Screening and Expression Characteristics of Plant Type Regulatory Genes in Salix psammophila
Abstract
1. Introduction
2. Materials and Methods
2.1. Location and Materials
2.2. Methods
2.2.1. Investigation of Plant Type
2.2.2. Construction of Hydroponic Prediction Group and RNA-seq
2.2.3. Target Gene Selection
2.2.4. Construction of Field Test Group
2.2.5. RT-qPCR and RNA-seq of Field and Hydroponic Validation Groups
2.2.6. Bioinformatics Pre-Analysis
3. Results
3.1. Gene Expression Analysis of Prediction Group and Test Group
3.2. Validation Group RT-qPCR and RNA-seq Analysis
3.3. Gene Screening for Plant Type Regulation
4. Discussion
4.1. Effects of Sampling Sites and Culture Methods on Gene Expression
4.2. Analysis of the Relationship between Genes and Plant Types
4.3. Plant Hormone Control Plant Type Analysis
4.4. Construction and Analysis of Prediction Group
4.5. Advantages of Double-Gene Combinations in Gene Selection
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Gomez-Roldan, V.; Fermas, S.; Brewer, P.B.; Puech-Pagès, V.; Dun, E.A.; Pillot, J.-P.; Letisse, F.; Matusova, R.; Danoun, S.; Portais, J.-C.; et al. Strigolactone inhibition of shoot branching. Nature 2008, 455, 189–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Umehara, M.; Hanada, A.; Yoshida, S.; Akiyama, K.; Arite, T.; Takeda-Kamiya, N.; Magome, H.; Kamiya, Y.; Shirasu, K.; Yoneyama, K.; et al. Inhibition of shoot branching by new terpenoid plant hormones. Nature 2008, 455, 195–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, J.; Zhou, Y.; Wenninger, J.; Ma, H.; Zhang, J.; Zhang, D. How water use of Salix psammophila bush depends on groundwater depth in a semi-desert area. Environ. Earth Sci. 2016, 75, 556. [Google Scholar] [CrossRef] [Scilit]
- Vörösmarty, C.J.; Green, P.; Salisbury, J.; Lammers, R.B. Global Water Resources: Vulnerability from Climate Change and Population Growth. Science 2000, 289, 284–288. [Google Scholar] [CrossRef] [Scilit]
- Cheng, D.; Duan, J.; Qian, K.; Qi, L.; Yang, H.; Chen, X. Groundwater evapotranspiration under psammophilous vegetation covers in the Mu Us Sandy Land, northern China. J. Arid. Land 2016, 9, 98–108. [Google Scholar] [CrossRef] [Scilit]
- Priyana, Y.; Safriningsih, D. The Ready System of Clean Water for Population in Musuk District to Respon Dry Season. Forum Geogr. 2016, 19, 81. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Bi, C.; Wang, C.; Ye, Q.; Yin, T.; Ye, N. Genome-wide identification and characterization of WUSCHEL-related homeobox (WOX) genes in Salix suchowensis. J. For. Res. 2018, 30, 1811–1822. [Google Scholar] [CrossRef] [Scilit]
- Jia, H.; Zhang, J.; Li, J.; Sun, P.; Zhang, Y.; Xin, X.; Lu, M.; Hu, J. Genome-wide transcriptomic analysis of a desert willow, Salix psammophila, reveals the function of hub genes SpMDP1 and SpWRKY33 in drought tolerance. BMC Plant Biol. 2019, 19, 356. [Google Scholar] [CrossRef] [Scilit]
- Finlayson, S.A. Arabidopsis TEOSINTE BRANCHED1-LIKE 1 Regulates Axillary Bud Outgrowth and is Homologous to Monocot TEOSINTE BRANCHED1. Plant Cell Physiol. 2007, 48, 667–677. [Google Scholar] [CrossRef] [Scilit]
