Genetic Diversity and Population Structure of Camellia drupifera (Theaceae) and Its Related Species Evaluated by SSR Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material Collection
2.2. Genomic DNA Extraction and Detection
2.3. Polymorphic SSR Primer Screening and Microsatellite Genotyping
2.4. Fluorescence PCR Amplification
2.5. Genotype Data Acquisition
2.6. Genetic Analysis
3. Results
3.1. Assessment of SSR Marker Diversity Levels
3.2. Population Genetic Evaluation
3.3. Population Genetic Structure Analysis
3.4. Genetic Relationship Identification
4. Discussion
4.1. Development of Effective SSR Genotyping Markers for C. drupifera and Its Related Species
4.2. Population Structure of C. drupifera and Its Related Species
4.3. Genetic Relationships Among C. drupifera and Its Related Species
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liang, H.; Qi, H.; Wang, Y.; Sun, X.; Wang, C.; Xia, T.; Chen, J.; Ye, H.; Feng, X.; Xie, S.; et al. Comparative chloroplast genome analysis of Camellia oleifera and C. meiocarpa: Phylogenetic relationships, sequence variation and polymorphic markers. Trop. Plants 2024, 3, e023. [Google Scholar] [CrossRef]
- Sun, J.; Huang, D.; Xia, S.; Zhang, Y.; Tao, J. Research progress of woody oil crops in China: A review. Seed Biol. 2024, 3, e008. [Google Scholar] [CrossRef]
- Lin, P.; Wang, K.; Wang, Y.; Hu, Z.; Yan, C.; Huang, H.; Ma, X.; Cao, Y.; Long, W.; Liu, W.; et al. The genome of oil-Camellia and population genomics analysis provide insights into seed oil domestication. Genome Biol. 2022, 23, 14. [Google Scholar] [CrossRef] [PubMed]
- Dou, X.; Wang, X.; Ma, F.; Yu, L.; Mao, J.; Jiang, J.; Zhang, L.; Li, P. Geographical origin identification of camellia oil based on fatty acid profiles combined with one-class classification. Food Chem. 2024, 433, 137306. [Google Scholar] [CrossRef] [PubMed]
- Luan, F.; Zeng, J.; Yang, Y.; He, X.; Wang, B.; Gao, Y.; Zeng, N. Recent advances in Camellia oleifera Abel: A review of nutritional constituents, biofunctional properties, and potential industrial applications. J. Funct. Foods 2020, 75, 104242. [Google Scholar] [CrossRef]
- Chen, J.; Guo, Y.; Hu, X.; Zhou, K. Comparison of the Chloroplast Genome Sequences of 13 Oil-Tea Camellia Samples and Identification of an Undetermined Oil-Tea Camellia Species From Hainan Province. Front. Plant Sci. 2021, 12, 798581. [Google Scholar] [CrossRef]
- Yao, X.; Ren, H.; Ma, J.; Wang, K. Oil-Tea Camellia Genetic Resource in China; Science Press: Beijing, China, 2020. [Google Scholar]
- Ye, Z.; Wu, Y.; Muhammad, Z.U.H.; Yan, W.; Yu, J.; Zhang, J.; Yao, G.; Hu, X. Complementary transcriptome and proteome profiling in the mature seeds of Camellia oleifera from Hainan Island. PLoS ONE 2020, 15, e0226888. [Google Scholar] [CrossRef]
- Yuan, J.; Han, Z.; He, Y.; Huang, L.; Zhou, N. Investigation and Cluster Analysis of Main Morphological and Economical Characters for Oiltea Resource in Hainan Province. J. Plant Genet. Resour. 2014, 15, 1380–1384. [Google Scholar] [CrossRef]
