant pathogens in the Iberian Peninsula: The case of Phytophthora cinnamomi Rands. For. Ecol. Manag. 2018, 419–420, 101–109. [Google Scholar] [CrossRef] [Scilit]
  36. Jiménez, M.P.; Díaz-Fernández, P.M.; Iglesias, S.; De Tuero, M.; Gil, L. Regiones de procedencia Quercus ilex L.; Instituto Nacional para la Conservación de la Naturaleza: Madrid, Spain, 1996; p. 100. ISBN 84-8014-143-3. [Google Scholar]
  37. Boada, M.; Puig, J.; Barriocanal, C. The effects of isolation and Natural Park coverage for landrace in situ conservation: And approach from the Montseny mountains (NE Spain). Sustainability 2013, 5, 654–663. [Google Scholar] [CrossRef] [Scilit]
  38. García, C. Estudio faunístico y ecológico de la familia Phoridae en el P. N. del Montseny. Ph.D Thesis, Universidad de Barcelona, Barcelona, Spain, 2013. [Google Scholar]
  39. Peñuelas, J.; Boada, M. A global change-induced biome shift in the Montseny mountains (NE Spain). Glob. Chang. Biol. 2003, 9, 131–140. [Google Scholar] [CrossRef] [Scilit]
  40. Jeffers, S.N.; Martin, S.B. Comparison of two media selective for Phytophthora and Pythium species. Plant Dis. 1986, 70, 1038–1043. [Google Scholar] [CrossRef] [Scilit]
  41. Jung, T.; Blaschke, H.; Neumann, P. Isolation, identification and pathogenicity of Phytophthora species from declining oak stands. Eur. J. For. Pathol. 1996, 26, 253–272. [Google Scholar] [CrossRef] [Scilit]
  42. Jung, T.; Blaschke, H.; Oßwald, W. Involvement of soilborne Phytophthora species in Central European oak decline and the effect of site factors on the disease. Plant Pathol. 2000, 49, 706–718. [Google Scholar] [CrossRef] [Scilit]
  43. White, T.J.; Bruns, S.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
  44. Cooke, D.E.L.; Drenth, A.; Duncan, J.M.; Wagels, G.; Brasier, C.M. A Molecular Phylogeny of Phytophthora and Related Oomycetes. Fungal Genet. Biol. 2000, 30, 17–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Kunadiya, M.; White, D.; Dunstan, W.A.; Hardy, G.E.St.J.; Andjic, V.; Burgess, T.I. Pathways to false-positive diagnoses using molecular detection methods; Phytophthora cinnamomi a case study. FEMS Microbiol. Lett. 2017, 364, fnx009. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Shearer, B.L.; Tippett, J.T. Jarrah Dieback: The Dynamics and Management of Phytophthora cinnamomi in the Jarrah (Eucalyptus marginata) Forests of South-Western Australia; Lewis, M., Ed.; Department of Conservation and Land Management: Como, Australia, 1989; ISSN 1032-8106. [Google Scholar]
  48. AEMET. Available online: http://www.aemet.es/es/ (accessed on 20 May 2016).
  49. Shearer, B.L.; Shea, S.R. Variation in seasonal population fluctuations of Phytophthora cinnamomi within and between infected Eucalyptus marginata sites of southwestern Australia. For. Ecol. Manag. 1987, 21, 209–230. [Google Scholar] [CrossRef] [Scilit]
  50. Balci, Y.; Halmschlager, E. Incidence of Phytophthora species in oak forests in Austria and their possible involvement in oak decline. For. Pathol. 2003, 33, 157–174. [Google Scholar] [CrossRef] [Scilit]
  51. Brasier, C.M.; Hamm, P.B.; Hansen, E.M. Cultural characters, protein patterns and unusual mating behaviour of P. gonapodyides isolates from Britain and North America. Mycol. Res. 1993, 97, 1287–1298. [Google Scholar] [CrossRef] [Scilit]
  52. Corcobado, T.; Cubera, E.; Moreno, G.; Solla, A. Quercus ilex forests are influenced by annual variations in water table, soil water deficit and fine root loss caused by Phytophthora cinnamomi. Agric. For. Meteorol. 2013, 169, 92–99. [Google Scholar] [CrossRef] [Scilit]
  53. Hardham, A.R.; Blackman, L.M. Molecular cytology of Phytophthora–plant interactions. Australas. Plant Path. 2010, 39, 29. [Google Scholar] [CrossRef] [Scilit]
