Toxic Effects of TiO2 NPs on Zebrafish
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents, Equipment and Laboratory Animal
2.2. Physical and Chemical Representation of TiO2 NPs
2.3. Acute Toxicity Experiment of Zebrafish Embryos
2.4. Exposure Experiment of Adult Zebrafish
2.5. ELISA Test for Three Oxidative Damages of Zebrafish
2.6. Expression of Antioxidant Response-Related Genes of Three Different Zebrafish Tissues
2.7. Statistical Analysis of Data
3. Results
3.1. Physical and Chemical Representation of TiO2 NPs
3.2. Acute Toxicity Experiment of Zebrafish Embryos
3.3. Results For Oxidative Damage Experiment Of Zebrafish
3.4. Expression Analysis Of Oxidative Response Related-Genes in Three Tissues Of Zebrafish
4. Discussion
5. Conclusions
- (1)
- Acute exposure to TiO2 NPs at experimental concentration has no significant effect on the hatchability and deformity rate of zebrafish embryos.
- (2)
- Under long-term exposure, TiO2 NPs can cause oxidative damage to the gill and liver tissues of zebrafish.
- (3)
- Under long-term exposure, the expression of CAT, SOD and GSTs antioxidant enzymes in zebrafish is up-regulated by TiO2 NPs to combat adverse reactions.
Author Contributions
Funding
Conflicts of Interest
References
- Clemente, Z.; Castro, V.L.; Jonsson, C.M.; Fraceto, L.F. Ecotoxicology of nano-TiO2—An evaluation of its toxicity to organisms of aquatic ecosystems. Int. J. Environ. Res. 2011, 6, 33–50. [Google Scholar]
- Davis, M.J. Nanomaterial Case Study: Nanoscale Titanium Dioxide in Water Treatment and in Topical Sunscreen; United States Environmental Protection Agency: Washington, DC, USA, 2009. [Google Scholar]
- Subhapriya, S.; Gomathipriya, P. Green synthesis of titanium dioxide (TiO2) nanoparticles by Trigonellafoenum-graecum extract and its antimicrobial properties. MicrobPathog 2018, 116, 215–220. [Google Scholar]
- Robichaud, C.O.; Uyar, A.E.; Darby, M.R.; Zucker, L.G.; Wiesner, M.R. Estimates of upper bounds and trends in nano-TiO2 production as a basis for exposure assessment. Environ. Sci. Technol. 2009, 43, 4227–4233. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Wxue, L. Toxicity and penetration of TiO2 nanoparticles in hairless mice and porcine skin after subchronic dermal exposure. Toxicol. Lett. 2009, 191, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Hong, F.; Zhou, Y.; Jianhui, J.; Zhuang, J.; Sheng, L.; Wang, L. Nano-TiO2 Inhibits Development of the Central Nervous System and Its Mechanism in Offspring Mice. J. Agric. Food Chem. 2018, 66, 11767–11774. [Google Scholar] [CrossRef] [PubMed]
- Wu, B.; Zhu, L.; Le, X.C. Metabolomics analysis of Tio2 nanoparticles induced toxicological effects on rice (Oryza sativa L.). Environ. Pollut. 2017, 230, 302. [Google Scholar] [CrossRef] [PubMed]
- Appiani, E.; Page, S.E.; McNeill, K. On the use of hydroxyl radical kinetics to assess the number-average molecular weight of dissolved organic matter. Environ. Sci. Technol. 2014, 48, 11794–11802. [Google Scholar] [CrossRef] [PubMed]
- Sipes, N.S.; Padilla, S.; Knudsen, T.B. Zebrafish as an integrative model for twenty-first century toxicity testing. Birth Defects Res. Part C Embryo Today Rev. 2011, 93, 256–267. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.S.; Zhu, L.; Duan, Z.H.; Qi, R.Q.; Li, Y.; Lang, Y.P. Comparative toxicity of several metal oxide nanoparticle aqueous suspensions to Zebrafish (Danio rerio) early developmental stage. J. Environ. Sci. Health Part A Toxic/Hazard. Subst. Environ. Eng. 2008, 43, 278–284. [Google Scholar] [CrossRef]
- Aguirre-Martínez, G.V.; Reinardy, H.C.; Martín-Díaz, M.L.; Henry, T.B. Response of gene expression in zebrafish exposed to pharmaceutical mixtures: Implications for environmental risk. Ecotoxicol. Environ. Saf. 2017, 142, 471–479. [Google Scholar] [CrossRef]
- Tang, T.; Yang, Y.; Chen, Y.; Tang, W.; Wang, F.; Diao, X. Thyroid disruption in zebrafish larvae by short-term exposure to bisphenol AF. Int. J. Environ. Res. Public Health 2015, 12, 13069–13084. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by thecomparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Leary, R.; Westwood, A. Carbonaceous nanomaterials for the enhancement of TiO2 photocatalysis. Carbon 2011, 49, 741–772. [Google Scholar] [CrossRef]
- Yan, J.; Lin, B.; Hu, C.; Zhang, H.; Lin, Z.; Xi, Z. The combined toxicological effects of titanium dioxide nanoparticles and bisphenol A on zebrafish embryos. Nanoscale Res. Lett. 2014, 9, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Clemente, Z.; Castro, V.L.S.S.; Moura, M.A.M.; Jonsson, C.M.; Fraceto, L.F. Toxicity assessment of TiO2, nanoparticles in zebrafish embryos under different exposure conditions. Aquat. Toxicol. 2014, 147, 129–139. [Google Scholar] [CrossRef]
- Vicario-Parés, U.; Castañaga, L.; Lacave, J.M.; Oron, M.; Reip, P.; Berhanu, D.; Valsami-Jones, E.; Cajaraville, M.P.; Orbea, A. Comparative toxicity of metal oxide nanoparticles (CuO, ZnO and TiO2) to developing zebrafish embryos. J. Nanoparti. Res. 2014, 16, 2550. [Google Scholar] [CrossRef]
- Fang, Q.; Shi, Q.; Guo, Y.; Hua, J.; Wang, X.; Zhou, B. Enhanced bioconcentration of Bisphenol A in the presence of Nano-TiO2 can lead to adverse reproductive outcomes in zebrafish. Environ. Sci. Technol. 2016, 50, 1005–1013. [Google Scholar] [CrossRef]
- Barilan, O.; Chuang, C.C.; Schwahn, D.J.; Yang, S.; Joshi, S.; Pedersen, J.A. TiO2 Nanoparticle exposure and illumination during zebrafish development: Mortality at parts per billion concentrations. Environ. Sci. Technol. 2013, 47, 4726–4733. [Google Scholar] [CrossRef]
- Pavagadhi, S.; Sathishkumar, M.; Balasubramanian, R. Uptake of Ag and TiO2 nanoparticles by zebrafish embryos in the presence of other contaminants in the aquatic environment. Water Res. 2014, 55, 280–291. [Google Scholar] [CrossRef]
- Qiang, L.; Shi, X.; Pan, X.; Zhu, L.; Chen, M.; Han, Y. Facilitated bioaccumulation of perfluorooctanesulfonate in zebrafish by nano-TiO2 in two crystalline phases. Environ. Pollut. 2015, 206, 644–651. [Google Scholar] [CrossRef]
- Fang, Q.; Shi, X.; Zhang, L.; Wang, Q.; Wang, X.; Guo, Y. Effect of titanium dioxide nanoparticles on the bioavailability, metabolism, and toxicity of pentachlorophenol in zebrafish larvae. J. Hazard. Mater. 2015, 283, 897–904. [Google Scholar] [CrossRef] [PubMed]