- Yang, L.; Zhang, Z.; Chen, J.; Chen, X.; Ji, Q.; Zheng, D. The quantitative characters and diversity of oiltea fruit in Hainan province. Nonwood For. Res. 2018, 36, 69–76. [Google Scholar] [CrossRef]
- Guo, Y.; Wang, P.; Zhou, K.; Chen, J. Effects of producing regions on the cultivation traits differences of Camellia vietnamensis in Hainan Province. J. For. Environ. 2019, 39, 431–437. [Google Scholar] [CrossRef]
- Xia, T.; Xiong, Z.; Wang, C.; Sun, X.; Chen, Y.; Chen, J.; Qi, H.; Liang, H.; Zhang, L.; Zheng, D. Comprehensive analysis of the effects of the traditional stir-fry process on the dynamic changes of volatile metabolites in Hainan camellia oil. Food Chem. X 2024, 23, 101747. [Google Scholar] [CrossRef] [PubMed]
- Jia, X.; Liu, Y.; Xu, Y.; Yu, Z. Metabonomic Analysis of Mature Grains of Camellia hainanica and Camellia oleifera. Mol. Plant Breed. 2022, 20, 8255–8263. [Google Scholar] [CrossRef]
- Zheng, D.; Pan, X.; Zhang, D.; Xi, L.; Zeng, J.; Zhang, Z.; Ye, H. Survey and Analysis on Tea-oil Camellia Resource in Hainan. J. Northwest For. Univ. 2016, 31, 130–135, 169. [Google Scholar] [CrossRef]
- Wan, T. Genetic Diversity and Phylogeography of Wild Prunus tomentosa in China. Ph.D. Thesis, Northwest A&F University, Xianyang, China, 2023. [Google Scholar]
- Jia, X.; Chen, L.; Yu, F.; Zhang, N. Preliminary Report on Genetic and Economic Traits of Tea-oil Camellia in Hainan Province. Chin. J. Trop. Agric. 2018, 38, 56–60. [Google Scholar]
- Gong, Q. A Comparative Study on Resource Characteristics and Affiliation of Hainan Oil-Tea. Master’s Thesis, Central South University of Forestry & Technology, Changsha, China, 2018. [Google Scholar]
- Ye, T.; Yuan, D.; Li, Y.; Xiao, S.; Gong, S.; Zhang, J.; Li, S.; Luo, J. Ploidy Identification of Camellia hainanica. Sci. Silvae Sin. 2021, 57, 61–69. [Google Scholar] [CrossRef]
- Xia, T.; Xiong, Z.; Sun, X.; Chen, J.; Wang, C.; Chen, Y.; Zheng, D. Metabolomic profiles and health-promoting functions of Camellia drupifera mature-seeds were revealed relate to their geographical origins using comparative metabolomic analysis and network pharmacology approach. Food Chem. 2023, 426, 136619. [Google Scholar] [CrossRef]
- Qi, H.; Sun, X.; Wang, C.; Chen, X.; Yan, W.; Chen, J.; Xia, T.; Ye, H.; Yu, J.; Dai, J.; et al. Geographic isolation causes low genetic diversity and significant pedigree differentiation in populations of Camellia drupifera, a woody oil plant native to China. Ind. Crop. Prod. 2023, 192, 116026. [Google Scholar] [CrossRef]
- Chen, X.; Yun, Y.; Wu, Y.; Qi, H.; Yang, L.; Chen, J.; Zheng, D. Genetic Diversity Analysis of Camellia oleifera Resources Based on SRAP Markers in Hainan Island. J. Trop. Subtrop. Bot. 2019, 27, 659–668. [Google Scholar]
- Xu, Z.; Yuan, D.; Tang, Y.; Wu, L.; Zhao, Y. Camellia hainanica (Theaceae) a new species from Hainan, supported from morphological characters and phylogenetic analysis. Pak. J. Bot. 2020, 52, 1025–1032. [Google Scholar] [CrossRef]
