Diversity and Genetic Structure Inferred with Microsatellites in Natural Populations of Pseudotsuga menziesii (Mirb.) Franco (Pinaceae) in the Central Region of Mexico
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Plant Material
2.2. DNA Extraction
2.3. Quantification of Nucleic Acids
2.4. SSR Analysis
2.5. Data Analysis
3. Results
3.1. Genetic Diversity
3.2. Genetic Structure
4. Discussion
4.1. Genetic Diversity
4.2. Genetic Structure
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Farjon, A. Pinaceae: Drawings and Descriptions of the Genera Abies, Cedrus, Pseudolarix, Keteeleria, Nothotsuga, Tsuga, Cathaya, Pseudotsuga, Larix and Picea; Koeltz Scientific Books: Konigstein, Germany, 1990; pp. 171–191. [Google Scholar]
- Sanchez, E.M.; Arregui, R.Z.; Veigas, G.P.; Saavedra, F.P. Variabilidad de parámetros de calidad de madera entre y dentro de procedencias de Pseudotsuga menziesii. Cuad. Soc. Esp. Cienc. For. 2008, 24, 75–80. [Google Scholar]
- Fussi, B.; Dounavi, A.; Konnert, M. Identification of varieties and gene flow in Douglas fir exemplified in artificially established stands in Germany. Ann. For. Res. 2013, 56, 249–268. [Google Scholar]
- Hermann, R.K.; Lavender, D.P. Douglas-fir planted forests. New Forest 1999, 17, 53–70. [Google Scholar] [CrossRef]
- Bastien, J.C.; Sanchez, L.; Michau, D. DouglasFir (Pseudotsuga menziesii (Mirb.) Franco). In Forest Tree Breeding in Europe; Pâques, L.E., Ed.; Springer: Berlin/Heidelberg, Germany, 2013; Volume 25, pp. 325–369. [Google Scholar]
- Van Loo, M.; Hintsteiner, W.; Pötzelsberger, E.; Schüler, S.; Hasenauer, H. Intervarietal and intravarietal genetic structure in Douglas-fir: nuclear SSRs bring novel insights into past population demographic processes, phylogeography, and intervarietal hybridization. Ecol. Evol. 2015, 5, 1802–1817. [Google Scholar] [CrossRef] [PubMed]
- Rzedowski, J.; Huerta, L. Vegetación de México; Limusa: Mexico City, México, 1978; Volume 432, pp. 323–324. [Google Scholar]
- Ventura-Ríos, A.; López-Upton, J.; Vargas-Hernández, J.J.; Guerra de la Cruz, V. Caracterización de Pseudotsuga menziesii (Mirb.) Franco en el centro de México. Implicaciones para su conservación. Rev. Fitotec. Mex. 2010, 33, 107–116. [Google Scholar]
- Secretaria de Medio Ambiente y Recursos Naturales (SEMARNAT). Norma Oficial Mexicana NOM-059-SEMARNAT-2010, Protección Ambiental-Especies Nativas de México de Flora y Fauna Silvestres-Categorías de Riesgo y Especificaciones para su Inclusión, Exclusión o Cambio-Lista de Especies en Riesgo. Available online: https://www.gob.mx/cms/uploads/attachment/file/134778/35.-_NORMA_OFICIAL_MEXICANA_NOM-059-SEMARNAT-2010.pdf (accessed on 9 January 2018).
- The IUCN Red List of Threatened Species 2013. Available online: http://www.iucnredlist.org/details/42429/0 (accessed on 24 February 2018).