  54. Crone, M.; McComb, J.; O’Brien, P.A.; Hardy, G.E. Survival of Phytophthora cinnamomi as oospores, stromata, and thick-walled chlamydospores in roots of symptomatic and asymptomatic annual and herbaceous perennial plant species. Fungal Biol. 2013, 117, 112–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Crone, M.; McComb, J.; O’Brien, P.A.; Hardy, G.E. Assessment of Australian native annual/herbaceous perennial plant species as asymptomatic or symptomatic hosts of Phytophthora cinnamomi under controlled conditions. For. Pathol. 2013, 43, 245–251. [Google Scholar] [CrossRef] [Scilit]
  56. Gómez-Aparicio, L.; Ibáñez, B.; Serrano, M.S.; De Vita, P.; Ávila, J.M.; Pérez-Ramos, I.M.; García, L.V.; Sánchez, M.E.; Marañón, T. Spatial patterns of soil pathogens in declining Mediterranean forests: Implications for trees regeneration. New Phytol. 2012, 194, 1014–1024. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Serrano, M.S.; de Vita, P.; Fernández-Rebollo, P.; Sánchez, M.E. Calcium fertilizers induce soil suppressiveness to Phytophthora cinnamomi root rot of Quercus ilex. Eur. J. Plant Pathol. 2012, 132, 271–279. [Google Scholar] [CrossRef] [Scilit]
  58. Robin, C.; Desprez-Loustau, M.L. Testing variability in pathogenicity of Phytophthora cinnamomi. Eur. J. Plant Pathol. 1998, 104, 465–475. [Google Scholar] [CrossRef] [Scilit]
  59. Robin, C.; Desprez-Loustau, M.L.; Capron, G.; Delatour, C. First record of Phytophthora cinnamomi on cork and holm oaks in France and evidence of pathogenicity. Ann. Sci. For. 1998, 55, 869–883. [Google Scholar] [CrossRef] [Scilit]
  60. Robin, C.; Capron, G.; Desprez-Loustau, M.L. Root infection by Phytophthora cinnamomi in seedlings of three oak species. Plant Pathol. 2001, 50, 708–716. [Google Scholar] [CrossRef] [Scilit]
  61. Tsao, P.H. Why many Phytophthora root rots and crown rots of tree and horticultural crops remain undetected. Bull. OEPP 1990, 20, 11–17. [Google Scholar] [CrossRef] [Scilit]
  62. Brasier, C.M.; Cooke, D.E.L.; Duncan, J.M.; Hansen, E.M. Multiple new phenotypic taxa from trees and riparian ecosystems in Phytophthora gonapodyides-P. megasperma ITS Clade 6, which tend to be high-temperature tolerant and either inbreeding or sterile. Mycol. Res. 2003, 107, 277–290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Hansen, E.M.; Reeser, P.; Sutton, W.; Brasier, C.M. Redesignation of Phytophthora taxon Pgchlamydo as Phytophthora chlamydospora sp. nov. N. Am. Fungi 2015, 10, 1–14. [Google Scholar]
  64. Safaiefarahani, B.; Mostowfizadeh-Ghalamfarsa, R.; Hardy, G.E.; Burgess, T.I. Re-evaluation of Phytophthora cryptogea species complex and the description of a new species, Phytophthtora pseudocryptogea sp. nov. Mycol. Prog. 2015, 14, 108. [Google Scholar] [CrossRef] [Scilit]
  65. Ippolito, A.; Schena, L.; Nigro, F.; Soleti, V.L.; Yaseen, T. Real-time detection of Phytophthora nicotianae and P. citrophthora in citrus roots and soil. Eur. J. Plant Pathol. 2004, 110, 833–843. [Google Scholar] [CrossRef] [Scilit]
  66. Bonants, P.J.; van Gent-Pelzer, M.P.; Hooftman, R.; Cooke, D.E.L.; Guy, D.C.; Duncan, J.M. A combination of baiting and different PCR formats, including measurement of real-time quantitative fluorescence, for the detection of Phytophthora fragariae in strawberry plants. Eur. J. Plant Pathol. 2004, 110, 689–702. [Google Scholar] [CrossRef] [Scilit]
  67. Tooley, P.W.; Martin, F.N.M.; Carras, M.M.; Frederick, R.D. Real-time fluorescent Polymerase Chain Reaction detection of Phytophthora ramorum and Phytophthora pseudosyringae using mitochondrial gene regions. Am. Phytopathol. Soc. 2006, 96, 336–345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Schena, L.; Hughes, K.J.D.; Cooke, D.E.L. Detection and quantification of Phytophthora ramorum, P. kernoviae, P. citricola and P. quercina in symptomatic leaves by multiplex real-time PCR. Mol. Plant Pathol. 2006, 7, 365–379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. Schena, L.; Duncan, J.M.; Cooke, D.E.L. Development and application of a PCR-based ‘molecular tool box’ for the identification of Phytophthora species damaging forests and natural ecosystems. Plant Pathol. 2008, 57, 64–75. [Google Scholar] [CrossRef] [Scilit]