- Rani, R.; Raza, G.; Tung, M.H.; Rizwan, M.; Ashfaq, H.; Shimelis, H.; Razzaq, M.K.; Arif, M. Genetic diversity and population structure analysis in cultivated soybean (Glycine max [L.] Merr.) Using SSR and EST-SSR markers. PLoS ONE 2023, 18, e0286099. [Google Scholar] [CrossRef]
- Yang, W.; Bai, Z.; Wang, F.; Zou, M.; Wang, X.; Xie, J.; Zhang, F. Analysis of the genetic diversity and population structure of Monochasma savatieri Franch. Ex Maxim using novel EST-SSR markers. BMC Genom. 2022, 23, 597. [Google Scholar] [CrossRef] [PubMed]
- Kapoor, M.; Mawal, P.; Sharma, V.; Gupta, R.C. Analysis of genetic diversity and population structure in Asparagus species using SSR markers. J. Genet. Eng. Biotechnol. 2020, 18, 50. [Google Scholar] [CrossRef] [PubMed]
- Cheng, L.; Cao, B.; Xie, S.; Yang, L.; Zhang, Y.; Cheng, Q.; Liu, J.; Yu, S.; Hu, D. Genetic diversity of wild Camellia oleifera in northern China revealed by simple sequence repeat markers. Genet. Resour. Crop Evol. 2024, 71, 2657–2672. [Google Scholar] [CrossRef]
- Dong, L.; Tian, Q.; Huang, B.; Xu, L.; Wen, Q. Association Analysis of Economic Traits with SSR Markers in Camellia chekiangoleosa. Mol. Plant Breed. 2022, 20, 4710–4722. [Google Scholar] [CrossRef]
- Liao, C. Development of EST-SSR Markers and Genetic Diversity Analysis of Tea-Oil Camellia in Southern Jiangxi. Master’s Thesis, Guangzhou University, Guangzhou, China, 2023. [Google Scholar]
- Wen, Q.; Xu, L.; Gu, Y.; Huang, M.; Xu, L. Development of polymorphic microsatellite markers in Camellia chekiangoleosa (Theaceae) using 454-ESTs. Am. J. Bot. 2012, 99, e203–e205. [Google Scholar] [CrossRef]
- Li, H.; Ding, H.; Chen, Y.; Xu, L.; Li, N.; Chuanjiu, H. Identification of 12 Superior Cultivars of Camellia oleifera by Using Simple Sequence Repeat Feature Indexes. J. Chin. Cereals Oils Assoc. 2017, 32, 171–178. [Google Scholar] [CrossRef]
- Yan, H.; Qi, H.; Li, Y.; Wu, Y.; Wang, Y.; Chen, J.; Yu, J. Assessment of the Genetic Relationship and Population Structure in Oil-Tea Camellia Species Using Simple Sequence Repeat (SSR) Markers. Genes 2022, 13, 2162. [Google Scholar] [CrossRef]
- Dong, B.; Deng, Z.; Liu, W.; Rehman, F.; Yang, T.; Huang, Y.; Gong, H. Development of expressed sequence tag simple sequence repeat (EST-SSR) markers and genetic resource analysis of tea oil plants (Camellia spp.). Conserv. Genet. Resour. 2022, 14, 41–45. [Google Scholar] [CrossRef]
- Jia, B.G.; Lin, Q.; Feng, Y.Z.; Hu, X.Y.; Tan, X.F.; Shao, F.G.; Zhang, L. Development and cross-species transferability of unigene-derived microsatellite markers in an edible oil woody plant, Camellia oleifera (Theaceae). Genet. Mol. Res. 2015, 14, 6906–6916. [Google Scholar] [CrossRef]
- Song, J.; Li, X.; Zhang, S.; Lai, H.; Hu, X.; Zhou, Y.; Chen, M.; Wang, J.; Pang, Z. Development and Evaluation of SSR Markers Based on Transcriptome Sequencing of Camellia in Hainan Province. Mol. Plant Breed. 2022, 20, 6791–6801. [Google Scholar] [CrossRef]
