Superhydrophobic Paper-Based Microfluidic Field-Effect Transistor Biosensor Functionalized with Semiconducting Single-Walled Carbon Nanotube and DNAzyme for Hypocalcemia Diagnosis
Abstract
:1. Introduction
2. Results and Discussion
2.1. Mechanism
2.2. Characterization
2.3. Optimization
2.4. Selectivity
2.5. Linear Relationship
2.6. Real Sample Analysis
3. Methods and Materials
3.1. Chemicals and Materials
3.2. Apparatus
3.3. Preparation of Superhydrophobic Cellulose Paper
3.4. Modification of Biomaterial
3.5. Sensing Protocol
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhang, F.; Nan, X.; Wang, H.; Zhao, Y.; Guo, Y.; Xiong, B. Effects of Propylene Glycol on Negative Energy Balance of Postpartum Dairy Cows. Animals 2020, 10, 1526. [Google Scholar] [CrossRef] [PubMed]
- Rasmussen, A.Q.; Jørgensen, N.R.; Schwarz, P. Identification and Functional Characterization of a Novel Mutation in the Human Calcium-Sensing Receptor That Co-Segregates with Autosomal-Dominant Hypocalcemia. Front. Endocrinol. 2018, 9, 200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alabsi, S.S.; Ahmed, A.Y.; Dennis, J.O.; Khir, M.H.; Algamili, A.S. A Review of Carbon Nanotubes Field Effect-Based Biosensors. IEEE Access 2020, 8, 69509–69521. [Google Scholar] [CrossRef]
- Li, J.; Zhang, Y.; To, S.; You, L.; Sun, Y. Effect of Nanowire Number, Diameter, and Doping Density on Nano-FET Biosensor Sensitivity. ACS Nano 2011, 5, 6661–6668. [Google Scholar] [CrossRef]
- Furst, A.; Francis, M.B. Impedance-Based Detection of Bacteria. Chem. Rev. 2018, 119, 700–726. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Wang, K.; Lou, Z.; Jiang, K.; Shen, G.J.A.F.M. Plant-based modular building blocks for “green” electronic skins. Adv. Funct. Mater. 2018, 28, 1804510. [Google Scholar] [CrossRef]
- Mahadeva, S.K.; Walus, K.; Stoeber, B. Paper as a Platform for Sensing Applications and Other Devices: A Review. ACS Appl. Mater. Interfaces 2015, 7, 8345–8362. [Google Scholar] [CrossRef] [PubMed]
- Fang, Z.; Zhang, H.; Qiu, S.; Kuang, Y.; Zhou, J.; Lan, Y.; Sun, C.; Li, G.; Gong, S.; Ma, Z. Versatile Wood Cellulose for Biodegradable Electronics. Adv. Mater. Technol. 2021, 6, 2000928. [Google Scholar] [CrossRef]
- Zhao, D.; Zhu, Y.; Cheng, W.; Chen, W.; Wu, Y.; Yu, H. Cellulose-Based Flexible Functional Materials for Emerging Intelligent Electronics. Adv. Mater. 2020, 33, e2000619. [Google Scholar] [CrossRef]
- Zhao, X.-Q.; Wahid, F.; Cui, J.-X.; Wang, Y.-Y.; Zhong, C. Cellulose-based special wetting materials for oil/water separation: A review. Int. J. Biol. Macromol. 2021, 185, 890–906. [Google Scholar] [CrossRef]
- Guan, M.; An, X.; Liu, H. Cellulose nanofiber (CNF) as a versatile filler for the preparation of bamboo pulp based tissue paper handsheets. Cellulose 2019, 26, 2613–2624. [Google Scholar] [CrossRef]
- Sharma, S.K.; Sharma, P.R.; Chen, H.; Johnson, K.; Zhan, C.; Wang, R.; Hsiao, B. Cellulose-Supported Nanosized Zinc Oxide: Highly Efficient Bionanomaterial for Removal of Arsenic from Water. In Contaminants in Our Water: Identification and Remediation Methods; American Chemical Society: Washington, DC, USA, 2020; Volume 1352, pp. 253–267. [Google Scholar]
- Tang, Z.; Li, H.; Hess, D.W.; Breedveld, V. Effect of chain length on the wetting properties of alkyltrichlorosilane coated cellulose-based paper. Cellulose 2016, 23, 1401–1413. [Google Scholar] [CrossRef]
- Verho, T.; Bower, C.; Andrew, P.; Franssila, S.; Ikkala, O.; Ras, R. Mechanically Durable Superhydrophobic Surfaces. Adv. Mater. 2010, 23, 673–678. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Wang, Y.; Huang, J.; Chen, Z.; Chen, G.; Lai, Y. Bioinspired surfaces with superamphiphobic properties: Concepts, synthesis, and applications. Adv. Funct. Mater. 2018, 28, 1707415. [Google Scholar] [CrossRef]
- Hu, L.; Wang, J.; Hou, K.; Yang, S. Robust ultralow friction between graphene and octadecyltrichlorosilane self-assembled monolayers. Appl. Surf. Sci. 2018, 475, 389–396. [Google Scholar] [CrossRef]
- Zhang, L.; Zhou, A.G.; Sun, B.R.; Chen, K.S.; Yu, H.-Z. Functional and versatile superhydrophobic coatings via stoichiometric silanization. Nat. Commun. 2021, 12, 982. [Google Scholar] [CrossRef]
- Gindi, M.; Melamed, A.; Malka, D. A four green-light demultiplexer using a multi gallium nitride slot-waveguide structure. Photonics Nanostructure-Fundam. Appl. 2020, 42, 100855. [Google Scholar] [CrossRef]
- Moshaev, V.; Leibin, Y.; Malka, D. Optimizations of Si PIN diode phase-shifter for controlling MZM quadrature bias point using SOI rib waveguide technology. Opt. Laser Technol. 2021, 138, 106844. [Google Scholar] [CrossRef]
- Je, G.; Malka, D.; Kim, H.; Hong, S.; Shin, B. A study on micro hydroforming using shock wave of 355 nm UV-pulsed laser. Appl. Surf. Sci. 2017, 417, 244–249. [Google Scholar] [CrossRef]
- Wang, H.; Liu, Y.; Wang, J.; Xiong, B.; Hou, X. Electrochemical impedance biosensor array based on DNAzyme-functionalized single-walled carbon nanotubes using Gaussian process regression for Cu (II) and Hg (II) determination. Microchim. Acta 2020, 187, 207. [Google Scholar] [CrossRef]
- Wang, H.; Zhang, F.; Wang, Y.; Shi, F.; Luo, Q.; Zheng, S.; Chen, J.; Dai, D.; Yang, L.; Tang, X.; et al. DNAzyme-Amplified Electrochemical Biosensor Coupled with pH Meter for Ca2+ Determination at Variable pH Environments. Nanomaterials 2021, 12, 4. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.; Burciu, B.; Filipe, C.D.; Li, Y.; Dellinger, K.; Didar, T.F. DNAzyme-Based Biosensors: Immobilization Strategies, Applications, and Future Prospective. ACS Nano 2021, 15, 13943–13969. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Saran, R.; Huang, P.-J.J.; Ding, J.; Liu, J. An Exceptionally Selective DNA Cooperatively Binding Two Ca2+ Ions. ChemBioChem 2017, 18, 518–522. [Google Scholar] [CrossRef]
- Cheng, P.-Y.; Tsai, J.-H.; Chen, J.-Z. Hydrophilic patterning of octadecyltrichlorosilane (OTS)-coated paper via atmospheric-pressure dielectric-barrier-discharge jet (DBDjet). Cellulose 2020, 27, 10293–10301. [Google Scholar] [CrossRef]
- He, Q.; Ma, C.; Hu, X.; Chen, H. Method for Fabrication of Paper-Based Microfluidic Devices by Alkylsilane Self-Assembling and UV/O3-Patterning. Anal. Chem. 2013, 85, 1327–1331. [Google Scholar] [CrossRef] [PubMed]
- Ye, T.; McArthur, E.A.; Borguet, E. Mechanism of UV Photoreactivity of Alkylsiloxane Self-Assembled Monolayers. J. Phys. Chem. B 2005, 109, 9927–9938. [Google Scholar] [CrossRef] [PubMed]
- Tang, L.; Wang, Y.; Li, J. The graphene/nucleic acid nanobiointerface. Chem. Soc. Rev. 2015, 44, 6954–6980. [Google Scholar] [CrossRef] [Green Version]
- Zhan, Z.; Lin, R.; Tran, V.-T.; An, J.; Wei, Y.; Du, H.; Tran, T.; Lu, W. Paper/carbon nanotube-based wearable pressure sensor for physiological signal acquisition and soft robotic skin. ACS Appl. Mater. Interfaces 2017, 9, 37921–37928. [Google Scholar] [CrossRef]
- Yousefi, H.; Su, H.-M.; Ali, M.; Filipe, C.D.M.; Didar, T.F. Producing Covalent Microarrays of Amine-Conjugated DNA Probes on Various Functional Surfaces to Create Stable and Reliable Biosensors. Adv. Mater. Interfaces 2018, 5, 1800659. [Google Scholar] [CrossRef]
- Atykyan, N.; Revin, V.; Shutova, V. Raman and FT-IR Spectroscopy investigation the cellulose structural differences from bacteria Gluconacetobacter sucrofermentans during the different regimes of cultivation on a molasses media. AMB Express 2020, 10, 84. [Google Scholar] [CrossRef]
- Kouadri, I.; Satha, H. Extraction and characterization of cellulose and cellulose nanofibers from Citrullus colocynthis seeds. Ind. Crop. Prod. 2018, 124, 787–796. [Google Scholar] [CrossRef]
- Agarwal, U.P.; Ralph, S.A.; Reiner, R.S.; Baez, C. Probing crystallinity of never-dried wood cellulose with Raman spectroscopy. Cellulose 2015, 23, 125–144. [Google Scholar] [CrossRef]
- Cunha, R.; Paupitz, R.; Yoon, K.; Van Duin, A.C.; Elías, A.L.; Carozo, V.; Dasgupta, A.; Fujisawa, K.; Lopez, N.P.; Araujo, P.T.; et al. Raman spectroscopy revealing noble gas adsorption on single-walled carbon nanotube bundles. Carbon 2017, 127, 312–319. [Google Scholar] [CrossRef] [Green Version]
- Glamazda, A.; Plokhotnichenko, A.; Leontiev, V.; Karachevtsev, V. DNA-wrapped carbon nanotubes aligned in stretched gelatin films: Polarized resonance Raman and absorption spectroscopy study. Phys. E Low-Dimens. Syst. Nanostructures 2017, 93, 92–96. [Google Scholar] [CrossRef]
- Grushevskaya, H.; Krylova, N.; Lipnevich, I.; Egorova, V.; Babenka, A. Single nucleotide polymorphism genotyping using DNA sequencing on multiwalled carbon nanotubes monolayer by CNT-plasmon resonance. Int. J. Mod. Phys. B 2018, 32, 1840033. [Google Scholar] [CrossRef]
- Shen, Y.; Tran, T.-T.; Modha, S.; Tsutsui, H.; Mulchandani, A. A paper-based chemiresistive bio-sensor employing single-walled carbon nanotubes for low-cost, point-of-care detection. Biosens. Bioelectron. 2019, 130, 367–373. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Yin, Y.; Gang, L. Single-gap Microelectrode Functionalized with Single-walled Carbon Nanotubes and Pbzyme for the Determination of Pb2+. Electroanalysis 2019, 31, 1174–1181. [Google Scholar] [CrossRef]
- Bila, H.; Kurisinkal, E.E.; Bastings, M.M.C. Engineering a stable future for DNA-origami as a biomaterial. Biomater. Sci. 2019, 7, 532–541. [Google Scholar] [CrossRef]
- Mahmoudi-Moghaddam, H.; Tajik, S.; Beitollahi, H. A new electrochemical DNA biosensor based on modified carbon paste electrode using graphene quantum dots and ionic liquid for determination of topotecan. Microchem. J. 2019, 150, 104085. [Google Scholar] [CrossRef]
- Liu, S.; Ding, J.; Qin, W. Current pulse based ion-selective electrodes for chronopotentiometric determination of calcium in seawater. Anal. Chim. Acta 2018, 1031, 67–74. [Google Scholar] [CrossRef]
- Ocaña, C.; Abramova, N.; Bratov, A.; Lindfors, T.; Bobacka, J.J.T. Calcium-selective electrodes based on photo-cured polyurethane-acrylate membranes covalently attached to methacrylate functionalized poly (3,4-ethylenedioxythiophene) as solid-contact. Talanta 2018, 186, 279–285. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Chen, Y.; Fang, D. Electrochemiluminescence in Luminol-based calcium-selective nanoparticles for the determination of calcium ions. J. Electroanal. Chem. 2020, 878, 114671. [Google Scholar] [CrossRef]
- Ahmad, R.; Tripathy, N.; Ahn, M.-S.; Yoo, J.-Y.; Hahn, Y.-B. Preparation of a Highly Conductive Seed Layer for Calcium Sensor Fabrication with Enhanced Sensing Performance. ACS Sens. 2018, 3, 772–778. [Google Scholar] [CrossRef]
- Yuan, H.; Ma, C.; Geng, J.; Zhang, L.; Cui, H.; Liu, C. Preparation of Co3O4 conical nanotube and its application in calcium ion biosensor. Appl. Phys. A 2018, 124, 101. [Google Scholar] [CrossRef]
- Keene, S.; Fogarty, D.; Cooke, R.; Casadevall, C.D.; Salleo, A.; Parlak, O. Wearable Organic Electrochemical Transistor Patch for Multiplexed Sensing of Calcium and Ammonium Ions from Human Perspiration. Adv. Healthc. Mater. 2019, 8, e1901321. [Google Scholar] [CrossRef] [PubMed]
- Yue, J.; Li, L.; Cao, L.; Zan, M.; Yang, D.; Wang, Z.; Chang, Z.; Mei, Q.; Miao, P.; Dong, W.-F. Two-Step Hydrothermal Preparation of Carbon Dots for Calcium Ion Detection. ACS Appl. Mater. Interfaces 2019, 11, 44566–44572. [Google Scholar] [CrossRef] [PubMed]
- Peng, B.; Zhou, J.; Xu, J.; Fan, M.; Ma, Y.; Zhou, M.; Li, T.; Zhao, S. A smartphone-based colorimetry after dispersive liquid–liquid microextraction for rapid quantification of calcium in water and food samples. Microchem. J. 2019, 149, 104072. [Google Scholar] [CrossRef]
- Shibata, H.; Ikeda, Y.; Hiruta, Y.; Citterio, D. Inkjet-printed pH-independent paper-based calcium sensor with fluorescence signal readout relying on a solvatochromic dye. Anal. Bioanal. Chem. 2020, 412, 3489–3497. [Google Scholar] [CrossRef]
