Prevalence of Rotavirus Genogroup A and Norovirus Genogroup II in Bassaseachic Falls National Park Surface Waters in Chihuahua, Mexico
Abstract
1. Introduction
2. Experimental Section
2.1. Collection of Samples
2.2. Virus Adsorption-Elution Technique (VIRADEL)
2.3. Viral RNA Extraction Using Trizol® Method
2.4. Reverse Transcription (RT) for RV
2.5. Polymerase Chain Reaction (PCR) for RV
2.6. RT for NV Detection
2.7. PCR for NV Detection
2.8. Real Time PCR Amplification (qPCR)
2.9. Construction of cDNA Standard
2.10. Standard Curve
2.11. Quality Control
2.12. Sequencing
2.13. Limits of Quantification
3. Results
3.1. Norovirus RT-PCR Optimization
3.2. Rotavirus RT-PCR Optimization
3.3. Phylogenetic Sequence Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Acknowledgements
Author Contributions
Conflicts of Interest
Abbreviations
References
- Lin, J.; Singh, A. Detection of human enteric viruses in Umgeni River, Durban, South Africa. J. Water Health 2015, 13, 1098–1112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iaconelli, M.; Muscillo, M.; Della Libera, S.; Fratini, M.; Meucci, L.; De Ceglia, M.; Giacosa, D.; La Rosa, G. One-year surveillance of human enteric viruses in raw and treated wastewaters, downstream river waters, and drinking waters. Food Environ. Virol. 2016, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fongaro, G.; Padilha, J.; Schissi, C.D.; Nascimento, M.A.; Bampi, G.B.; Viancelli, A.; Barardi, C.R. Human and animal enteric virus in groundwater from deep wells, and recreational and network water. Environ. Sci. Pollut. Res. 2015, 22, 20060–20066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leifels, M.; Hamza, I.A.; Krieger, M.; Wilhelm, M.; Mackowiak, M.; Jurzik, L. From lab to lake—Evaluation of current molecular methods for the detection of infectious enteric viruses in complex water matrices in an urban area. PLoS ONE 2016, 11, e0167105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diario Oficial de la Federación (DOF), Tercera Sección. Secretaria de Medio Ambiente y Recursos Naturales. Available online: http://www.conanp.gob.mx/que_hacemos/pdf/programas_manejo/2016/CASCADA_DE_BASSASEACHIC.pdf (accessed on 15 September 2016).
- Scipioni, A.; Mauroy, A.; Ziant, D.; Saegerman, C.; Thiry, E. A SYBR Green RT-PCR assay in single tube to detect human and bovine noroviruses and control for inhibition. Virol. J. 2008, 5, 94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tong, Y.; Lee, B.E.; Pang, X.L. Rapid genotyping of human rotavirus using SYBR green real-time reverse transcription-polymerase chain reaction with melting curve analysis. World J. Virol. 2015, 4, 365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ye, X.Y.; Ming, X.; Zhang, Y.L.; Xiao, W.Q.; Huang, X.N.; Cao, Y.G.; Gu, K.D. Real-time PCR detection of enteric viruses in source water and treated drinking water in Wuhan, China. Curr. Microbiol. 2012, 65, 244–253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chigor, V.N.; Okoh, A.I. Quantitative RT-PCR detection of hepatitis A virus, rotaviruses and enteroviruses in the Buffalo River and source water dams in the Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Heath 2012, 9, 4017–4032. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodríguez, J.; García, I.; Vila, S.; Gozalbo, R.; Buesa, J.; Monedero, V.; Collado, M.C. Relevance of secretor status genotype and microbiota composition in susceptibility to rotavirus and norovirus infections in humans. Sci. Rep. 2017. [Google Scholar] [CrossRef] [Scilit]
- Diario Oficial de la Federación (DOF). NOM-014-SSA1-1993. Procedimientos Sanitarios para el Muestreo de Agua para uso y Consumo Humano en Sistemas de Abastecimiento de Agua Públicos y Privados. Secretaría de Salud. Available online: http://www.salud.gob.mx/unidades/cdi/nom/127ssa14.html (accessed on 14 June 2016).
- Goyal, S.M.; Gerba, C.P. Viradel method for detection of rota virus from seawater. J. Virol. Methods 1983, 7, 279–285. [Google Scholar] [CrossRef] [Scilit]
- Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef] [Scilit]
- Gentsch, J.R.; Glass, R.I.; Woods, P.; Gouvea, V.; Gorziglia, M.; Flores, J.; Bhan, M.K. Identification of group A rotavirus gene 4 types by polymerase chain reaction. J. Clin. Microbiol. 1992, 30, 1365–1373. [Google Scholar] [PubMed]
- Thorven, M.; Grahn, A.; Hedlund, K.O.; Johansson, H.; Wahlfrid, C.; Larson, G.; Svensson, L. A homozygous nonsense mutation (428G→A) in the human secretor (FUT2) gene provides resistance to symptomatic norovirus (GGII) infections. J. Virol. 2005, 79, 15351–15355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kottaridi, C.; Spathis, A.T.; Ntova, C.K.; Papaevangelou, V.; Karakitsos, P. Evaluation of a multiplex real time reverse transcription PCR assay for the detection and quantitation of the most common human rotavirus genotypes. J. Virol. Methods 2012, 180, 49–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stals, A.; Baert, L.; Botteldoorn, N.; Werbrouck, H.; Herman, L.; Uyttendaele, M.; Van Coillie, E. Multiplex real-time RT-PCR for simultaneous detection of GI/GII noroviruses and murine norovirus 1. J. Virol. Methods 2009, 161, 247–253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ward, P.; Poitras, E.; Leblanc, D.; Gagnon, C.A.; Brassard, J.; Houde, A. Comparison of different RT-qPCR assays for the detection of human and bovine group A rotaviruses and characterization by sequences analysis of genes encoding VP4 and VP7 capsid proteins. J. Appl. Microbiol. 2013, 114, 1435–1448. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Albinana, N.; Clemente, P.; Calgua, B.; Huguet, J.; Courtois, S.; Girones, R. Comparison of methods for concentrating human adenoviruses, polyomavirus JC and noroviruses in source waters and drinking water using quantitative PCR. J. Virol. Methods 2009, 158, 104–109. [Google Scholar] [CrossRef] [Scilit]
- Lodder, W.; Husman, A. Presence of noroviruses and other enteric viruses in sewage and surface waters in The Netherlands. Appl. Environ. Microbiol. 2005, 71, 1453–1461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kitajima, M.; Haramoto, E.; Phanuwan, C.; Katayama, H.; Ohgaki, S. Detection of genogroup IV norovirus in wastewater and river water in Japan. Lett. Appl. Microbiol. 2009, 49, 655–658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Min, B.S.; Noh, Y.J.; Shin, J.H.; Baek, S.Y.; Min, K.I.; Ryu, S.R.; Kim, B.G.; Park, M.K.; Choi, S.E.; Yang, E.H.; et al. Assessment of the quantitative real-time polymerase chain reaction using a cDNA standard for human group A rotavirus. J. Virol. Methods 2006, 137, 280–286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodríguez-Díaz, J.; Querales, L.; Caraballo, L.; Vizzi, E.; Liprandi, F.; Takiff, H.; Betancourt, W.Q. Detection and characterization of waterborne gastroenteritis viruses in urban sewage and sewage-polluted river waters in Caracas, Venezuela. Appl. Environ. Microbiol. 2009, 75, 387–394. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Félix, J.; Fernandez, Y.; Velarde-Felix, J.; Torres, B.; Chaidez, C. Detection and phylogenetic analysis of hepatitis A virus and norovirus in marine recreational waters of Mexico. J. Water Health 2010, 8, 269–278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Bartolo, I.; Monini, M.; Losio, M.N.; Pavoni, E.; Lavazza, A.; Ruggeri, F.M. Molecular characterization of noroviruses and rotaviruses involved in a large outbreak of gastroenteritis in Northern Italy. Appl. Environ. Microbiol. 2011, 77, 5545–5548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pérez-Sautu, U.; Sano, D.; Guix, S.; Kasimir, G.; Pintó, R.M.; Bosch, A. Human norovirus occurrence and diversity in the Llobregat river catchment, Spain. Environ. Microbiol. 