- Schuelke, M. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 2000, 18, 233–234. [Google Scholar] [CrossRef] [PubMed]
- Christelová, P.; De Langhe, E.; Hřibová, E.; ížková, J.; Sardos, J.; Hušáková, M.; Van den Houwe, I.; Sutanto, A.; Kepler, A.K.; Swennen, R.; et al. Molecular and cytological characterization of the global Musa germplasm collection provides insights into the treasure of banana diversity. Biodivers. Conserv. 2017, 26, 801–824. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef] [PubMed]
- Pritchard, J.K.; Stephens, M.; Rosenberg, N.A.; Donnelly, P. Association Mapping in Structured Populations. Am. J. Hum. Genet. 2000, 67, 170–181. [Google Scholar] [CrossRef]
- Li, Y.L.; Liu, J.X. StructureSelector: A web-based software to select and visualize the optimal number of clusters using multiple methods. Mol. Ecol. Resour. 2018, 18, 176–177. [Google Scholar] [CrossRef]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef]
- Puechmaille, S.J. Program structure does not reliably recover the correct population structure when sampling is uneven: Subsampling and new estimators alleviate the problem. Mol. Ecol. Resour. 2016, 16, 608–627. [Google Scholar] [CrossRef]
- Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. Clumpak: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v6: Recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024, 52, W78–W82. [Google Scholar] [CrossRef] [PubMed]
- Lin, P.; Yao, X.H.; Wang, K.L.; Zheng, T.T.; Teng, J.H. Identification and Genetic Analysis of Camellia oleifera Changlin Series Superior Clones by SRAP Molecular Marker. J. Agric. Biotechnol. 2010, 18, 272–279. [Google Scholar]
- Xiao, P.; Liu, H.; Wang, D.; Tang, W.; Yang, H.; Wang, C.; He, Z.; Wang, R.; Wang, X.; Lu, X.; et al. Assessment of genetic diversity in Camellia oleifera Abel. Accessions using inter-simple sequence repeat (ISSR) and start codon targeted (SCoT) polymorphic markers. Genet. Resour. Crop Evol. 2020, 67, 1115–1124. [Google Scholar] [CrossRef]
- Xie, Y.; Yao, X.; Li, Z.; Huang, Y. Analysis of Genetic Difference and Relationship of Camellia meiocarpa Native Varieties by Morphology and AFLP Markers. Forest Res. 2014, 27, 201–207. [Google Scholar]
- Kao, A.; Wang, S.; Wang, Y.; Xu, Z.; Zhou, Y.; Ding, C. Analyses of genetic diversity among 65 wild Camellia oleifera based on ISSR and RAPD. Guihaia 2014, 34, 419–425. [Google Scholar]
- Yan, R.; Ruan, C.; Zhao, S.; Ding, J.; Du, W.; Wang, H.; Han, P. SNP discovery of Camellia oleifera based on RNA-seq and its application for identification of genetic relationships and locus for oil content among different cultivars. J. Hortic. Sci. Biotechnol. 2020, 95, 687–702. [Google Scholar] [CrossRef]
- Devarumath, R.M.; Nandy, S.; Rani, V.; Marimuthu, S.; Muraleedharan, N.; Raina, S.N. RAPD, ISSR and RFLP fingerprints as useful markers to evaluate genetic integrity of micropropagated plants of three diploid and triploid elite tea clones representing Camellia sinensis (China type) and C. assamica ssp. Assamica (Assam-India type). Plant Cell Rep. 2002, 21, 166–173. [Google Scholar] [CrossRef]