- Pathania, A.; Rialch, N.; Sharma, P.N. Marker Assisted Selection in Disease Resistance Breeding: A Boon to Enhance Agricultural Production. In Current Developments in Biotechnology and Bioengineering, United States, 1st ed.; Dubey, S.K., Pandey, A., Sangwan, R.S., Eds.; Elsevier: Amsterdam, The Netherlands, 2016; pp. 187–213. ISBN 978-0-444-63661-4. [Google Scholar]
- Juárez-Agis, A.; López-Upton, J.; Vargas-Hernández, J.J.; Sáenz-Romero, C. Variación geográfica en la germinación y crecimiento inicial de plántulas de Pseudotsuga menziesii en México. Agrociencia 2006, 40, 783–792. [Google Scholar]
- Mápula-Larreta, M.; López-Upton, J.; Vargas-Hernández, J.J.; Hernández-Livera, A. Germinación y vigor de semillas en Pseudotsuga menziesii de México. Ra Ximhai 2008, 4, 119–134. [Google Scholar]
- Velasco-García, M.V.; López-Upton, J.; Ángeles-Pérez, G.; Vargas-Hernández, J.J.; Guerra de la Cruz, V. Dispersión de semillas de Pseudotsuga menziesii en poblaciones del centro de México. Agrociencia 2007, 41, 121–131. [Google Scholar]
- Cruz-Nicolás, J.; Vargas-Hernández, J.J.; Ramírez-Vallejo, P.; López-Upton, J. Patrón de cruzamiento en poblaciones naturales de Pseudotsuga menziesii (Mirb.) Franco en México. Agrociencia 2008, 42, 367–378. [Google Scholar]
- Frith, K.E.; Hoelzel, A.R. Conservation Genetics. Encyclopedia of Biodiversity; Durham University: Durham, UK, 2016; Volume 2, pp. 263–277. [Google Scholar]
- Mote, P.W.; Salathé, E.P. Future climate in the Pacific Northwest. Clim. Chang. 2010, 102, 29–50. [Google Scholar] [CrossRef]
- Beedlow, P.A.; Waschmann, S.R.; Lee, E.H.; Tingey, D.T. Seasonal patterns of bole water content in old growth Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco). Agric. For. Meteorol. 2017, 242, 209–219. [Google Scholar] [CrossRef] [PubMed]
- Gugger, P.F.; Gonzalez-Rodríguez, A.; Rodríguez-Correa, H.; Sugita, S.; Cavender- Bares, J. Southward Pleistocene migration of Douglas-fir into Mexico: Phylogeography, ecological niche modeling, and conservation of ‘rear edge’ populations. New Phytol. 2011, 189, 1185–1199. [Google Scholar] [CrossRef] [PubMed]
- Bruford, M.W.; Davies, N.; Dulloo, M.E.; Faith, D.P.; Walters, M. Monitoring changes in genetic diversity. In The GEO Handbook on Biodiversity Observation Networks; Walters, M., Scholes, R.J., Eds.; Springer International Publishing: New York, NY, USA, 2017; pp. 107–128. [Google Scholar]
- Hedrick, P.W. Conservation genetics and the persistence and translocation of small populations: Bighorn sheep populations as examples. Anim. Conserv. 2014, 17, 106–114. [Google Scholar] [CrossRef]
- Marwal, A.; Sahu, K.A. Molecular Markers: Tool for Genetic Analysis. In Animal Biotechnology; Verma, A.S., Singh, A., Eds.; Elsevier: Amsterdam, The Netherlands, 2014; pp. 289–305. [Google Scholar]