2012, 14, 494–502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, H.W.; Lucy, F.E.; Broaders, M.A.; Mastitsky, S.E.; Chen, C.H.; Murray, A. Municipal wastewater treatment plants as pathogen removal systems and as a contamination source of noroviruses and Enterococcus faecalis. J. Water Health 2012, 10, 380–389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fongaro, G.; Nascimento, M.A.; Viancelli, A.; Tonetta, D.; Petrucio, M.M.; Barardi, C.R. Surveillance of human viral contamination and physicochemical profiles in a surface water lagoon. Water Sci. Technol. 2012. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vieira, C.B.; de Abreu Corrêa, A.; de Jesus, M.S.; Luz, S.L.B.; Wyn-Jones, P.; Kay, D.; Vargha, M.; Miagostovich, M.P. Viruses surveillance under different season scenarios of the Negro River Basin, Amazonia, Brazil. Food Environ. Virol. 2016, 8, 57–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- La Rosa, G.; Iaconelli, M.; Pourshaban, M.; Muscillo, M. Detection and molecular characterization of noroviruses from five sewage treatment plants in central Italy. Water Res. 2010, 44, 1777–1784. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Symonds, E.M.; Young, S.; Verbyla, M.E.; McQuaig-Ulrich, S.M.; Ross, E.; Jimenez, J.A.; Harwood, V.J.; Breitbart, M. Microbial source tracking in shellfish harvesting waters in the Gulf of Nicoya, Costa Rica. Water Res. 2017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rohayem, J. Norovirus seasonality and the potential impact of climate change. Clin. Microbiol. Infect. 2009, 15, 524–527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Japhet, M.; Adesina, O.; Famurewa, O.; Svensson, L.; Nordgren, J. Molecular epidemiology of rotavirus and norovirus in Ile-Ife, Nigeria: High prevalence of G12P [8] rotavirus strains and detection of a rare norovirus genotype. J. Med. Virol. 2012, 84, 1489–1496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaas, L.; Gourinat, A.C.; Urbès, F.; Langlet, J. A 1-year study on the detection of human enteric viruses in New Caledonia. Food Environ. Virol. 2015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Payne, D.C.; Vinjé, J.; Szilagyi, P.G.; Edwards, K.M.; Staat, M.A.; Weinberg, G.A.; Wikswo, M. Norovirus and medically attended gastroenteritis in US children. N. Engl. J. Med. 2013, 368, 1121–1130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, L.; Liu, N.; Humphries, E.; Yu, J.; Li, S.; Lindsay, B.; Duan, Z. Aetiology of diarrhoeal disease and evaluation of viral-bacterial co-infection in children under 5 years old in China: a matched case-control study. Clin. Microbiol. Infect. 2015, 22, 381.e9–381.e16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koo, H.L.; Neill, F.H.; Estes, M.K.; Munoz, F.M.; Cameron, A.; DuPont, H.L.; Atmar, R.L. Noroviruses: The most common pediatric viral enteric pathogen at a large university hospital after introduction of rotavirus vaccination. J. Pediatr. Infect. Dis. Soc. 2012, pis070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bucardo, F.; Reyes, Y.; Svensson, L.; Nordgren, J. Predominance of Norovirus and Sapovirus in Nicaragua after implementation of universal rotavirus vaccination. PLoS ONE 2014, 9, e98201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barril, P.A.; Fumian, T.M.; Prez, V.E.; Gil, P.I.; Martínez, L.C.; Giordano, M.O.; Nates, S.V. Rotavirus seasonality in urban sewage from Argentina: Effect of meteorological variables on the viral load and the genetic diversity. Environ. Res. 2015, 138, 409–415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Assis, A.S.F.; Cruz, L.T.; Ferreira, A.S.; Bessa, M.E.; de Oliveira Pinto, M.A.; Vieira, C.B.; Silva, M.L. Relationship between viral detection and turbidity in a watershed contaminated with group A rotavirus. Environ. Sci. Pollut. Res. 2015, 22, 6886–6897. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CDC: Centers for Disease Control and Prevention. Data & Statistics Feature: Surveillance for Rotavirus Outbreaks. Available online: http://www.cdc.gov/norovirus/trends-outbreaks.html (accessed on 31 March 2016).