- Tian, Q.; Huang, B.; Huang, J.; Wang, B.; Dong, L.; Yin, X.; Gong, C.; Wen, Q. Microsatellite analysis and polymorphic marker development based on the full-length transcriptome of Camellia chekiangoleosa. Sci. Rep. 2022, 12, 18906. [Google Scholar] [CrossRef]
- Wang, P.; Su, J.; Wu, H.; Chen, Y.; Xie, Y.; Wang, H.; He, G.; Chen, N.; Wei, C.; Yang, L.; et al. Analysis of germplasm genetic diversity and construction of a core collection in Camellia oleifera C. Abel by integrating novel simple sequence repeat markers. Genet. Resour. Crop Evol. 2023, 70, 1517–1530. [Google Scholar] [CrossRef]
- Wu, S.; Ye, H.; Chen, Y.; Deng, J.; Su, J.; Xie, Y.; Xie, Q.; Zhang, Z.; Qin, Z.; Xiao, Y.; et al. Characterization and cross-species transferability of a novel set of microsatellites derived from root transcriptomes of Camellia oleifera. Plant Genet. Resour. Charact. Util. 2019, 17, 371–374. [Google Scholar] [CrossRef]
- Jia, B.; Lin, Q.; Zhang, L.; Tan, X.; Lei, X.; Hu, X.; Shao, F. Development of 15 genic-SSR markers in oil-tea tree (Camellia oleifera) based on transcriptome sequencing. Genetika 2014, 46, 789–797. [Google Scholar] [CrossRef]
- Yin, X.; Li, T.; Tian, Q.Q.; Dong, L.; Xu, L.A.; Wen, Q. Development of Novel Polymorphic Microsatellite Markers and their Application for Closely Related Camellia (Theaceae) Species. Russ. J. Genet. 2022, 58, 404–412. [Google Scholar] [CrossRef]
- Zhu, Y.; Liang, D.; Song, Z.; Tan, Y.; Guo, X.; Wang, D. Genetic Diversity Analysis and Core Germplasm Collection Construction of Camellia oleifera Based on Fruit Phenotype and SSR Data. Genes 2022, 13, 2351. [Google Scholar] [CrossRef] [PubMed]
- Balloux, F. Heterozygote excess in small populations and the heterozygote-excess effective population size. Evol. Int. J. Org. Evol. 2004, 58, 1891–1900. [Google Scholar] [CrossRef]
- Zhou, Q.; Mu, K.; Ni, Z.; Liu, X.; Li, Y.; Xu, L. Analysis of genetic diversity of ancient Ginkgo populations using SSR markers. Ind. Crop Prod. 2020, 145, 111942. [Google Scholar] [CrossRef]
- Zou, Y.; Ge, X.; Yan, C.; Zhong, Q.; Chen, D.; Chen, Z.; Yuan, Y.; Guo, H.; Zhou, Y.; Wang, J.; et al. Assessment of genetic diversity of Camellia yuhsienensis based on leaf structure and inter simple sequence repeat (ISSR) markers. Genet. Resour. Crop Evol. 2024, 71, 4749–4762. [Google Scholar] [CrossRef]
- Yang, Y.; Hong, Y.; Huang, Y.; Yao, X.; Wang, K. Analysis of Genetic Diversity for Camellia meiocarpa Hu. Population in Southwest Area of China by SRAP. Hunan Agric. Sci. 2011, 13, 1–4. [Google Scholar] [CrossRef]
- Huang, Y. Study on introgressive hybridization of sympatric populations of Camellia meiocarpa and Camellia oleifera. Chin. J. Appl. Ecol. 2013, 24, 2345–2352. [Google Scholar]