- Borem, A.; Fritsche-Neto, R. Biotechnology and Plant Breeding; Biotechnology Applied to Plant Breeding. Cedrus, Pseudolarix, Keteeleria, Nothotsuga, Tsuga, Cathaya, Pseudotsuga, Larix and Picea; Koeltz Scientific Books: Konigstein, Germany, 2014; pp. 171–191. [Google Scholar]
- Jiang, G. Molecular Markers. Plant Breeding and Genetic. Reference Module in Life Sciences. Encyclopedia of Applied Plant Sciences, 2nd ed.; Elsevier: Amsterdam, The Netherlands, 2017; pp. 207–214. [Google Scholar]
- Amarasinghe, V.; Carlson, J.E. The development of microsatellite DNA markers for genetic analysis in Douglas-fir. Can. J. For. Res. 2002, 32, 1904–1915. [Google Scholar] [CrossRef]
- Slavov, G.T.; Howe, G.T.; Yakovlev, I.; Edwards, K.J.; Krutovskii, K.V.; Tuskan, G.A.; Carlson, J.E.; Strauss, S.H.; Edwards, W.T. Highly variable SSR markers in Douglas-fir: Mendelian inheritance and map locations. Theor. Appl. Genet. 2004, 108, 873–880. [Google Scholar] [CrossRef] [PubMed]
- Krutovsky, K.V.; St. Clair, J.B.; Saich, R.; Hipkins, V.D.; Neale, D.B. Estimation of population structure in coastal Douglas-fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] using allozyme and microsatellite markers. Tree Genet. Genomes 2009, 5, 641–658. [Google Scholar] [CrossRef][Green Version]
- Villagómez Loza, M.A.; Bello González, M.Á. Pseudotsuga menziesii (Mirb.) Franco var. glauca (Beissn.) Franco: nuevo registro para Guanajuato. Rev. Mex. Cienc. For. 2015, 6, 66–73. [Google Scholar]
- Li, P.; Adams, W.T. Range-wide patterns of allozime variantions in Douglas-fir (Pseudotsuga menziesii). Can. J. For. Res. 1989, 19, 149–161. [Google Scholar] [CrossRef]
- Novick, R.R.; Dick, C.W.; Lemes, M.R.; Navarro, C.; Caccone, A.; Berminhham, E. Genetic Structure of Mesoamercian populations of Big-leas mahogany (Swietenia macrophylla) inferred from microsatellites analysis. Mol. Ecol. 2003, 12, 2885–2893. [Google Scholar] [CrossRef]
- Saghai-Maroof, M.A.; Soliman, K.M.; Jorgensen, R.A.; Allard, R.W. Ribosomal DNA spacer-length polymorphisms in barley mendelian inheritance, chromosomal location and population dynamics. Proc. Natl. Acad. Sci. USA 1984, 81, 8014–8018. [Google Scholar] [CrossRef]
- Sanguinetti, C.J.; Neto, D.E.; Simpson, A.J. Rapid silver staining and recovery of PCR products separated on polyacrylamide gels. Biotechniques 1994, 17, 915–918. [Google Scholar]
- Yeh, F.; Yang, R.C.; Boyle, J.T. Popgene Version 1.31; University of Alberta and Centre for International Forestry Research: Edmondton, AB, Canada, 1999. [Google Scholar]
- Szpiech, Z.A.; Rosenberg, N.A. On the size distribution of private microsatellite alleles. Theor. Popul. Biol. 2011, 80, 100–113. [Google Scholar] [CrossRef] [PubMed]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed]
- Mantel, N. The detection of disease clustering and a generalized regression approach. Cancer Res. 1967, 27, 209–220. [Google Scholar] [PubMed]
- Weir, B.S.; Cockerham, C.C. Estimating F-statistics for the analysis of population structure. Evolution 1984, 38, 1358–1370. [Google Scholar]