- Ding, C.; Zhang, S.W. Overview of important regulatory genes in plant light signaling pathways. Shanxi Agric. Sci. 2015, 43, 3. (In Chinese) [Google Scholar]
- Yin, M.; Wang, Y.; Zhang, L.; Li, J.; Quan, W.; Yang, L.; Wang, Q.; Chan, Z. The Arabidopsis Cys2/His2 zinc finger transcription factor ZAT18 is a positive regulator of plant tolerance to drought stress. J. Exp. Bot. 2017, 68, 2991–3005. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, W.; Wang, L.; Sheng, X.; Yan, C.; Zhou, R.; Hang, J.; Yin, P.; Yan, N. Molecular basis for the selective and ABA-independent inhibition of PP2CA by PYL13. Cell Res. 2013, 23, 1369–1379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, Y.Y.; Li, X.Y. Effect of overexpression of transcription factor AhAREB1 on growth hormone distribution in Arabidopsis thaliana. J. South China Norm. Univ. 2015, 1, 87–92. (In Chinese) [Google Scholar] [CrossRef]
- Zhang, L.; Ye, Z.W. Cloning and bioinformatics analysis of salsify spslazy1a and spslazy1b genes. J. Northwest For. Coll. 2017, 32, 8. (In Chinese) [Google Scholar]
- Yuan, M.R.; Yang, Y. Cloning, bioinformatics and tissue-specific expression analysis of the SpsTAC2 gene in Salix salicifolia. Mol. Plant Breed. 2019, 7, 2144–2151. (In Chinese) [Google Scholar] [CrossRef]
- Zhang, Y.; Chen, K.; Zhao, F.-J.; Sun, C.; Jin, C.; Shi, Y.; Sun, Y.; Li, Y.; Yang, M.; Jing, X.; et al. OsATX1 Interacts with Heavy Metal P1B-Type ATPases and Affects Copper Transport and Distribution. Plant Physiol. 2018, 178, 329–344. [Google Scholar] [CrossRef] [Scilit]
- Bohra, A.; Jha, U.C.; Adhimoolam, P.; Bisht, D.; Singh, N.P. Cytoplasmic male sterility (CMS) in hybrid breeding in field crops. Plant Cell Rep. 2016, 35, 967–993. [Google Scholar] [CrossRef] [Scilit]
- Cheng, Y.; Deng, J. Genome-wide identification and expression analysis of the FAR1/FHY3 transcription factor family in tomato. J. Plant Physiol. 2021, 10, 1983–1995. [Google Scholar] [CrossRef]
- The cDNA/DNA/Small RNA Libraries Were Sequenced on the Illumina Sequencing Platform by Genedenovo Biotechnology Co., Ltd.; Genedenovo Biotechnology Co., Ltd.: Guangzhou, China, 2023.
- Vissenberg, K.; Claeijs, N.; Balcerowicz, D.; Schoenaers, S. Hormonal regulation of root hair growth and responses to the environment in Arabidopsis. J. Exp. Bot. 2020, 71, 2412–2427. [Google Scholar] [CrossRef] [Scilit]
- Lu, D.Y.; Zhang, G.S. Research Progress of Salix psammophila. Mol. Plant Breed. 2020, 18, 6. (In Chinese) [Google Scholar] [CrossRef]
- Yang, H.F.; Li, A.Y. Identification and anatomical structure of stem banding phenotype of Salix psammophila. Desert China 2021, 41, 45. (In Chinese) [Google Scholar]
- Jiang, Y.; Zhu, Y.; Zhang, L.; Su, W.; Peng, J.; Yang, X.; Song, H.; Gao, Y.; Lin, S. EjTFL1 Genes Promote Growth but Inhibit Flower Bud Differentiation in Loquat. Front. Plant Sci. 2020, 11, 576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Q.; Li, X.; Tang, B.; Gu, M. Growth Responses and Root Characteristics of Lettuce Grown in Aeroponics, Hydroponics, and Substrate Culture. Horticulturae 2018, 4, 35. [Google Scholar] [CrossRef] [Scilit]