- Patel, M.M.; Pitzer, V.; Alonso, W.J.; Vera, D.; Lopman, B.; Tate, J.; Viboud, C.; Parashar, U.D. Global seasonality of rotavirus disease. Pediatr. Infect. Dis. J. 2013, 32, e134. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Virus | Primer | 5′–3′ Sequence | Amplicon Size | Reference | |
|---|---|---|---|---|---|
| Rotavirus | CON 3 | TGGCTTCGCCATTTTATAGACA | Forward | 345 bp | Gentsch et al. [14] |
| Rotavirus | IT-I | TCTACTTGGATAACGTGC | Reverse | ||
| Virus | Primer | 5´–3´ Sequence | Amplicon size | Reference | |
|---|---|---|---|---|---|
| Norovirus | JV12 | ATACCACTATGATGCAGATTA | Forward | 326 bp | Thorven et al. [15] |
| Norovirus | JV13 | TCATCATCACCATAGAAAGAG | Reverse | ||
| Season | Volume (L) | Norovirus Copies/L | Rotavirus Copies/L |
|---|---|---|---|
| March | 12 | - | 9.8 × 101 |
| June | 11 | 1.0 × 102 | 1.8 × 102 |
| October | 13 | 5.27 × 102 | - |
| December | 13 | - | - |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Delgado-Gardea, M.C.E.; Tamez-Guerra, P.; Gomez-Flores, R.; Mendieta-Mendoza, A.; Zavala-Díaz de la Serna, F.J.; Contreras-Cordero, J.F.; Erosa-de la Vega, G.; Pérez-Recoder, M.C.; Sánchez-Ramírez, B.; González-Horta, C.; et al. Prevalence of Rotavirus Genogroup A and Norovirus Genogroup II in Bassaseachic Falls National Park Surface Waters in Chihuahua, Mexico. Int. J. Environ. Res. Public Health 2017, 14, 482. https://doi.org/10.3390/ijerph14050482
Delgado-Gardea MCE, Tamez-Guerra P, Gomez-Flores R, Mendieta-Mendoza A, Zavala-Díaz de la Serna FJ, Contreras-Cordero JF, Erosa-de la Vega G, Pérez-Recoder MC, Sánchez-Ramírez B, González-Horta C, et al. Prevalence of Rotavirus Genogroup A and Norovirus Genogroup II in Bassaseachic Falls National Park Surface Waters in Chihuahua, Mexico. International Journal of Environmental Research and Public Health. 2017; 14(5):482. https://doi.org/10.3390/ijerph14050482
Chicago/Turabian StyleDelgado-Gardea, Ma. Carmen E., Patricia Tamez-Guerra, Ricardo Gomez-Flores, Aurora Mendieta-Mendoza, Francisco Javier Zavala-Díaz de la Serna, Juan Francisco Contreras-Cordero, Gilberto Erosa-de la Vega, María Concepción Pérez-Recoder, Blanca Sánchez-Ramírez, Carmen González-Horta, and et al. 2017. "Prevalence of Rotavirus Genogroup A and Norovirus Genogroup II in Bassaseachic Falls National Park Surface Waters in Chihuahua, Mexico" International Journal of Environmental Research and Public Health 14, no. 5: 482. https://doi.org/10.3390/ijerph14050482
APA StyleDelgado-Gardea, M. C. E., Tamez-Guerra, P., Gomez-Flores, R., Mendieta-Mendoza, A., Zavala-Díaz de la Serna, F. J., Contreras-Cordero, J. F., Erosa-de la Vega, G., Pérez-Recoder, M. C., Sánchez-Ramírez, B., González-Horta, C., & Infante-Ramírez, R. (2017). Prevalence of Rotavirus Genogroup A and Norovirus Genogroup II in Bassaseachic Falls National Park Surface Waters in Chihuahua, Mexico. International Journal of Environmental Research and Public Health, 14(5), 482. https://doi.org/10.3390/ijerph14050482