- Gao, M.; Li, Y.; Chen, X.; Li, S.; Ren, L.; Tang, B.Z. Aggregation-Induced Emission Probe for Light-Up and in Situ Detection of Calcium Ions at High Concentration. ACS Appl. Mater. Interfaces 2018, 10, 14410–14417. [Google Scholar] [CrossRef]
- Wang, H.; Luo, Q.; Zhao, Y.; Nan, X.; Zhang, F.; Wang, Y.; Wang, Y.; Hua, D.; Zheng, S.; Jiang, L.; et al. Electrochemical device based on nonspecific DNAzyme for the high-accuracy determination of Ca2+ with Pb2+ interference. Bioelectrochemistry 2020, 140, 107732. [Google Scholar] [CrossRef]
Name | Sequence and Modifications (from 3′-Terminus) |
---|---|
NS-substrate | NH2-(CH2)6-GCGGTAGAAGG/rA/TATCACTGAGCACTGGGATAAGCGGTAGA |
NT-substrate | NH2-(CH2)6-GCGGTAGAAGG/rA/TATCACTGAGCACTGGG/rA/TAAGCGGTA GA |
ND-substrate | NH2-(CH2)6-GCGGTAGAAGG/rA/TATCACTGAGCACTGGG/rA/TAAGCGGTA GAACTCACAATGTATAATGCGCGCATTATACATTGTGAGT |
NO-substrate | NH2-(CH2)6-GCGGTAGAAGGATATCACTGAGCACTGGGATAAGCGGTAGAA CTCACAATGTATAATGCGCGCATTATACATTGTGAGT |
CS-EtNa-C5T | TCTACCGCTTATCCCAGTGCTCAGTGATTGTTGGAATGGCTCATGCCACACTCTTTTCTACCGC |
CD-EtNa-C5T | TCTACCGCTTTGTTGGAATGGCTCATGCCACACTCTTCAGTGCTCAGTGATTGTTGGAATGGCTCATGCCACACTCTTTTCTACCGC |
Sample | Add Ca2+ Concentration (μM) | Dual-MFB (μM) | AAS (μM) | Recovery (%) |
---|---|---|---|---|
1 | - | 821 ± 73 | 879 | 93.40 |
500 | 1420 ± 108 | - | 102.97 | |
2 | - | 992 ± 89 | 934 | 106.21 |
500 | 1543 ± 142 | - | 107.60 | |
3 | - | 812 ± 89 | 874 | 93.12 |
500 | 1327 ± 131 | - | 96.58 | |
4 | - | 1072 ± 93 | 982 | 109.16 |
500 | 1401 ± 173 | - | 94.53 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, H.; Chen, R.; Zhang, F.; Yu, Z.; Wang, Y.; Tang, Z.; Yang, L.; Tang, X.; Xiong, B. Superhydrophobic Paper-Based Microfluidic Field-Effect Transistor Biosensor Functionalized with Semiconducting Single-Walled Carbon Nanotube and DNAzyme for Hypocalcemia Diagnosis. Int. J. Mol. Sci. 2022, 23, 7799. https://doi.org/10.3390/ijms23147799
Wang H, Chen R, Zhang F, Yu Z, Wang Y, Tang Z, Yang L, Tang X, Xiong B. Superhydrophobic Paper-Based Microfluidic Field-Effect Transistor Biosensor Functionalized with Semiconducting Single-Walled Carbon Nanotube and DNAzyme for Hypocalcemia Diagnosis. International Journal of Molecular Sciences. 2022; 23(14):7799. https://doi.org/10.3390/ijms23147799
Chicago/Turabian StyleWang, Hui, Ruipeng Chen, Fan Zhang, Zhixue Yu, Yue Wang, Zhonglin Tang, Liang Yang, Xiangfang Tang, and Benhai Xiong. 2022. "Superhydrophobic Paper-Based Microfluidic Field-Effect Transistor Biosensor Functionalized with Semiconducting Single-Walled Carbon Nanotube and DNAzyme for Hypocalcemia Diagnosis" International Journal of Molecular Sciences 23, no. 14: 7799. https://doi.org/10.3390/ijms23147799
APA StyleWang, H., Chen, R., Zhang, F., Yu, Z., Wang, Y., Tang, Z., Yang, L., Tang, X., & Xiong, B. (2022). Superhydrophobic Paper-Based Microfluidic Field-Effect Transistor Biosensor Functionalized with Semiconducting Single-Walled Carbon Nanotube and DNAzyme for Hypocalcemia Diagnosis. International Journal of Molecular Sciences, 23(14), 7799. https://doi.org/10.3390/ijms23147799