  70. Hughes, K.J.D.; Tomlinson, J.A.; Giltrap, P.M.; Barton, V.; Hobden, E.; Boonham, N.; Lane, C.R. Development of a real-time PCR assay for detection of Phytophthora kernoviae and comparison of this method with a conventional culturing technique. Eur. J. Plant Pathol. 2011, 131, 695–703. [Google Scholar] [CrossRef] [Scilit]
  71. Than, D.J.; Hughes, K.J.D.; Boonhan, N.; Tomlinson, J.A.; Woodhall, J.W.; Bellgard, S.E. A TaqMan real-time PCR assay for the detection of Phytophthora ‘taxon Agathis’ in soil, pathogen of Kauri in New Zealand. For. Pathol. 2013, 43, 324–330. [Google Scholar] [CrossRef] [Scilit]
  72. Touseef, H.; Bir, P.S.; Firoz, A. A quantitative real-time PCR based method for the detection of Phytophthora infestans causing Late blight of potato, in infested soil. Saud. J. Biol. Sci. 2014, 21, 380–386. [Google Scholar]
Figure 1. Percentage of each Phytophthora species cultures isolated in the dehesas 2013 survey according to whether the holm oaks were declining or non-declining.
Figure 1. Percentage of each Phytophthora species cultures isolated in the dehesas 2013 survey according to whether the holm oaks were declining or non-declining.
Forests 09 00697 g001
Table 1. Description of the survey conducted in 2012 and 2013 in the dehesas of the Extremadura region and in 2013 in the oak woodland of Montseny Biosphere Reserve.
Table 1. Description of the survey conducted in 2012 and 2013 in the dehesas of the Extremadura region and in 2013 in the oak woodland of Montseny Biosphere Reserve.
2012 Dehesas
SiteNumber of SamplesX CoordinateY Coordinate
16748324.994428259.51
26248632.544460613.6
367525004418487
46694464.024431470.91
567525004418487
66750948.574437972.39
767426854456109
86753940.254450439.88
962484284459568
1067492804457282
2013 Dehesas
SiteNumber of SamplesX CoordinateY Coordinate
16748324.994428259.51
26248632.544460613.6
367525004418487
46694464.024431470.91
56761398,914425067.28
62750948.574437972.39
727426854456109
82753940.254450439.88
922484284459568
1027495804457274
1122797994430500
122285614.184435261.32
1322819734432507
142724766.44438845.56
152246007.774396525.56
2013 Montseny Biosphere Reserve (Oak Woodland)
SiteNumber of SamplesX CoordinateY Coordinate
MS 214501344625428
MS 614586104621206
MS 1214571724620252
MS 1314571974620078
MS 1414553464619895
MS 1614547634621083
MS 1814551614621632
MS 2214552664618911
MS 2314540864619117
MS 2414539794619403
MS 2514529614620152
MS 2614527344619947
MS 2714513984622040
MS 2814505374622715
MS 2914498294622703
Table 2. Number of isolates of Phytophthora spp. obtained from Quercus ilex roots and soil in the 2012 survey in the dehesas of the Extremadura region according to the symptomatology of the sampled trees and results of the TaqMan real-time PCR assays. Results obtained from samples in each site are grouped according to whether samples were from declining or non-declining trees.
Table 2. Number of isolates of Phytophthora spp. obtained from Quercus ilex roots and soil in the 2012 survey in the dehesas of the Extremadura region according to the symptomatology of the sampled trees and results of the TaqMan real-time PCR assays. Results obtained from samples in each site are grouped according to whether samples were from declining or non-declining trees.
SiteSymptomatologyIsolatesqPCR
CINQUE
CAMCINGONRootsSoil *RootsSoil *
1d001 andt0/3ndt3/3
1nd000ndt2/3ndt3/3
2d000ndt0/3ndt1/3
2nd000ndt0/3ndt1/3
3d000ndt0/3ndt2/3