- Ni, J.; Gao, C.; Chen, M.-S.; Pan, B.-Z.; Ye, K.; Xu, Z.-F. Gibberellin Promotes Shoot Branching in the Perennial Woody Plant Jatropha curcas. Plant Cell Physiol. 2015, 56, 1655–1666. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, J.; Lin, R.; Hoecker, U.; Liu, B.; Xu, L.; Wang, H. Repression of light signaling by Arabidopsis SPA1 involves post-translational regulation of HFR1 protein accumulation. Plant J. 2005, 43, 131–141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, L.L.; Zhang, X. Cloning of Birch BpZFP4 gene promoter and functional analysis of adversity response elements. Plant Res. 2019, 6, 917–926. (In Chinese) [Google Scholar]
- Chen, N.Y.; Zhang, G.X. Role of Abf transcription factors in plant response to abiotic stress. J. Plant Genet. Resour. 2021, 22, 9. [Google Scholar] [CrossRef]
- Wu, S.W. Molecular Mechanism of Arabidopsis thaliana SPA1 Interaction with Photosensitive Pigment B. Ph.D. Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2009. (In Chinese) [Google Scholar]
- Hou, Y.; Wang, X.; Zhu, Z.; Sun, M.; Li, M.; Hou, L. Expression Analysis of Genes Related to Auxin Metabolism at Different Growth Stages of Pak Choi. Hortic. Plant J. 2019, 6, 25–33. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Wang, D.; Xu, W.; Kong, L.; Ye, X.; Zhuang, Q.; Fan, D.; Luo, K. Histone methyltransferase ATX1 dynamically regulates fiber secondary cell wall biosynthesis in Arabidopsis inflorescence stem. Nucleic Acids Res. 2020, 49, 190–205. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Sun, Y.; Yao, H.; Zheng, Y.; Cao, S.; Wang, H. Arabidopsis Circadian Clock Repress Phytochrome a Signaling. Front. Plant Sci. 2022, 13, 809563. [Google Scholar] [CrossRef] [Scilit]
- Ding, Y.; Avramova, Z.; Fromm, M. Two Distinct Roles of ARABIDOPSIS HOMOLOG OF TRITHORAX1 (ATX1) at Promoters and within Transcribed Regions of ATX1-Regulated Genes. Plant Cell 2011, 23, 350–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hussain, S.; Zhang, N.; Wang, W.; Ahmed, S.; Cheng, Y.; Chen, S.; Wang, X.; Wang, Y.; Hu, X.; Wang, T.; et al. Involvement of ABA Responsive SVB Genes in the Regulation of Trichome Formation in Arabidopsis. Int. J. Mol. Sci. 2021, 22, 6790. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.; Lee, K.; Hwang, H.; Bhatnagar, N.; Kim, D.-Y.; Yoon, I.S.; Byun, M.-O.; Kim, S.T.; Jung, K.-H.; Kim, B.-G. Overexpression of PYL5 in rice enhances drought tolerance, inhibits growth, and modulates gene expression. J. Exp. Bot. 2014, 65, 453–464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hiltbrunner, A.; Tscheuschler, A.; Viczián, A.; Kunkel, T.; Kircher, S.; Schäfer, E. FHY1 and FHL Act Together to Mediate Nuclear Accumulation of the Phytochrome A Photoreceptor. Plant Cell Physiol. 2006, 47, 1023–1034. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Wei, H.; Ma, M.; Li, Q.; Kong, D.; Sun, J.; Ma, X.; Wang, B.; Chen, C.; Xie, Y.; et al. Arabidopsis FHY3 and FAR1 Regulate the Balance between Growth and Defense Responses under Shade Conditions. Plant Cell 2019, 31, 2089–2106. [Google Scholar] [CrossRef] [Scilit]