- Ding, Y. Genetic Diversity Analysis and Molecular ID Card Construction of Ancient Chestnut Trees and Varieties (Lines) in Yanshan. Master’s Thesis, Hebei Normal University of Science & Technology, Qinhuangdao, China, 2023. [Google Scholar]
- Song, L.; Wang, X.; Liu, W.; Yang, H.; Fu, J.; Hu, X.; Gao, Y.; Li, J. Genetic Diversity Analysis of 504 Tomato Germplasm Resources Based on SNP Markers. J. Nucl. Agric. Sci. 2022, 36, 2366–2373. [Google Scholar] [CrossRef]
- Qi, H. Molecular Identification and Genetic Diversity Evaluation of Tea-Oil Camellia resources of Hainan Island. Master’s Thesis, Hainan University, Haikou, China, 2020. [Google Scholar]
- Qi, H.; Sun, X.; Yan, W.; Ye, H.; Chen, J.; Yu, J.; Jun, D.; Wang, C.; Xia, T.; Chen, X.; et al. Genetic relationships and low diversity among the tea-oil Camellia species in Sect. Oleifera, a bulk woody oil crop in China. Front. Plant Sci. 2020, 13, 996731. [Google Scholar] [CrossRef]
- Shi, J.; Dai, X.; Chen, Y.; Chen, J.; Shi, J.; Yin, T. Discovery and experimental analysis of microsatellites in an oil woody plant Camellia chekiangoleosa. Plant Syst. Evol. 2013, 299, 1387–1393. [Google Scholar] [CrossRef]
- Sharma, R.K.; Bhardwaj, P.; Negi, R.; Mohapatra, T.; Ahuja, P.S. Identification, characterization and utilization of unigene derived microsatellite markers in tea (Camellia sinensis L.). BMC Plant Biol. 2009, 9, 53. [Google Scholar] [CrossRef] [PubMed]
- Huang, X. Genetie structure of hexaploid wild Camellia oleifera in mount Jinggang and Lu based on microsatellite markers. Master’s Thesis, Nanchang University, Nanchang, China, 2016. [Google Scholar]
- Dai, H.; Shen, T.; Shi, T.; Li, R. Genomic SSR Loci Mining and Genetic Diversity Analysis of Camellia oleifera Based on Genome Sequences. Crops 2024, 40, 23–31. [Google Scholar] [CrossRef]
- Yan, R.; Ruan, C.; Du, W.; Ding, J.; Wu, B.; Liu, L. Development of SSR Markers for Target-Genes Derived from Camellia oleifera by RNA-seq Technology. Mol. Plant Breed. 2018, 16, 2540–2548. [Google Scholar] [CrossRef]






| Locus | Repeat Motif | Primer Sequence (5′–3′) | Amplified Fragments Size (bp) | Annealing Temperature (°C) |
|---|---|---|---|---|
| C191 [28] | (AAAT)6 | F: CATCGACACAAATCCTAACAACA R: CCTTCCCTTCCTTATCCTTACAG | 157 | 52 |
| C46 [28] | (TTG)6 | F: AATCGGATCTGAGGGTTGTCTAT R: TTGTAAATGCTTCAGAAATGCCT | 160 | 52 |
| C96 [28] | (TG)11 | F: ACAAAGAAACACAACCTCACGAT R: ACCCAAAAGATGAATTGTGCTAA | 145 | 52 |
| Ck89 [29] | (CCGATG)5 | F: TGCCTTTGACCAACTCTA R: TTCCGACCTCCAACACTC | 252 | 52 |
| Co81 [30] | (GAT)n | F: GGTCAAAACGAAGAAGAAGATCA R: GGGATTCCCAATAGAGAGCC | 146–161 | 52 |
| CoA011 [31] | (CTT)5 | F: TGGGTGGCTCAATATCATCA R: ACCGGCCATTTATATGGGTT | 200 | 52 |
| CoA032 [31] | (GCG)5 | F: TTATTCTTCGGGAACAACGG R: ACACATGAAACAACGGCAAA | 170 | 52 |
| CoA038 [31] | (GTG)7 | F: GAGATCGGCCAGAGTTTGAG R: CATCAAAGCCACACTCGCTA | 202 | 52 |
| CoA046 [31] | (TAAC)4 | F: AACCAGAGGAACATCCAACG R: TATCCTTGCCGCTTTGAATC | 196 | 52 |
| CoA069 [31] | (TGC)6 | F: CATGGCTTGGCTTCAATCTT R: CAATGTTCCCAAGCGATTCT | 224 | 52 |