3nd000ndt1/3ndt0/3
4d000ndt0/3ndt1/3
4nd000ndt0/3ndt3/3
5d000ndt0/3ndt2/3
5nd000ndt1/3ndt1/3
6d000ndt1/3ndt3/3
6nd000ndt0/3ndt2/3
7d000ndt0/3ndt2/3
7nd000ndt0/3ndt3/3
8d000ndt2/3ndt2/3
8nd000ndt0/3ndt3/3
9d000ndt2/3ndt0/3
9nd1 a00ndt1/3ndt2/3
10d01 a0ndt1/3ndt3/3
10nd000ndt0/3ndt3/3
d = declining; nd = non-declining; CAM = Phytophthora cambivora; CIN = Phytophthora cinnamomi; GON = Phytophthora gonapodyides; QUE = Phytophthora quercina; a = isolated from soil with apple baiting; ndt = not determined; * = number of positive samples detected out of the total number of samples.
Table 3. Number of isolates of Phytophthora spp. obtained from Q. ilex roots and soil in the 2013 survey in the dehesas of the Extremadura region according to whether samples were from declining or non-declining trees and results of the TaqMan real-time PCR assays. PCR results obtained from samples in sites 1 to 5 are grouped according to whether samples were from declining or non-declining trees.
Table 3. Number of isolates of Phytophthora spp. obtained from Q. ilex roots and soil in the 2013 survey in the dehesas of the Extremadura region according to whether samples were from declining or non-declining trees and results of the TaqMan real-time PCR assays. PCR results obtained from samples in sites 1 to 5 are grouped according to whether samples were from declining or non-declining trees.
SiteSymptomatologyIsolatesqPCR
CINQUE
CINGONPSCMEGRoots *Soil *Roots *Soil *
1d01 b000/32/32/33/3
1nd4 r,b8 r,b04 b2/32/33/33/3
2d00000/31/32/31/3
2nd03 b03 b1/32/31/33/3
3d4 b0003/32/30/30/3
3nd00002/31/31/31/3
4d0002 b0/32/33/33/3
4nd03 b000/31/32/33/3
5d3 b0002/30/31/32/3
5nd2 b6 b001/31/33/33/3
6d0000+
6nd0000+
7d0000++++
7nd0000++
8d0000++
8nd0000+++
9d0000+
9nd0001 b+++
10d3 r,b000+++
10nd0000+
11d1 b000++
11nd0000++
12d0000++
12nd0000++
13d0000+++
13nd0000+
14d0001 b
14nd0000++
15d5 a,b02 b0++++
15nd1 r01 a0++
d = declining; nd = non-declining; CIN = P. cinnamomi; GON = P. gonapodyides; MEG = Phytophthora megasperma; PSC = Phytophthora pseudocryptogea; QUE = P. quercina; r = isolated from roots; a = isolated from soil with apple baiting; b = isolated from baiting soil with leaves; * = number of positive detected samples out of the total number of samples; + = positive; − = negative.
Table 4. Results of the TaqMan real-time PCR assays obtained from Q. ilex roots and soil in the 2013 survey in the oak woodland of Montseny Biosphere Reserve.
Table 4. Results of the TaqMan real-time PCR assays obtained from Q. ilex roots and soil in the 2013 survey in the oak woodland of Montseny Biosphere Reserve.
SiteqPCR
CINQUE
RootsSoilRootsSoil
MS 2+++
MS 6++
MS 12++
MS 13++
MS 14+
MS 16+
MS 18
MS 22++
MS 23+++
MS 24+++
MS 25
MS 26+++
MS 27+
MS 28+
MS 29++
CIN = P. cinnamomi. QUE = P. quercina. + = positive detection; − = negative detection.

Share and Cite

MDPI and ACS Style

Mora-Sala, B.; Berbegal, M.; Abad-Campos, P. The Use of qPCR Reveals a High Frequency of Phytophthora quercina in Two Spanish Holm Oak Areas. Forests 2018, 9, 697. https://doi.org/10.3390/f9110697

AMA Style

Mora-Sala B, Berbegal M, Abad-Campos P. The Use of qPCR Reveals a High Frequency of Phytophthora quercina in Two Spanish Holm Oak Areas. Forests. 2018; 9(11):697. https://doi.org/10.3390/f9110697

Chicago/Turabian Style

Mora-Sala, Beatriz, Mónica Berbegal, and Paloma Abad-Campos. 2018. "The Use of qPCR Reveals a High Frequency of Phytophthora quercina in Two Spanish Holm Oak Areas" Forests 9, no. 11: 697. https://doi.org/10.3390/f9110697

APA Style

Mora-Sala, B., Berbegal, M., & Abad-Campos, P. (2018). The Use of qPCR Reveals a High Frequency of Phytophthora quercina in Two Spanish Holm Oak Areas. Forests, 9(11), 697. https://doi.org/10.3390/f9110697

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop