Isolation and Characterization of Two Microalgal Isolates from Vietnam with Potential for Food, Feed, and Biodiesel Production
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation and Purification of Microalgae
2.2. DNA Isolation, PCR and DNA Sequencing
2.3. Microalgal Growth
2.4. Biomass Analysis
2.4.1. Dry Weight
2.4.2. Fatty Acid Methyl Ester Analysis (FAME) Analysis
2.4.3. Biodiesel Fuel Properties Based on FAME Profiles
2.4.4. Protein Content
2.4.5. Pigment Analysis
2.5. Intron Analysis
2.6. 18S rDNA Phylogeny
3. Results
3.1. Sequencing of the rDNA-ITS Region
3.2. Phylogenetic Analysis of the nl3 Sequence
3.3. Microalgal Growth
3.4. Pigment Content in the Exponential and Stationary Phases
3.5. Fatty Acid Profile and Content in the Exponential and Stationary Phases
3.6. Effect of Salinity Conditions on Biodiesel Quality
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Rodolfi, L.; Chini, G.; Niccol, Z.; Giulia, B.; Natascia, P.; Gimena, B.; Mario, B.; Tredici, R. Microalgae for oil: Strain selection, induction of lipid synthesis and outdoor mass cultivation in a low-cost photobioreactor. Biotechnol. Bioeng. 2009, 102, 100–112. [Google Scholar] [CrossRef] [PubMed]
- Sydney, E.B.; Sydney, A.C.N.; de Carvalho, J.C.; Soccol, C.R. Microalgal strain selection for biofuel production. In Biomass, Biofuels and Biochemicals: Biofuels from Algae; Panday, A., Chang, J.S., Soccol, C.R., Lee, D.J., Chisti, Y., Elsevier, B.V., Eds.; Elsevier: Amsterdam, The Netherlands, 2019; pp. 59–66. [Google Scholar]
- Laurens, L.M.L.; Chen-Glasser, M.; McMillan, J.D. A perspective on renewable bioenergy from photosynthetic algae as feedstock for biofuels and bioproducts. Algal Res. 2017, 24, 261–264. [Google Scholar] [CrossRef]
- Hu, H.; Gao, K. Optimization of growth and fatty acid composition of a unicellular marine picoplankton, Nannochloropsis sp., with enriched carbon sources. Biotechnol. Lett. 2003, 25, 421–425. [Google Scholar] [CrossRef] [PubMed]
- Sajjadi, B.; Chen, W.Y.; Raman, A.A.A.; Ibrahim, S. Microalgae lipid and biomass for biofuel production: A comprehensive review on lipid enhancement strategies and their effects on fatty acid composition. Renew. Sustain. Energy Rev. 2018, 97, 200–232. [Google Scholar] [CrossRef]
- Petrie, J.R.; Singh, S.P. Expanding the docosahexaenoic acid food web for sustainable production: Engineering lower plant pathways into higher plants. AoB Plants 2011, 2011. [Google Scholar] [CrossRef]
- Spolaore, P.; Joannis-Cassan, C.; Duran, E.; Isambert, A. Commercial applications of microalgae. J. Biosci. Bioeng. 2006, 101, 87–96. [Google Scholar] [CrossRef]
- Gong, M.; Bassi, A. Carotenoids from microalgae: A review of recent developments. Biotechnol. Adv. 2016, 34, 1396–1412. [Google Scholar] [CrossRef]
- De Vries, J.; Archibald, J.M. Endosymbiosis: Did Plastids Evolve from a Freshwater Cyanobacterium? Curr. Biol. 2017, 27, R103–R122. [Google Scholar] [CrossRef]
- De Vries, J.; Gould, S.B. The monoplastidic bottleneck in algae and plant evolution. J. Cell Sci. 2018, 131, jcs203414. [Google Scholar] [CrossRef]
- Archibald, J.M. Genomic perspectives on the birth and spread of plastids. Proc. Natl. Acad. Sci. USA 2015, 112, 10147–10153. [Google Scholar] [CrossRef]
- Keeling, P.J. The Number, Speed, and Impact of Plastid Endosymbioses in Eukaryotic Evolution. Annu. Rev. Plant Biol. 2013, 64, 583–607. [Google Scholar] [CrossRef] [PubMed]
- Newman, S.M.; Boynton, J.E.; Gillham, N.W.; Randolph-Anderson, B.L.; Johnson, A.M.; Harris, E.H. Transformation of chloroplast ribosomal RNA genes in Chlamydomonas: Molecular and genetic characterization of integration events. Genetics 1990, 126, 875–888. [Google Scholar] [PubMed]
- Harris, E.H. The Chlamydomonas Sourcebook; Elsevier Inc.: Amsterdam, The Netherlands, 1989. [Google Scholar]
- Guillard, R.R.; Ryther, J.H. Studies of marine planktonic diatoms. I. Cyclotella nana Hustedt, and Detonula confervacea (cleve) Gran. Can. J. Microbiol. 1962, 8, 229–239. [Google Scholar] [CrossRef] [PubMed]
- Makridis, P.; Vadstein, O. Food size selectivity of Artemia franciscana at three. J. Plankton Res. 1999, 21, 2191–2201. [Google Scholar] [CrossRef]
- Wood, A.M.; Everroad, R.C.; Wingard, L.M. Measuring growth rates in microalgal cultures. In Algal Culturing Techniques; Andersen, R.A., Ed.; Elsevier: Amsterdam, The Netherlands, 2005; pp. 269–285. [Google Scholar]
- Hoekman, S.K.; Broch, A.; Robbins, C.; Ceniceros, E.; Natarajan, M. Review of biodiesel composition, properties, and specifications. Renew. Sustain. Energy Rev. 2012, 16, 143–169. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Wilgenbusch, J.C.; Swofford, D. Inferring Evolutionary Trees with PAUP*. Curr. Protoc. Bioinforma. 2003. [Google Scholar] [CrossRef]
- Jobb, G.; Von Haeseler, A.; Strimmer, K. TREEFINDER: A powerful graphical analysis environment for molecular phylogenetics. BMC Evol. Biol. 2004, 4, 18. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics: PCR—Protocols and Applications—A Laboratory Manual; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press Inc.: New York, NY, USA, 1990; ISBN 008088671X. [Google Scholar]
- Smolik, M.; Krupa-Małkiewicz, M.; Smolik, B.; Wieczorek, J.; Predygier, K. rDNA variability assessed in PCR reactions of selected accessions of Acer. Not. Bot. Horti Agrobot. Cluj-Napoca 2011, 39, 260–266. [Google Scholar] [CrossRef][Green Version]
- Hoshina, R. DNA analyses of a private collection of microbial green algae contribute to a better understanding of microbial diversity. BMC Res. Notes 2014, 4, 792. [Google Scholar] [CrossRef] [PubMed]
- Suh, S.O.; Jones, K.G.; Blackwell, M. A Group I intron in the nuclear small subunit rRNA gene of Cryptendoxyla hypophloia, an ascomycetous fungus: Evidence for a new major class of Group I introns. J. Mol. Evol. 1999, 48, 493–500. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Wang, Z.; Yu, C.; Yin, Y.; Zhou, G. Evaluation of the potential of 9 Nannochloropsis strains for biodiesel production. Bioresour. Technol. 2014, 167, 503–509. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Xiang, W.; Dai, S.; Li, T.; Yang, F.; Jia, Q.; Wang, G.; Wu, H. The influence of cultivation period on growth and biodiesel properties of microalga Nannochloropsis gaditana 1049. Bioresour. Technol. 2015, 192, 157–164. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Zhu, Y.; Huang, W.; Zhang, C.; Li, T.; Zhang, Y.; Li, A. Evaluation of flocculation induced by pH increase for harvesting microalgae and reuse of flocculated medium. Bioresour. Technol. 2012, 110, 496–502. [Google Scholar] [CrossRef]
- Harris, E.H. Chlamydomonas as a model organism. Annu. Rev. Plant Physiol. Plant Mol. Biol. 2001, 52, 363–406. [Google Scholar] [CrossRef]
- Ji, F.; Hao, R.; Liu, Y.; Li, G.; Zhou, Y.; Dong, R. Isolation of a novel microalgae strain Desmodesmus sp. and optimization of environmental factors for its biomass production. Bioresour. Technol. 2013, 148, 249–254. [Google Scholar] [CrossRef]
- Zhang, Y.; He, M.; Zou, S.; Fei, C.; Yan, Y.; Zheng, S.; Rajper, A.A.; Wang, C. Breeding of high biomass and lipid producing Desmodesmus sp. by Ethylmethane sulfonate-induced mutation. Bioresour. Technol. 2016, 207, 268–275. [Google Scholar] [CrossRef]
- Vieler, A.; Wu, G.; Tsai, C.H.; Bullard, B.; Cornish, A.J.; Harvey, C.; Reca, I.B.; Thornburg, C.; Achawanantakun, R.; Buehl, C.J.; et al. Genome, Functional Gene Annotation, and Nuclear Transformation of the Heterokont Oleaginous Alga Nannochloropsis oceanica CCMP1779. PLoS Genet. 2012, 8, e1003064. [Google Scholar] [CrossRef]
- Solovchenko, A.; Lukyanov, A.; Solovchenko, O.; Didi-Cohen, S.; Boussiba, S.; Khozin-Goldberg, I. Interactive effects of salinity, high light, and nitrogen starvation on fatty acid and carotenoid profiles in Nannochloropsis oceanica CCALA 804. Eur. J. Lipid Sci. Technol. 2014, 116, 635–644. [Google Scholar] [CrossRef]
- Ruivo, M.; Amorim, A.; Cartaxana, P. Effects of growth phase and irradiance on phytoplankton pigment ratios: Implications for chemotaxonomy in coastal waters. J. Plankton Res. 2011, 33, 1012–1022. [Google Scholar] [CrossRef]
- Hu, J.; Nagarajan, D.; Zhang, Q.; Chang, J.S.; Lee, D.J. Heterotrophic cultivation of microalgae for pigment production: A review. Biotechnol. Adv. 2018, 36, 54–67. [Google Scholar] [CrossRef]
- Lubian, L.M.; Montero, O.; Moreno-Garrido, I.; Huertas, I.E.; Sobrino, C.; Gonzalez-Del Valle, M.; Pares, G. Nannochloropsis (Eustigmatophyceae) as source of commercially valuable pigments. J. Appl. Phycol. 2000, 12, 249–255. [Google Scholar] [CrossRef]
- Liu, J.; Sun, Z.; Gerken, H.; Liu, Z.; Jiang, Y.; Chen, F. Chlorella zofingiensis as an alternative microalgal producer of astaxanthin: Biology and industrial potential. Mar. Drugs 2014, 12, 3487–3515. [Google Scholar] [CrossRef]
- Chen, W.-C.; Hsu, Y.-C.; Chang, J.-S.; Ho, S.-H.; Wang, L.-F.; Wei, Y.-H. Enhancing production of lutein by a mixotrophic cultivation system using microalga Scenedesmus obliquus CWL-1. Bioresour. Technol. 2019, 291, 121891. [Google Scholar] [CrossRef] [PubMed]
- Rauytanapanit, M.; Janchot, K.; Kusolkumbot, P.; Sirisattha, S.; Waditee-Sirisattha, R.; Praneenararat, T. Nutrient deprivation-associated changes in green microalga coelastrum sp. TISTR 9501RE enhanced potent antioxidant carotenoids. Mar. Drugs 2019, 17, 328. [Google Scholar] [CrossRef] [PubMed]
- Christa, G.; Cruz, S.; Jahns, P.; de Vries, J.; Cartaxana, P.; Esteves, A.C.; Serôdio, J.; Gould, S.B. Photoprotection in a monophyletic branch of chlorophyte algae is independent of energy-dependent quenching (qE). New Phytol. 2017, 214, 1132–1144. [Google Scholar] [CrossRef] [PubMed]
- Khozin-Goldberg, I.; Boussiba, S. Concerns over the reporting of inconsistent data on fatty acid composition for microalgae of the genus Nannochloropsis (Eustigmatophyceae). J. Appl. Phycol. 2011, 23, 933–934. [Google Scholar] [CrossRef]
- Plancke, C.; Vigeolas, H.; Höhner, R.; Roberty, S.; Emonds-Alt, B.; Larosa, V.; Willamme, R.; Duby, F.; Onga Dhali, D.; Thonart, P.; et al. Lack of isocitrate lyase in Chlamydomonas leads to changes in carbon metabolism and in the response to oxidative stress under mixotrophic growth. Plant J. 2014, 77, 404–417. [Google Scholar] [CrossRef]
- Lang, I.; Hodac, L.; Friedl, T.; Feussner, I. Fatty acid profiles and their distribution patterns in microalgae: A comprehensive analysis of more than 2000 strains from the SAG culture collection. BMC Plant Biol. 2011, 11, 124. [Google Scholar] [CrossRef]
- Knothe, G. Improving biodiesel fuel properties by modifying fatty ester composition. Energy Environ. Sci. 2009, 2, 759–766. [Google Scholar] [CrossRef]
- Ma, X.N.; Chen, T.P.; Yang, B.; Liu, J.; Chen, F. Lipid production from Nannochloropsis. Mar. Drugs 2016, 14, 61. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Wang, H.; Chen, L.; Cheng, W.; Liu, T. Heterotrophy of filamentous oleaginous microalgae Tribonema minus for potential production of lipid and palmitoleic acid. Bioresour. Technol. 2017, 239, 250–257. [Google Scholar] [CrossRef]
- Wang, H.; Gao, L.; Zhou, W.; Liu, T. Growth and palmitoleic acid accumulation of filamentous oleaginous microalgae Tribonema minus at varying temperatures and light regimes. Bioprocess Biosyst. Eng. 2016, 39, 1589–1595. [Google Scholar] [CrossRef]
- Janssen, J.H.; Wijffels, R.H.; Barbosa, M.J. Lipid Production in Nannochloropsis gaditana during Nitrogen Starvation. Biology 2019, 8, 5. [Google Scholar] [CrossRef]