| CoSSR68 [32] | (TGA)8 | F: TTCAGGAGGGCTCGACGATAAT R: GTTGGGGATTCAGGGGCGATTT | 234 | 52 |
| CoUg3402 [33] | (GAT)8 | F: ACTCTTGTGGGTGAATGTTG R: GCTGGTAGGTTGGTTATGTT | 205 | 52 |
| SJMCoa003 [34] | (CAA)7 | F: ACGAAACATGTCGGACGTGA R: GGGAATGGACGAGACTTGGG | 120 | 52 |
| SJMCoa090 [34] | (TCA)9 | F: ACAGAAGGCGTTTGAGTCAA R: GGCTTCTTCTTCGGAACCCA | 165 | 52 |
| Locus | Product Size (bp) | Na | Ne | I | Ho | He | ||||
|---|---|---|---|---|---|---|---|---|---|---|
| Mean | SD | Mean | SD | Mean | SD | Mean | SD | |||
| C191 | 136–155 | 6 | 1.847 | 0.271 | 0.629 | 0.125 | 0.917 | 0.084 | 0.442 | 0.110 |
| C46 | 152–170 | 6 | 1.968 | 0.047 | 0.685 | 0.013 | 0.914 | 0.083 | 0.492 | 0.013 |
| C96 | 125–139 | 8 | 1.980 | 0.029 | 0.688 | 0.008 | 0.952 | 0.050 | 0.495 | 0.008 |
| Ck89 | 243–288 | 13 | 1.733 | 0.376 | 0.542 | 0.252 | 0.925 | 0.083 | 0.383 | 0.185 |
| Co81 | 134–186 | 16 | 1.748 | 0.273 | 0.587 | 0.166 | 0.847 | 0.235 | 0.409 | 0.123 |
| CoA011 | 187–205 | 7 | 1.791 | 0.304 | 0.599 | 0.162 | 0.915 | 0.057 | 0.419 | 0.134 |
| CoA032 | 161–179 | 7 | 1.855 | 0.205 | 0.643 | 0.079 | 0.931 | 0.066 | 0.453 | 0.073 |
| CoA038 | 193–217 | 9 | 1.921 | 0.099 | 0.671 | 0.029 | 0.906 | 0.107 | 0.478 | 0.028 |
| CoA046 | 188–216 | 8 | 1.762 | 0.313 | 0.573 | 0.220 | 0.881 | 0.129 | 0.405 | 0.157 |
| CoA069 | 212–263 | 12 | 1.892 | 0.159 | 0.659 | 0.055 | 0.923 | 0.087 | 0.467 | 0.052 |
| CoSSR68 | 221–266 | 14 | 1.883 | 0.257 | 0.631 | 0.176 | 0.936 | 0.081 | 0.452 | 0.127 |
| CoUg3402 | 178–202 | 9 | 1.870 | 0.308 | 0.611 | 0.216 | 0.936 | 0.065 | 0.440 | 0.156 |
| SJMCoa003 | 104–131 | 10 | 1.918 | 0.110 | 0.669 | 0.034 | 0.904 | 0.114 | 0.477 | 0.032 |
| SJMCoa090 | 149–182 | 12 | 1.947 | 0.085 | 0.678 | 0.026 | 0.926 | 0.088 | 0.485 | 0.025 |
| Mean | – | 9.786 | 1.865 | – | 0.633 | – | 0.915 | – | 0.450 | – |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, Y.; Liu, Y.; Yu, Z.; Wu, K.; Cao, Q.; Gong, H.; Yang, Y.; Ye, J.; Jia, X. Genetic Diversity and Population Structure of Camellia drupifera (Theaceae) and Its Related Species Evaluated by SSR Markers. Forests 2024, 15, 2066. https://doi.org/10.3390/f15122066
Xu Y, Liu Y, Yu Z, Wu K, Cao Q, Gong H, Yang Y, Ye J, Jia X. Genetic Diversity and Population Structure of Camellia drupifera (Theaceae) and Its Related Species Evaluated by SSR Markers. Forests. 2024; 15(12):2066. https://doi.org/10.3390/f15122066
Chicago/Turabian StyleXu, Yufen, Yanju Liu, Zhaoyan Yu, Kunlin Wu, Qiulin Cao, Han Gong, Yaodong Yang, Jianqiu Ye, and Xiaocheng Jia. 2024. "Genetic Diversity and Population Structure of Camellia drupifera (Theaceae) and Its Related Species Evaluated by SSR Markers" Forests 15, no. 12: 2066. https://doi.org/10.3390/f15122066
APA StyleXu, Y., Liu, Y., Yu, Z., Wu, K., Cao, Q., Gong, H., Yang, Y., Ye, J., & Jia, X. (2024). Genetic Diversity and Population Structure of Camellia drupifera (Theaceae) and Its Related Species Evaluated by SSR Markers. Forests, 15(12), 2066. https://doi.org/10.3390/f15122066

