High Prevalence and Genetic Polymorphisms of Legionella in Natural and Man-Made Aquatic Environments in Wenzhou, China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Legionella Isolation
2.3. Real Time PCR Assay
2.4. Pulsed Field Gel Electrophoresis (PFGE)
2.5. Sequence-Based Typing
2.6. Intracellular Growth Assay
2.7. Statistical Analysis
3. Results
3.1. Degree of Legionella Pollution in Water Samples
3.2. Distribution of Serogroups of Legionella Isolates
3.3. Fluorescence Quantitative Polymerase Chain Reaction Analysis
3.4. PFGE Analysis of Legionella Isolates
3.5. SBT Analysis of Legionella Isolates
3.6. Intracellular Growth Ability
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Diederen, B.M.W. Legionella spp. and Legionnaires’ disease. J. Infect. 2008, 56, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Yu, V.L.; Plouffe, J.F.; Pastoris, M.C.; Stout, J.E.; Schousboe, M.; Widmer, A.; Summersgill, J.; File, T.; Heath, C.M.; Paterson, D.L.; et al. Distribution of Legionella species and serogroups isolated by culture in patients with sporadic community acquired legionellosis: An international collaborative survey. J. Infect. Dis. 2002, 186, 127–128. [Google Scholar] [CrossRef] [PubMed]
- Amemura-Maekawa, J.; Kura, F.; Helbig, J.H.; Chang, B.; Kaneko, A.; Watanabe, Y.; Isobe, J.; Nukina, M.; Nakajima, H.; Kawano, K.; et al. Characterization of Legionella pneumophila isolates from patients in Japan according to serogroups, monoclonal antibody subgroups, and sequence types. J. Med. Microbiol. 2010, 59, 653–659. [Google Scholar] [CrossRef] [PubMed]
- Messi, P.; Bargellini, A.; Anacarso, I.; Marchesi, I.; de Niederhäusern, S.; Bondi, M. Protozoa and human macrophages infection by Legionella pneumophila environmental strains belonging to different serogroups. J. Basic Microbiol. 2012, 52, 261–268. [Google Scholar] [CrossRef]
- Breiman, R.F.; Butler, J.C. Legionnaires’ disease: Clinical, epidemiological, and public health perspectives. J. Semin. Respir. Infect. 1998, 13, 84–89. [Google Scholar]
- Völker, S.; Schreiber, C.; Kistemann, T. Modelling characteristics to predict Legionella contamination risk—Surveillance of drinking water plumbing systems and identification of risk areas. Int. J. Hyg. Environ. Heal. 2016, 219, 101–109. [Google Scholar] [CrossRef] [PubMed]
- Joseph, C.A.; Ricketts, K.D. Legionnaires’ disease in Europe 2007–2008. J. Euro. Surveill. 2010, 15, 19493. [Google Scholar]
- Sánchez-Busó, L.; Guiral, S.; Crespi, S.; Moya, V.; Camaró, M.L.; Olmos, M.P.; Adrián, F.; Morera, V.; Vanaclocha, H.; González-Candelas, F. Genomic investigation of a Legionellosis outbreak in a persistently colonized hotel. Front. Microbiol. 2016, 6, 1556–1565. [Google Scholar] [CrossRef] [PubMed]
- Craun, G.F.; Brunkard, J.M.; Yoder, J.S.; Roberts, V.A.; Carpenter, J.; Wade, T.; Calderon, R.L.; Roberts, J.M.; Beach, M.J.; Roy, S.L. Causes of outbreaks associated with drinking water in the United States from 1971 to 2006. Clin. Microbiol. Rev. 2010, 23, 507–528. [Google Scholar] [CrossRef] [PubMed]