- Excoffier, L.; Lisher, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
- Nei, M. Genetic distance between populations. Am. Nat. 1972, 106, 283–292. [Google Scholar] [CrossRef]
- Felsenstein, J. Distance methods for inferring phylogenies: A justification. Evolution 1984, 38, 16–24. [Google Scholar] [CrossRef] [PubMed]
- Miller, M.P. Tools for Population Genetic Analysis (TFPGA), Ver 1.3; Northern Arizona University: Flagstaff, AZ, USA, 2000. [Google Scholar]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [PubMed]
- Wright, S. The genetical structure of populations. Ann. Eugenic. 1951, 15, 323–354. [Google Scholar] [CrossRef]
- Slatkin, M.; Barton, N.H. A comparison of three indirect methods for estimating average levels of gene flow. Evolution 1989, 43, 1349–1368. [Google Scholar] [CrossRef] [PubMed]
- Raymond, M.L.; Rousset, F. An exact for population differentiation. Evolution 1995, 49, 1280–1283. [Google Scholar] [CrossRef] [PubMed]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [PubMed]
- Acevedo-Rodríguez, R.; Vargas-Hernández, J.J.; López-Upton., J.; Mendoza, J.V. Effect of geographic origin and nutrition on shoot phenology of Mexican Douglas-Fir (Pseudotsuga sp.) seedlings. Agrociencia 2006, 40, 125–137. [Google Scholar]
- Reyes-Hernández, V.; Vargas-Hernández, J.; López-Upton, J.; Vaquera-Huerta, H. Phenotypic similarity among Mexican populations of Pseudotsuga Carr. Agrociencia 2006, 40, 545–556. [Google Scholar]
- Cruz-Nicolás, J.; Vargas-Hernández, J.J.; Ramírez-Vallejo, P.; López-Upton, J. Genetic diversity and differentiation of Pseudotsuga menziesii (Mirb.) Franco populations in Mexico. Rev. Fitotec. Mex. 2011, 34, 233–240. [Google Scholar]
- Lai, B.S.; Funda, T.; Liewlaksaneeyanawin, C.; Klápště, J.; Van Niejenhuis, A.; Cook, C.; Stoehr, M.U.; Woods, J.; El-Kassaby, Y.A. Pollination dynamics in a Douglas-fir seed orchard as revealed by pedigree reconstruction. Ann. For. Sci. 2010, 67, 807–808. [Google Scholar]
- Kess, T.; El-Kassaby, Y.A. Estimates of pollen contamination and selfing in a coastal Douglas-fir seed orchard. Scand. J. For. R. 2015, 30, 266–275. [Google Scholar] [CrossRef]
- Aguirre-Planter, E.; Furnier, G.R.; Eguiarte, L.E. Low levels of genetic variation within and high levels of genetic differentiation among populations of species of Abies from southern Mexico and Guatemala. Am. J. Bot. 2000, 87, 362–371. [Google Scholar] [CrossRef]
- Falconer, D.S.; Mackay, T.F.C. Introduction to Quantitative Genetics, 4th ed.; Longmans Green: Harlow, Essex, UK, 1996. [Google Scholar]
- Savolainen, O.; Kuitttinrn, H. Small population processes. In Forest Genetics: Principles and Practice; Young, A.D., Boyle, T., Eds.; CSIRO Publishing: Clayton, Australia, 2000. [Google Scholar]
- Ledig, F.T.; Hodgskiss, P.D.; Jacob-Cervantes, V. Genetic diversity mating system, and conservation of a Mexican subalpine relict, Picea mexicana Martínez. Conserv. Genet. 2002, 3, 113–122. [Google Scholar] [CrossRef]