- Hedberg, A.; Johansen, S.D. Nuclear group i introns in self-splicing and beyond. Mob. DNA 2013, 4, 17. [Google Scholar] [CrossRef]
- Corsaro, D.; Köhsler, M.; Venditti, D.; Rott, M.B.; Walochnik, J. Recovery of an Acanthamoeba strain with two group I introns in the nuclear 18S rRNA gene. Eur. J. Protistol. 2019, 68, 88–98. [Google Scholar] [CrossRef]
- Goddard, M.R.; Burt, A. Recurrent invasion and extinction of a selfish gene. Proc. Natl. Acad. Sci. USA 1999, 96, 13880–13885. [Google Scholar] [CrossRef]
- Besen, K.P.; Melim, E.W.H.; da Cunha, L.; Favaretto, E.D.; Moreira, M.; Fabregat, T.E.H.P. Lutein as a natural carotenoid source: Effect on growth, survival and skin pigmentation of goldfish juveniles (Carassius auratus). Aquac. Res. 2019, 50, 2200–2206. [Google Scholar] [CrossRef]
- Thao, T.Y.; Linh, D.T.N.; Si, V.C.; Carter, T.W.; Hill, R.T. Isolation and selection of microalgal strains from natural water sources in Viet Nam with potential for edible oil production. Mar. Drugs 2017, 15, 194. [Google Scholar] [CrossRef]
- Corsaro, D.; Venditti, D. Nuclear Group I introns with homing endonuclease genes in Acanthamoeba genotype T4. Eur. J. Protistol. 2018, 66, 26–35. [Google Scholar] [CrossRef] [PubMed]



| Primer | Sequence (5′-3′) | DNA Region Amplified |
|---|---|---|
| NS1 | GTAGTCATATGCTTGTCTC | SSU |
| NS2 | GGCTGCTGGCACCAGACTTGC | SSU |
| NS3 | GCAAGTCTGGTGCCAGCAGCC | SSU |
| NS4 | CTTCCGTCAATTCCTTTAAG | SSU |
| NS5 | AACTTAAAGGAATTGACGGAAG | SSU |
| NS8 | TCCGCAGGTTCACCTACGGA | SSU |
| ITS1 | TCCGTAGGTGAACCTGCGG | ITS1 |
| ITS3 | GCATCGATGAAGAACGCAGC | ITS2 |
| ITS4 | TCCTCCGCTTATTGATATGC | ITS2 |
| Pigment | N. salina nl6 | Desmodesmus sp. nl3 | |||
| Exponential Phase | Stationary Phase | Exponential Phase | Stationary Phase | ||
| Lutein | 0.48 ± 0.02 | 0.22 ± 0.03 | 1.88 ± 0.11 | 1.63 ± 0.24 | |
| Neoxanthin | 0.13 ± 0.00 | nd | 0.16 ± 0.02 | 0.13 ± 0.08 | |
| Violaxanthin | 2.51 ± 0.11 | 0.59 ± 0.10 | 0.61 ± 0.05 | 0.31 ± 0.07 | |
| Antheraxanthin | nd | nd | nd | 0.13 ± 0.03 | |
| Chlorophyll b | - | - | 3.79 ± 0.45 | 2.16 ± 0.09 | |
| Chlorophyll a | 12.20 ±0.49 | 3.07 ± 0.36 | 14.16 ± 0.64 | 6.82 ± 0.33 | |
| Beta-carotene | 0.27 ± 0.00 | 0.06 ± 0.01 | 0.52 ± 0.05 | 0.18 ± 0.02 | |
| Astaxanthin | nd | 0.36 ± 0.03 | nd | nd | |
| Canthaxanthin | nd | 0.18 ± 0.01 | 0.02 ± 0.00 | 0.01 ± 0.00 | |
| Desmodesmus sp. nl3 (Stationary Phase) | Salinity | ||||
| 0‰ | 10‰ | 20‰ | 30‰ | 35‰ | |
| Lutein | 1.63 ± 0.24 | 4.01 ± 0.55 | 7.00 ± 0.24 | 5.67 ± 0.17 | 2.24 ± 0.72 |
| Protein (% DW) | 26.3 ± 1.99 | 40.54 ± 2.96 | 38.07 ± 0.29 | 39.26 ± 1.71 | 31.93 ± 2.55 |
| Biomass yield (g L−1) | 1.54 ± 0.06 | 1.19 ± 0.04 | 1.41 ± 0.03 | 1.21 ± 0.02 | 1.12 ± 0.00 |
| Fatty Acid | N. salina nl6 | Desmodesmus sp. nl3 | ||
|---|---|---|---|---|
| Exponential Phase | Stationary Phase | Exponential Phase | Stationary Phase | |
| C14 | nd | 0.68 ± 0.21 | nd | nd |