- Ehrhardt, J.; Alabi, A.S.; Kuczius, T.; Tsombeng, F.F.; Becker, K.; Kremsner, P.G.; Schaumburg, F.; Esen, M. Population structure of Legionella spp. from environmental samples in Gabon. Infect. Genet. Evol. 2015, 33, 299–303. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Wang, Y.; Peng, X.; Tang, Y.; Chu, T.; Zhou, W.; Chen, L.; Wan, C. Investigation of an Legionnaires’ disease outbreak associated with contaminated air-conditioning system. Chin. J. Epidemiol. 1998, 19, 200–204. (In Chinese) [Google Scholar]
- Deng, C.; Fang, X.; Wan, C.; Ren, H.; Qiu, Q.; Yang, X.; Zhang, S.; Wang, S.; Jiang, W. Investigation on an outbreak of Legionnaires’ disease caused by Lboz in a suburb of Beijing. Chin. J. Epidemiol. 2001, 22, 182–183. (In Chinese) [Google Scholar]
- Ning, Z.; Wang, B.; Liu, X.F.; Liu, X.J.; Teng, R.; Su, Y.; Zhang, Z.; Wu, J. Investigation of an Legionnaires’ disease outbreak. Chin. J. Public Health 2004, 20, 859. (In Chinese) [Google Scholar]
- De Zoysa, A.S.; Harrison, T.G. Molecular typing of Legionella pneumophila serogroup 1 by PFGE with SfiI and comparison of this method with restriction fragment-length polymorphism analysis. J. Med. Microbiol. 1999, 48, 269–278. [Google Scholar] [CrossRef] [PubMed]
- Thouverez, M.; Godard, C.; Leprat, R.; Talon, D. Is pulsed-field gel electrophoresis a valuable tool to identify nosocomial cases of Legionella pneumophila disease? J. Hosp. Infect. 2003, 55, 254–259. [Google Scholar] [CrossRef] [PubMed]
- Gaia, V.; Fry, N.K.; Afshar, B.; Luck, P.C.; Meugnier, H.; Etienne, J.; Peduzzi, R.; Harrison, T.G. Consensus sequence-based scheme for epidemiological typing of clinical and environmental isolates of Legionella pneumophila. J. Clin. Microbiol. 2005, 43, 2047–2052. [Google Scholar] [CrossRef] [PubMed]
- Ratzow, S.; Gaia, V.; Helbig, J.H.; Fry, N.K.; Luck, P.C. Addition of neuA, the gene encoding N-acylneuraminate cytidylyl transferase, increases the discriminatory ability of the consensus sequence-based scheme for typing Legionella pneumophila serogroup 1 strains. J. Clin. Microbiol. 2007, 45, 1965–1968. [Google Scholar] [CrossRef] [PubMed]
- Mahbubani, M.H.; Bej, A.K.; Miller, R.; Haff, L.; Di Cesare, J.; Atlas, R.M. Detection of Legionella with polymerase chain reaction and gene probe methods. Mol. Cell Probes 1990, 4, 175–187. [Google Scholar] [CrossRef]
- Diederen, B.M.; de Jong, C.M.; Kluytmans, J.A.; van der Zee, A.; Peeters, M.F. Detection and quantification of L. pneumophila DNA in serum: Case reports and review of the literature. J. Med. Microbiol. 2006, 55, 639–642. [Google Scholar] [CrossRef] [PubMed]
- Yáñez, M.A.; Carrasco-Serrano, C.; Barberá, V.M.; Catalán, V. Quantitative detection of L. pneumophila in water samples by immunomagnetic purification and real-time PCR amplification of the dotA gene. Appl. Environ. Microbiol. 2005, 71, 3433–3441. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; Ren, H.; Zhu, B.; Kan, B.; Xu, J.; Shao, Z. Optimization of pulsed-field gel electrophoresis for L. pneumophila subtyping. Appl. Environ. Microbiol. 2010, 76, 1334–1340. [Google Scholar] [CrossRef] [PubMed]
- Dice, L.R. Measures of the amount of ecological association between species. Ecology 1945, 26, 297–302. [Google Scholar] [CrossRef]