- Raza, A.; Salehi, H.; Rahman, A.; Zahid, Z.; Haghjou, M.M.; Najafi-Kakavand, S.; Charagh, S.; Osman, H.S.; Albaqami, M.; Zhuang, Y.; et al. Plant hormones and neurotransmitter interactions mediate antioxidant defenses under induced oxidative stress in plants. Front. Plant Sci. 2022, 13, 961872. [Google Scholar] [CrossRef] [Scilit]






| Primer Name | Primer Sequences (5′ to 3′) |
|---|---|
| UBQ-F | AAGCCCAAGAAGATCAAGCA |
| UBQ-R | ACCACCAGCCTTCTGGTAAA |
| TB1-F | AAGCAAGCAAAACTATCGAGTG |
| TB1-R | GAAGAAACACTCTTGCTGTCAG |
| SPA2-F | CTTAGCCATTGTTGGTACATCG |
| SPA2-R | AAGGTATGACTACGGGAAATCC |
| Lazy1b-F | CACTGAAGGATTTTGCTATCGG |
| Lazy1b-R | CAGAAAACCATGGAATAGCTCG |
| TAC2-F | AAAGATGGGCTCGCTGGAAA |
| TAC2-R | GTGAATCCTCTACAGCGCGA |
| ATX1-F | TGGGGCTGTGAAAAGGGTTT |
| ATX1-R | GCATCTGGCTGCACATTTCC |
| FHY1-F | TGGGGATTTTTATGGTGAGGAA |
| FHY1-R | AAGTTTATGGATGCTTGCAGTG |
| RFK1-F | AAGGACAGACCAGCATCCAG |
| RFK1-R | GGAAGACGTGGAGGTGGATA |
| ABF2-F | CAAGAACTTCTCAAATGACCCG |
| ABF2-R | TGAAGCTCGTCAAAAGTTAACG |
| PYL1-F | GCAGGTCACGGGGTTTAGTA |
| PYL1-R | CCGTGTGTCTTCCTCGGTAT |
| ZFP4-F | AACCTGCATCACGTACCACA |
| ZFP4-R | AATGAGGATCCATGCAGAGG |
| Gene | Date | 7.28 | 8.06 | 8.16 | 8.26 | 9.05 |
|---|---|---|---|---|---|---|
| Cultivation | ||||||
| FHY1 | Water | 0.778 | 0.685 | 0.693 | 0.872 | 0.831 |
| Field | 0.625 | 0.623 | 0.982 | 0.823 | 0.985 | |
| ATX1 | Water | −0.962 | −0.980 | −0.872 | −0.626 | −0.996 |
| Field | −0.974 | −0.834 | −0.880 | −0.881 | −0.795 | |
| RFK1 | Water | −0.729 | −0.669 | −0.736 | −0.757 | −0.998 |
| Field | −0.859 | −0.974 | −0.910 | −0.775 | −0.877 | |
| PYL1 | Water | −0.931 | −0.660 | −0.899 | −0.764 | −0.507 |
| Field | −0.766 | −0.775 | −0.335 | −0.813 | −0.287 | |
| ABF2 | Water | −0.875 | −0.730 | −0.700 | −0.960 | −0.255 |
| Field | −0.932 | −0.892 | −0.964 | −0.357 | −0.899 | |
| SPA2 | Water | −0.668 | −0.117 | −0.466 | −0.782 | −0.891 |
| Field | −0.982 | −0.789 | −0.924 | −0.643 | −0.418 | |
| TB1 | Water | −0.998 | −0.994 | −0.458 | −0.964 | −0.800 |
| Field | −0.813 | −0.672 | −0.992 | −0.768 | −0.689 | |
| ZFP4 | Water | −0.440 | −0.449 | −0.498 | −0.489 | −0.529 |
| Field | −0.628 | −0.465 | −0.978 | −0.761 | −0.995 | |
| LAZY1b | Water | −0.123 | −0.866 | −0.360 | −0.417 | −0.829 |
| Field | −0.464 | −0.230 | −0.882 | −0.280 | −0.931 | |
| TAC2 | Water | 0.210 | 0.104 | 0.864 | 0.782 | 0.807 |
| Field | 0.976 | 0.996 | 0.612 | 0.530 | 0.120 |
| Groups | Prediction Group | Validation Groups | |
|---|---|---|---|
| Gene | Field Validation Group | Hydroponic Validation Group | |
| FHY1 | 1.0–3.0 | 7.0–17.5 | 7.0–27.6 |
| ATX1 | 55.0–100.0 | 35.2−131.3 | 33.7–119.6 |
| RFK1 | 0.9–3.0 | 0.1–8.3 | 0.0–6.6 |
| PYL1 | 0.3–1.3 | 0.0–1.9 | 0.1–0.6 |
| ABF2 | 8.0–19.0 | 9.6–33.5 | 11.1–80.0 |