- Xiong, D.; Fang, T.; Yu, L.; Sima, X.; Zhu, W. Effects of nano-scale TiO2, zno and their bulk counterparts on zebrafish: Acute toxicity, oxidative stress and oxidative damage. Sci. Total Environ. 2011, 409, 1444–1452. [Google Scholar] [CrossRef] [PubMed]
- Nel, A.; Xia, T.; Mädler, L.; Li, N. Toxic potential of materials at the nanolevel. Science 2006, 311, 622–627. [Google Scholar] [CrossRef] [PubMed]
- Federici, G.; Shaw, B.J.; Handy, R.D. Toxicity of titanium dioxide nanoparticles to rainbow trout (Oncorhynchus mykiss): Gill injury, oxidative stress, and other physiological effects. Aquat. Toxicol. 2007, 84, 415. [Google Scholar] [CrossRef] [PubMed]
- Winston, G.W. Oxidants and antioxidants in aquatic animals. Winston, Oxidants and antioxidants in aquatic animals. Comp. Biochem. Physiol. C Comp. Pharmacol. Toxicol. 1991, 100, 173. [Google Scholar] [CrossRef]
- Venditti, P.; Di Stefano, L.; Di Meo, S. Mitochondrial metabolism of reactive oxygen species. Mitochondrion 2013, 13, 71–82. [Google Scholar] [CrossRef] [PubMed]
- Jiang, J.; Oberdörster, G.; Elder, A.; Gelein, R.; Mercer, P.; Biswas, P. Does nanoparticle activity depend upon size and crystal phase? Nanotoxicology 2008, 2, 33–42. [Google Scholar] [CrossRef] [PubMed]
- Brown, D.M.; Donaldson, K.; Borm, P.J.; Schins, R.P.; Dehnhardt, M.; Gilmour, P.; Jimenez, L.A.; Stone, V. Calcium and ROS-mediated activation of transcription factors and TNF-alpha cytokine gene expression in macrophages exposed to ultrafine particles. Am. J. Physiol. Lung Cell. Mol. Physiol. 2004, 286, 344–353. [Google Scholar] [CrossRef] [PubMed]
- Tian, W.; Bai, W.; Zhao, C.; Zhang, Z.; Cui, J.; He, X.; Ma, Y.; Zhao, Y. Effects of ZnO nanoparticles on antioxidant enzyme system of zebrafish embryos. China Environ. Sci. 2010, 30, 705–709. [Google Scholar]
- Cuypers, A.; Plusquin, M.; Remans, T.; Jozefczak, M.; Keunen, E.; Gielen, H. Cadmium stress: An oxidative challenge. Biometals 2010, 23, 927–940. [Google Scholar] [CrossRef]
- Dong, M.; Zhu, L.; Zhu, S.; Wang, J.; Du, Z. Toxic effects of 1-decyl-3-methylimidazolium bromide ionic liquid on the antioxidant enzyme system and DNA in zebrafish (Danio rerio) livers. Chemosphere 2013, 91, 1107–1112. [Google Scholar] [CrossRef]
- El-Said, K.S.; Ali, E.M.; Kanehira, K.; Taniguchi, A. Molecularmechanism of DNA damage induced by titanium dioxidenanoparticles in toll-like receptor 3 or 4 expressing humanhepatocarcinoma cell lines. J. Nanobiotechnol. 2014, 12, 48. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Xu, L.; Zhang, T.; Ren, G.; Yang, Z. Oxidative stress and apoptosis induced by nanosized titanium dioxide in PC12 cells. Toxicology 2010, 267, 172–177. [Google Scholar] [CrossRef] [PubMed]
- Park, E.J.; Yi, J.; Chung, K.H.; Ryu, D.Y.; Choi, J.; Park, K. Oxidative stress and apoptosis induced by titanium dioxide nanoparticles in cultured BEAS-2B cells. Toxicol. Lett. 2008, 180, 222–229. [Google Scholar] [CrossRef] [PubMed]