- Sala, O.E.; Chapin, F.S.; Armesto, J.J.; Berlow, E.; Bloomfield, J.; Dirzo, R.; Huber-Sanwald, E.; Huenneke, L.F.; Jackson, R.B.; Kinzig, A.; et al. Global biodiversity scenarios for the year 2100. Science 2000, 287, 1770–1774. [Google Scholar] [CrossRef] [PubMed]
- Tan, J.; Zhao, Z.-G.; Guo, J.-J.; Wang, C.-S.; Zeng, J. Genetic diversity and population genetic structure of Erythrophleum fordii Oliv., and endangered rosewood species in south China. Forest 2018, 9, 636. [Google Scholar] [CrossRef]
- El-Kassaby, Y.A.; Ritland, K. Genetic variation in low elevation Douglas-fir of British Columbia and its relevance to gene conservation. Biodivers. Conserv. 1996, 5, 779–794. [Google Scholar] [CrossRef]
- Hedrick, P.W. Perspective: highly variable loci and their interpretation in evolution and conservation. Evolution 1999, 53, 313–318. [Google Scholar] [CrossRef] [PubMed]
- Mápula-Larreta, M.; López-Upton, J.; Vargas-Hernández, J.J.; Hernández-Livera, A. Reproductive indicators in natural populations of Douglas-fir in Mexico. Biodivers. Conserv. 2007, 16, 727–742. [Google Scholar] [CrossRef]
- Ledig, F.T. Genetic variation in Pinus. In Ecology and Biogeography of Pinus; Richardson, D.M., Ed.; Cambridge University Press: Cambridge, UK, 1998; pp. 251–280. [Google Scholar]
- Nybom, H. Comparison of different nuclear DNA markers for estimating intraspecific genetic diversity in plants. Mol. Ecol. 2004, 13, 1143–1155. [Google Scholar] [CrossRef]
- Hamrick, J.L.; Godt, M.J.W. Effects of life history traits on genetic diversity in plant species. Philosoph. Trans. R. Soc. B 1996, 351, 1291–1298. [Google Scholar]
- Pérez-González, M.A.; Caujapé-Castells, J.; Sosa, P.A. Allozyme variation and structure of the Canarian endemic palm tree (Populus tremuloides Michx). J. Hered. 1995, 86, 454–460. [Google Scholar]
- Petit, R.J.; El Mousadik, A.; Pons, O. Identifying populations for conservation on the basis of genetic markers. Conserv. Biol. 1998, 12, 844–855. [Google Scholar] [CrossRef]
- Vinceti, B.; Loo, J.; Gaisberger, H.; Van Zonneveld, M.J.; Schueler, S.; Konrad, H.; Kadu, C.A.; Geburek, T. Conservation priorities for Prunus africana defined with the aid of spatial analysis of genetic data and climatic variables. PLoS ONE 2013, 8, e59987. [Google Scholar] [CrossRef]
- López-Upton, J.; Valdez-Lazalde, R.; Ventura-Ríos, A.; Vargas-Hernández, J.J.; Guerra de la Cruz, V. Extinction risk of Pseudotsuga menziesii populations in the central region of Mexico: An AHP analysis. Forest 2015, 6, 1598–1612. [Google Scholar] [CrossRef]





| Population 1 | State | Number of Individuals | Altitude (m.a.s.l.) 2 | Longitude W | Latitude N | 
|---|---|---|---|---|---|
| La Barranca | Querétaro | 16 | 2187 | 99°38′44″ | 21°08′59″ | 
| Carbonero Jacales | Veracruz | 20 | 2589 | 98°28′15″ | 20°25′16″ | 
| Tlaxco | Tlaxcala | 20 | 2698 | 98°05′42″ | 19°37′21″ | 