| C16 | 55.75 ± 1.86 | 44.62 ± 1.39 | 24.81 ± 0.62 | 25.70 ± 1.75 |
| C16:1 (C16:1n−7) | 35.64 ± 2.15 | 33.61 ± 1.24 | nd | nd |
| C18 | nd | 1.28 ± 0.56 | 1.60 ± 0.81 | nd |
| C18:1–cis | 2.79 ± 0.86 | 7.07 ± 0.78 | 12.12 ± 0.95 | 27.73 ± 1.27 |
| C18:2–cis | nd | 0.65 ± 0.24 | 11.20 ± 0.81 | 21.74 ± 0.41 |
| C18:3(cis-Δ9,12,15) | - | - | 50.27 ± 0.32 | 24.83 ± 2.20 |
| C20:3 (C20:3n−6) | 1.01 ± 0.42 | 1.11 ± 0.15 | - | - |
| C20:4 (C20:4n−6) | 0.42 ± 0.28 | 4.01 ± 0.29 | - | - |
| C20:5 (C20:5n−3) | 4.39 ± 0.73 | 7.08 ± 0.39 | - | - |
| Σ SFA a | 55.75 ± 1.86 | 46.47 ± 1.20 | 26.41 ± 1.43 | 25.70 ± 1.75 |
| Σ MUFA b | 38.43 ± 1.60 | 40.68 ± 1.00 | 12.12 ± 0.95 | 27.73 ± 1.27 |
| Σ PUFA c | 5.82 ± 1.33 | 12.86 ± 0.95 | 61.47 ± 0.48 | 46.57 ± 2.44 |
| % DW | 18.87 ± 3.21 | 40.41 ± 2.87 | 10.22 ± 0.91 | 8.65 ± 0.50 |
| N. salina nl6 | Salinity | |||
|---|---|---|---|---|
| Fatty Acid | 10‰ | 20‰ | 30‰ | 35‰ |
| C14 | 2.81 ± 0.03 | 2.90 ± 0.01 | 3.89 ± 0.09 | 1.94 ± 0.51 |
| C16 | 48.50 ± 5.25 | 43.85 ± 2.14 | 43.86 ± 0.59 | 44.41 ± 1.35 |
| C16:1 (C16:1n−7) | 40.06 ± 3.99 | 38.25 ± 1.01 | 36.37 ± 0.82 | 37.59 ± 1.58 |
| C18 | nd | 1.52 ± 0.83 | 1.24 ± 0.36 | 0.63 ± 0.16 |
| C18:1–cis | 8.63 ± 1.28 | 11.25 ± 0.63 | 10.88 ± 1.10 | 10.89 ± 0.29 |
| C18:2–cis | nd | 0.40 ± 0.04 | 0.57 ± 0.09 | 0.18 ± 0.25 |
| C20 | nd | nd | nd | nd |
| C20:3 (C20:3n−6) | nd | nd | nd | 0.01 ± 0.00 |
| C20:4 (C20:4n−6) | nd | 0.97 ± 0.09 | 1.51 ± 0.38 | 1.93 ± 0.24 |
| C20:5 (C20:5n−3) | nd | 0.86 ± 0.19 | 1.68 ± 0.47 | 2.44 ± 0.31 |
| Σ SFA a | 51.31 ± 5.28 | 48.27 ± 1.31 | 48.99 ± 1.04 | 46.98 ± 1.00 |
| Σ MUFA b | 48.69 ± 5.28 | 49.50 ± 1.65 | 47.26 ± 0.28 | 48.47 ± 1.30 |
| Σ PUFA c | nd | 2.23 ± 0.33 | 3.76 ± 0.76 | 4.55 ± 0.29 |
| Biomass yield (g/L) | 0.4 ± 0.01 | 0.44 ± 0.00 | 0.49 ± 0.00 | 0.48 ± 0.03 |
| Desmodesmus sp. nl3 | Salinity | |||
|---|---|---|---|---|
| % Fatty Acids | 10‰ | 20‰ | 30‰ | 35‰ |
| C14 | nd | nd | nd | nd |
| C16 | 19.00 ± 0.33 | 17.54 ± 1.95 | 18.05 ± 0.63 | 21.53 ± 0.51 |
| C16:1 | nd | nd | 1.51 ± 0.27 | 3.62 ± 0.36 |
| C18 | nd | nd | nd | 0.55 ± 0.54 |
| C18:1–cis | 9.47 ± 0.97 | 6.04 ± 0.21 | 14.64 ± 0.51 | 26.23 ± 2.69 |
| C18:2–cis | 27.70 ± 0.89 | 22.71 ± 1.01 | 23.60 ± 1.24 | 19.22 ± 0.47 |
| C18:3(cis-Δ9,12,15) | 43.83 ± 1.79 | 53.71 ± 2.35 | 42.20 ± 0.78 | 29.03 ± 3.79 |
| Σ SFAa | 19.00 ± 0.33 | 17.54 ± 1.95 | 18.05 ± 0.63 | 21.90 ± 0.93 |
| Σ MUFAb | 9.47 ± 0.97 | 6.04 ± 0.21 | 16.14 ± 0.43 | 29.85 ± 2.85 |
| Σ PUFAc | 71.53 ± 1.30 | 76.42 ± 1.76 | 65.80 ± 0.58 | 48.26 ± 3.78 |
| Biodiesel Properties | Salinity (Stationary Phase) | Stationary Phase | Exponential Phase | Standards | ||||
|---|---|---|---|---|---|---|---|---|
| 10‰ | 20‰ | 30‰ | 35‰ | 24‰ | 24‰ | US (ASTMD 6751-08) | Europe (EN 14214) | |
| ADU | 0.49 ± 0.05 | 0.58 ± 0.00 | 0.63 ± 0.04 | 0.69 ± 0.01 | 0.97 ± 0.04 | 0.65 ± 0.06 | - | - |