- Naqvi, S.; Samim, M.; Abdin, M.Z.; Ahmed, F.J.; Maitra, A.N.; Prashant, C.K.; Dinda, A.K. Concentration-dependent toxicity of iron oxide nanoparticles mediated by increased oxidative stress. Int. J. Nanomed. 2010, 5, 983–989. [Google Scholar] [CrossRef] [PubMed]
- Buyukhatipoglu, K.; Clyne, A.M. Superparamagnetic iron oxide nanoparticles change endothelial cell morphology and mechanics via reactive oxygen species formation. J. Biomed. Mater. Res. A 2011, 96, 187–195. [Google Scholar] [CrossRef]
- Shakeel, M.; Jabeen, F.; Qureshi, N.A.; Fakhr-E-Alam, M. Toxic effects of titanium dioxide nanoparticles and titanium dioxide bulk salt in the liver and blood of male sprague-dawley rats assessed by different assays. Biol. Trace Elem. Res. 2016, 173, 405–426. [Google Scholar] [CrossRef]
- Varela-Valencia, R.; Gómez-Ortiz, N.; Oskam, G.; de Coss, R.; Rubio-Piña, J.; del Río-García, M.; Albores-Medina, A.; Zapata-Perez, O. The effect of titanium dioxide nanoparticles on antioxidant gene expression in tilapia (Oreochromisniloticus). J. Nanopart. Res. 2014, 16, 2369. [Google Scholar] [CrossRef]
Gene | Accession Number | Forwand Primer (5′–3′) | Reverse Primer (5′–3′) | Amplicon (bp) |
---|---|---|---|---|
Cu/Zn-sod | NM_131294.1 | CAAGAGGGTGAAAAGAAGCCA | GGTCACATTACCCAGGTCTCC | 201 |
cat | NM_130912.2 | AAGTCACTCACGACATCACGC | CGGTGTAGAACTTCACTGCGA | 159 |
gst | NM_131734.3 | CCCTCCTGTCTGGACTCTTTC | CAGTTTCTTGAAGTTCTCGCA | 105 |
β-actin | NM_131031.2 | CACAGTGCTGTCTGGAGGTAC | CATTTAAGGTGGCAACAGTTC | 265 |
Group | 0 h | 24 h | ||
---|---|---|---|---|
Diameter (nm) | Zeta Potential (mV) | Diameter (nm) | Zeta Potential (mV) | |
TiO2 (100 mg/L) | 371.8 ± 27.4 | −21.6 ± 1.1 | 466.8 ± 42.7 | −27.2 ± 0.9 |
TiO2 NPs (10 mg/L) | 101.4 ± 14.5 | −22.8 ± 0.5 | 261.9 ± 22.1 | −19.6 ± 0.7 |
TiO2 NPs (50 mg/L) | 132.9 ± 8.1 | −14.8 ± 0.5 | 327.6 ± 14.5 | −21.5 ± 0.9 |
TiO2 NPs (100 mg/L) | 140.4 ± 15.9 | −17.7 ± 0.7 | 335 ± 29.9 | −28.1 ± 1.1 |
Name of Sample | Concentration (ng/μl) | A260/A280 |
---|---|---|
a1 | 1597.76 | 2.04 |
a2 | 1596.62 | 2.05 |
a3 | 773.00 | 1.99 |
a4 | 1423.89 | 2.03 |
a5 | 537.48 | 1.99 |
b1 | 1287.15 | 2.04 |
b2 | 1742.94 | 2.04 |
b3 | 2127.67 | 2.07 |
b4 | 1972.66 | 2.05 |
b5 | 2385.67 | 2.06 |
c1 | 486.77 | 1.96 |
c2 | 315.04 | 1.96 |
c3 | 270.62 | 1.96 |
c4 | 278.48 | 1.93 |
c5 | 247.95 | 1.94 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, T.; Zhang, Z.; Zhu, X. Toxic Effects of TiO2 NPs on Zebrafish. Int. J. Environ. Res. Public Health 2019, 16, 523. https://doi.org/10.3390/ijerph16040523
Tang T, Zhang Z, Zhu X. Toxic Effects of TiO2 NPs on Zebrafish. International Journal of Environmental Research and Public Health. 2019; 16(4):523. https://doi.org/10.3390/ijerph16040523
Chicago/Turabian StyleTang, Tianle, Zhang Zhang, and Xiaopeng Zhu. 2019. "Toxic Effects of TiO2 NPs on Zebrafish" International Journal of Environmental Research and Public Health 16, no. 4: 523. https://doi.org/10.3390/ijerph16040523
APA StyleTang, T., Zhang, Z., & Zhu, X. (2019). Toxic Effects of TiO2 NPs on Zebrafish. International Journal of Environmental Research and Public Health, 16(4), 523. https://doi.org/10.3390/ijerph16040523