| Cruz de León | Puebla | 20 | 2825 | 97°52′19″ | 19°34′52″ | 
| Emiliano Zapata | Tlaxcala | 20 | 2884 | 97°55′00″ | 19°33′31″ | 
| Tlalmotolo | Puebla | 20 | 2739 | 97°44′18″ | 19°33′05″ | 
| La Rosa | Tlaxcala | 20 | 2863 | 97°54′32″ | 19°31′23″ | 
| Villareal | Tlaxcala | 20 | 2976 | 97°53′53″ | 19°31′11″ | 
| Cuatexmola | Puebla | 20 | 3125 | 97°49′46″ | 19°30′01″ | 
| La Caldera | Puebla | 20 | 2866 | 97°52′15″ | 19°29′58″ | 
| Axopilco | Tlaxcala | 18 | 2880 | 97°55′37″ | 19°28′10″ | 
| Apizaquito | Puebla | 20 | 3100 | 97°18′41″ | 19°12′11″ | 
| Locus | Sequence (3′ to 5′) | Observed Size (bp) | Tm (°C) | 
|---|---|---|---|
| PmOSU_3H4 | F: TTTGCCGTCACATTTTT ATTG | 198–202 | 55 | 
| R: GCATCTTTCAGGCATAGTCT | |||
| BCPsmAG27 | F: ACGGGGAGGGAGGGTAAC | 120–124 | 55 | 
| R: CCTTCCTCTCCACTTTCAACC | |||
| PmOSU_3B9 | F: TGTGTAAAAATGTCTAATCC | 152–164 | 50 | 
| R: ACTACTATTCGAGGTTTTCT | |||
| PmOSU_4E9 | F: GTTGGTTGTGTATATTCAGTTT | 116–122 | 55 | 
| R: GCCTCTTCTTGGTTTGGT | |||
| PmOSU_3G9 | F: ATTCCTTTTGAGACCTACTT | 150–158 | 50 | 
| R: CTTCAAAAATTCCTACAACA | |||
| PmOSU_2B6 | F: TTGTTGGGTATAATTTTCA | 150–180 | 47 | 
| R: TAATAAAATAGCTCTAACCC | |||
| PmOSU_2D6 | F: GGAAAATATACATCTCACGAC | 164–176 | 55 | 
| R: AAGCATGCGTACTAGGTG | |||
| PmOSU_2D9 | F: TCGATTTACGCTTTTTTCTC | 162–176 | 55 | 
| R: TGTTTATCCCCAGTCTCAAG | |||
| BCPsmAG20 | F: CATAGAGAGGGGGCATATCAA | 126–146 | 55 | 
| R: ACCCCCGAACCGTTACTAC | |||
| PmOSU_2G12 | F: CAAGGACTCATATGGGAAA | 240–254 | 50 | 
| R: AACATCAGTAATAACCTTTT | |||
| PmOSU_2D4 | F: TTATTGCACATGAGTATTATGA | 150–190 | 50 | 
| R: CAGATGTTGTTTTTTATACCAC | |||
| PmOSU_783 | F: GAGCTGATGCCTTGAAGACT | 250–270 | 55 | 
| R: CAAGTCAGTTCACAATTCCT | 
| Locus | Na | FIS | FIT | FST | Nm | NP | 
|---|---|---|---|---|---|---|
| PmOSU_3H4 | 3 | 1.000 | 1.000 | 0.075 | 3.067 | 0 | 
| BCPsmAG27 | 3 | −0.599 | −0.318 | 0.176 | 1.404 | 0 | 
| PmOSU_3B9 | 3 | 0.764 | 0.780 | 0.070 | 3.325 | 2 | 
| PmOSU_4E9 | 4 | 0.450 | 0.559 | 0.197 | 0.958 | 0 | 
| PmOSU_3G9 | 5 | 0.077 | 0.754 | 0.733 | 0.089 | 3 | 
| PmOSU_2B6 | 6 | 0.701 | 0.853 | 0.507 | 0.246 | 1 | 
| PmOSU_2D6 | 7 | −0.047 | −0.016 | 0.029 | 8.677 | 6 | 
| PmOSU_2D9 | 7 | −0.295 | −0.185 | 0.084 | 2.575 | 2 | 
| BCPsmAG20 | 8 | 0.554 | 0.636 | 0.183 | 1.098 | 1 | 
| PmOSU_2G12 | 8 | 0.227 | 0.359 | 0.170 | 1.346 | 2 | 
| PmOSU_2D4 | 9 | 0.944 | 0.964 | 0.358 | 0.527 | 1 | 
| PmOSU_783 | 10 | 0.028 | 0.082 | 0.054 | 4.654 | 4 | 
| Mean | 6.08 | 0.234 | 0.452 | 0.285 | 0.647 | 
| Population | N | %P | Na | Ae | Ho | He | NP | 
|---|---|---|---|---|---|---|---|
| La Barranca | 16 | 183.83 | 2.750 | 1.796 | 0.301 | 0.371 | 4 | 
| Carbonero Jacales | 20 | 183.33 | 3.166 | 2.067 | 0.238 | 0.383 | 5 | 
| Tlaxco | 20 | 175.00 | 2.250 | 1.416 | 0.162 | 0.226 | 0 | 
| Cruz de León | 20 | 166.67 | 2.167 | 1.509 | 0.191 | 0.257 | 1 | 
| Emiliano Zapata | 20 | 175.00 | 2.666 | 1.518 | 0.200 | 0.246 | 3 | 