| SPA2 | 12.0–16.0 | 3.6–10.9 | 7.3–17.0 |
| TB1 | 0.3–2.0 | 0.2–6.8 | 0.4–19.3 |
| ZFP4 | 12.9–26.0 | 1.8–8.8 | 3.3–36.6 |
| LAZY1b | 5.0–30.0 | 0.8–3.1 | 0.2–1.6 |
| TAC2 | 1.0–6.0 | 7.5–21.1 | 10.1–22.9 |
| Gene Name | Mean | Standard Deviation | p | Min | Max |
|---|---|---|---|---|---|
| ATX1 | 0.726 | 0.309 | 0.000 | 0.130 | 1.410 |
| LAZY1b | 0.302 | 0.182 | 0.061 | 0.040 | 1.160 |
| TAC2 | 2.345 | 1.847 | 0.207 | 0.340 | 8.810 |
| TB1 | 0.730 | 0.579 | 0.000 | 0.200 | 5.190 |
| ZFP4 | 19.732 | 23.706 | 0.099 | 0.110 | 109.230 |
| ABF2 | 1.315 | 0.765 | 0.044 | 0.240 | 4.730 |
| FHY1 | 2.631 | 1.596 | 0.000 | 0.170 | 8.090 |
| RFK1 | 0.657 | 0.505 | 0.000 | 0.020 | 2.790 |
| SPA2 | 0.794 | 0.760 | 0.078 | 0.070 | 4.520 |
| PYL1 | 1.684 | 1.407 | 0.038 | 0.06 | 7.63 |
| Gene Combinations | R2 | F Value | p Value | Models |
|---|---|---|---|---|
| ATX1 + FHY1 | 0.740 | 133.847 | 0.000 | y = 1.159 − 0.566 × ATX1 + 0.076 × FHY1 |
| ATX1 + TB1 | 0.622 | 77.419 | 0.000 | y = 1.477 − 0.634 × ATX1 − 0.095 × TB1 |
| ATX1 + RFK1 | 0.614 | 74.900 | 0.000 | y = 1.482 − 0.656 × ATX1 − 0.09 × RFK1 |
| ATX1 + ABF2 | 0.602 | 71.035 | 0.000 | y = 1.497 − 0.698 × ATX1 − 0.033 × ABF2 |
| ATX1 + PYL1 | 0.596 | 69.393 | 0.000 | y = 1.472 − 0.741 × ATX1 + 0.008 × PYL1 |
| FHY1 + TB1 | 0.597 | 69.518 | 0.000 | y = 0.823 − 0.206 × TB1 + 0.012 × FHY1 |
| FHY1 + RFK1 | 0.516 | 50.109 | 0.000 | y = 0.79+0.103 × FHY1 − 0.172 × RFK1 |
| FHY1 + ABF2 | 0.460 | 39.988 | 0.000 | y = 0.732+0.113 × FHY1 − 0.061 × ABF2 |
| FHY1 + PYL1 | 0.492 | 45.534 | 0.000 | y = 0.737 − 0.050 × PYL1 + 0.112 × FHY1 |
| TB1 + RFK1 | 0.381 | 28.949 | 0.000 | y = 1.226 − 0.208 × TB1 − 0.194 × RFK1 |
| TB1 + ABF2 | 0.323 | 22.441 | 0.000 | y = 1.23 − 0.242 × TB1 − 0.08 × ABF2 |
| TB1 + PYL1 | 0.367 | 27.264 | 0.000 | y = 1.232 − 0.249 × TB1 − 0.061 × PYL1 |
| RFK1 + ABF2 | 0.253 | 15.947 | 0.000 | y = 1.188 − 0.240 × RFK1 − 0.063 × ABF2 |
| RFK1 + PYL1 | 0.274 | 17.709 | 0.000 | y = 1.178 − 0.046 × PYL1 − 0.234 × RFK1 |
| ABF2 + PYL1 | 0.184 | 10.564 | 0.000 | y = 1.174 − 0.061 × PYL1 − 0.095 × ABF2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, K.; He, R.; Zhang, G.; Qin, F.; Yue, Y.; Li, L.; Dong, X. Screening and Expression Characteristics of Plant Type Regulatory Genes in Salix psammophila. Forests 2024, 15, 103. https://doi.org/10.3390/f15010103
Zhao K, He R, Zhang G, Qin F, Yue Y, Li L, Dong X. Screening and Expression Characteristics of Plant Type Regulatory Genes in Salix psammophila. Forests. 2024; 15(1):103. https://doi.org/10.3390/f15010103
Chicago/Turabian StyleZhao, Kai, Rong He, Guosheng Zhang, Fucang Qin, Yongjie Yue, Long Li, and Xiaoyu Dong. 2024. "Screening and Expression Characteristics of Plant Type Regulatory Genes in Salix psammophila" Forests 15, no. 1: 103. https://doi.org/10.3390/f15010103
APA StyleZhao, K., He, R., Zhang, G., Qin, F., Yue, Y., Li, L., & Dong, X. (2024). Screening and Expression Characteristics of Plant Type Regulatory Genes in Salix psammophila. Forests, 15(1), 103. https://doi.org/10.3390/f15010103