| kV | 4.90 ± 0.03 | 4.84 ± 0.00 | 4.81 ± 0.03 | 4.77 ± 0.00 | 4.6 ± 0.02 | 4.8 ± 0.04 | 1.9–6.0 | 3.5–5.5 |
| SG | 0.88 ± 0.00 | 0.88 ± 0.00 | 0.88 ± 0.00 | 0.88 ± 0.00 | 0.88 ± 0.00 | 0.88 ± 0.00 | 0.85–0.9 | - |
| CP (°C) | 13.49 ± 0.70 | 12.18 ± 0.03 | 11.60± 0.53 | 10.81 ± 0.09 | 7.07 ± 0.47 | 11.3 ± 0.74 | - | - |
| CN | 59.63 ± 0.35 | 58.98 ± 0.01 | 58.69 ± 0.26 | 58.29 ± 0.05 | 56.42 ± 0.24 | 58.54 ± 0.37 | Min 47 | Min 51 |
| IV | 48.93 ± 3.92 | 56.20 ± 0.15 | 59.45 ± 2.95 | 63.83 ± 0.51 | 84.68 ± 2.64 | 61.12 ± 4.13 | - | Max 120 |
| HHV | 39.39 ± 0.09 | 39.56 ± 0.00 | 39.64 ± 0.07 | 39.74 ± 0.01 | 40.24 ±0.06 | 39.68 ± 0.10 | - | - |
| Biodiesel Properties | Salinity (Stationary Phase) | Stationary Phase | Exponential Phase | Standards | ||||
|---|---|---|---|---|---|---|---|---|
| 10‰ | 20‰ | 30‰ | 35‰ | 0‰ | 0‰ | US (ASTMD 6751-08) | Europe (EN 14214) | |
| ADU | 1.96 ± 0.03 | 2.13 ± 0.06 | 1.90 ± 0.01 | 1.55 ± 0.08 | 1.46 ± 0.06 | 1.85 ± 0.02 | - | - |
| kV | 3.97 ± 0.02 | 3.86 ± 0.04 | 4.01 ± 0.01 | 4.23 ± 0.05 | 4.29 ± 0.04 | 4.04 ± 0.01 | 1.9–6.0 | 3.5–5.5 |
| SG | 0.88 ± 0.00 | 0.88 ± 0.00 | 0.88 ± 0.00 | 0.88 ± 0.00 | 0.88 ± 0.00 | 0.88 ± 0.0 | 0.85–0.9 | - |
| CP (°C) | −6.23 ± 0.44 | −8.40 ± 0.79 | −5.38 ± 0.15 | −0.76 ± 1.13 | 0.54 ± 0.83 | −4.76 ± 0.21 | - | - |
| CN | 49.78 ± 0.22 | 48.70 ± 0.39 | 50.21 ± 0.08 | 52.51 ± 0.57 | 53.16 ± 0.42 | 50.52 ± 0.11 | Min 47 | Min 51 |
| IV | 158.74 ± 2.47 | 170.81 ± 4.40 | 153.97 ± 0.86 | 128.27 ± 6.31 | 121.06 ± 4.65 | 150.53 ± 1.19 | - | Max 120 |
| HHV | 41.99 ± 0.06 | 42.28 ± 0.10 | 41.88 ± 0.02 | 41.27 ± 0.15 | 41.10 ± 0.11 | 41.80 ± 0.03 | - | - |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nguyen Luu, T.; Alsafra, Z.; Corato, A.; Corsaro, D.; Le, H.A.; Eppe, G.; Remacle, C. Isolation and Characterization of Two Microalgal Isolates from Vietnam with Potential for Food, Feed, and Biodiesel Production. Energies 2020, 13, 898. https://doi.org/10.3390/en13040898
Nguyen Luu T, Alsafra Z, Corato A, Corsaro D, Le HA, Eppe G, Remacle C. Isolation and Characterization of Two Microalgal Isolates from Vietnam with Potential for Food, Feed, and Biodiesel Production. Energies. 2020; 13(4):898. https://doi.org/10.3390/en13040898
Chicago/Turabian StyleNguyen Luu, Thao, Zouheir Alsafra, Amélie Corato, Daniele Corsaro, Hung Anh Le, Gauthier Eppe, and Claire Remacle. 2020. "Isolation and Characterization of Two Microalgal Isolates from Vietnam with Potential for Food, Feed, and Biodiesel Production" Energies 13, no. 4: 898. https://doi.org/10.3390/en13040898
APA StyleNguyen Luu, T., Alsafra, Z., Corato, A., Corsaro, D., Le, H. A., Eppe, G., & Remacle, C. (2020). Isolation and Characterization of Two Microalgal Isolates from Vietnam with Potential for Food, Feed, and Biodiesel Production. Energies, 13(4), 898. https://doi.org/10.3390/en13040898