| Tlamotolo | 20 | 183.33 | 2.666 | 1.752 | 0.304 | 0.365 | 1 | 
| La Rosa | 20 | 100.00 | 3.000 | 1.809 | 0.225 | 0.364 | 3 | 
| Villareal | 20 | 183.33 | 2.500 | 1.550 | 0.231 | 0.286 | 2 | 
| Cuatexmola | 20 | 183.33 | 2.916 | 1.693 | 0.270 | 0.320 | 2 | 
| La Caldera | 20 | 166.67 | 2.750 | 1.615 | 0.220 | 0.267 | 1 | 
| Axopilco | 18 | 175.00 | 2.833 | 1.635 | 0.231 | 0.287 | 0 | 
| Apizaquito | 20 | 158.33 | 2.333 | 1.519 | 0.187 | 0.251 | 0 | 
| Mean | 177.86 | 2.667 | 1.657 | 0.230 | 0.302 | ||
| * Overall | 234 | 100.00 | 6.083 | 2.039 | 0.229 | 0.417 | 
| AMOVA | ||||
|---|---|---|---|---|
| Sum of Squares | Variance Component | Percentage of Variation | Φst | |
| Between populations | 1323.957 | 0.711 | 27.860 | |
| Within population | 1835.968 | 1.841 | 72.149 | |
| Total | 1159.925 | 2.552 | 100.000 | 0.278 | 
| Population | Genetic Group | |
|---|---|---|
| I | II | |
| Emiliano Zapata | 0.965 | 0.035 | 
| Cruz de León | 0.979 | 0.021 | 
| La Caldera | 0.978 | 0.022 | 
| Cuatexmola | 0.788 | 0.212 | 
| Tlalmotolo | 0.107 | 0.893 | 
| Apizaquito | 0.022 | 0.978 | 
| La Rosa | 0.049 | 0.951 | 
| Axopilco | 0.303 | 0.697 | 
| Tlaxco | 0.173 | 0.827 | 
| Villareal | 0.849 | 0.151 | 
| Carbonero Jacales | 0.562 | 0.438 | 
| La Barranca | 0.145 | 0.855 | 
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Montiel Castelán, P.; Cortés-Cruz, M.; Mendoza-Castillo, M.d.C.; Cruz-Izquierdo, S.; López-Upton, J.; Sandoval Padilla, I.; Guerra de la Cruz, V. Diversity and Genetic Structure Inferred with Microsatellites in Natural Populations of Pseudotsuga menziesii (Mirb.) Franco (Pinaceae) in the Central Region of Mexico. Forests 2019, 10, 101. https://doi.org/10.3390/f10020101
Montiel Castelán P, Cortés-Cruz M, Mendoza-Castillo MdC, Cruz-Izquierdo S, López-Upton J, Sandoval Padilla I, Guerra de la Cruz V. Diversity and Genetic Structure Inferred with Microsatellites in Natural Populations of Pseudotsuga menziesii (Mirb.) Franco (Pinaceae) in the Central Region of Mexico. Forests. 2019; 10(2):101. https://doi.org/10.3390/f10020101
Chicago/Turabian StyleMontiel Castelán, Paulina, Moisés Cortés-Cruz, Ma. del Carmen Mendoza-Castillo, Serafín Cruz-Izquierdo, Javier López-Upton, Isaac Sandoval Padilla, and Vidal Guerra de la Cruz. 2019. "Diversity and Genetic Structure Inferred with Microsatellites in Natural Populations of Pseudotsuga menziesii (Mirb.) Franco (Pinaceae) in the Central Region of Mexico" Forests 10, no. 2: 101. https://doi.org/10.3390/f10020101
APA StyleMontiel Castelán, P., Cortés-Cruz, M., Mendoza-Castillo, M. d. C., Cruz-Izquierdo, S., López-Upton, J., Sandoval Padilla, I., & Guerra de la Cruz, V. (2019). Diversity and Genetic Structure Inferred with Microsatellites in Natural Populations of Pseudotsuga menziesii (Mirb.) Franco (Pinaceae) in the Central Region of Mexico. Forests, 10(2), 101. https://doi.org/10.3390/f10020101
 
        

 
                         
       