- Qin, T.; Yan, G.; Ren, H.; Zhou, H.; Wang, H.; Xu, Y.; Zhao, M.; Guan, H.; Li, M.; Shao, Z. High prevalence, genetic diversity and intracellular growth ability of Legionella in hot spring environments. PLoS ONE 2013, 8, e59018. [Google Scholar] [CrossRef] [PubMed]
- Sikora, A.; Wójtowicz-Bobin, M.; Kozioł-Montewka, M.; Magryś, A.; Gładysz, I. Prevalence of L. pneumophila in water distribution systems in hospitals and public buildings of the Lublin region of eastern Poland. Ann. Agric. Environ. Med. 2015, 22, 195–201. [Google Scholar] [CrossRef] [PubMed]
- Matuszewska, R.; Krogulska, B. Problem występowania pałeczek Legionella w instalacjach I urządzeniach wytwarzających aerosol wodno-powietrzny w obiektach służby zdrowia w Polsce. Nowa Med. 2009, 1, 56–60. (In Polish) [Google Scholar]
- Bartram, J.; Chartier, Y.; Lee, J.V.; Pond, K.; Surman-Lee, S. Legionella and Prevention of Legionellosis; World Health Organization: Geneva, Switzerland, 2007. [Google Scholar]
- Matuszewska, R.; Krogulska, B. Występowaniebakterii z rodzaju Legionella w systemach wodychłodniczej. Roczn. PZH 2008, 59, 445–454. (In Polish) [Google Scholar]
- Zhang, L.; Li, Y.; Zheng, W.; Ma, X. Sequence-based typing of L. pneumophila isolates from the public cooling tower water. Chin. J. Zoonoses 2013, 29, 262–266, 273. (In Chinese) [Google Scholar]
- Li, L.; Qin, T.; Li, Y.; Zhou, H.; Song, H.; Ren, H.; Li, L.; Li, Y.; Zhao, D. Prevalence and molecular characteristics of waterborne pathogen Legionella in industrial cooling tower environments. Int. J. Environ. Res. Public Health 2015, 12, 12605–12617. [Google Scholar] [CrossRef] [PubMed]
- Ren, H.; Tian, Z.; Zhou, H.; Guan, H.; Shao, Z.; Qin, T. Contamination and intracellular growth ability of Legionella in pipe water system in Shanghai Port. Chin. J. Zoonoses 2014, 30, 929–933. (In Chinese) [Google Scholar]
Name | Positions on Gene | Sequence (5’→3’) | Fragment Size (bp) | GenBank Accession Number of Reference Sequence |
---|---|---|---|---|
5SF | 618682–618701 | ACTATAGCGATTTGGAACCA | 104 | CP01760.1 |
5SR | 618785–618766 | GCGATGACCTACTTTCGCAT | CP01760.1 | |
5SProbe | 618737–618759 | HEX-CCGCGCCAATGATAGTGTGAGGC-BHQ | CP01760.1 | |
dotAF | 986–1004 | ATTGTCTCGCGCGATTGC | 81 | AF095231 |
dotAR | 1066–1043 | CCGGATCATTATTAACCATCACC | AF095231 | |
dotA probe | 1006–1027 | FAM-ATACAGCAAATGTATGTGACTT-MGB | AF095231 |
Water Type | No. of Tested Samples | No. of Positive Samples | Positive Amounts | |
---|---|---|---|---|
SW-H1 | 110 | 50 | 3 | 15.45% (17/110) |
SW-H2 | 60 | 14 | ||
CW-H1 | 30 | 10 | 0 | 13.33% (4/30) |
CW-H2 | 20 | 4 | ||
HW | 40 | 25 | 62.50% (25/40) | |
Total | 180 | 46 | 25.56% (46/180) |
Serogroup | Hotel Shower Water (n = 15) | Hospital Shower Water (n = 3) | Hot Springs Water (n = 30) | Cooling Tower Water (n = 4) | Total (n = 52) | |||||
---|---|---|---|---|---|---|---|---|---|---|
No. | Proportion (%) | No. | Proportion (%) | No. | Proportion (%) | No. | Proportion (%) | No. | Proportion (%) | |
LP1 | 3 | 20.00 | 3 | 100 | 11 | 36.67 | 0 | 0.00 | 17 | 32.69 |
LP2 | 1 | 6.67 | 0 | 0.00 | 5 | 16.67 | 0 | 0.00 | 6 | 11.54 |
LP3 | 1 | 6.67 | 0 | 0.00 | 12 | 40.00 | 2 | 50.00 | 15 | 28.85 |
LP5 | 3 | 20.00 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 3 | 5.77 |
LP6 | 5 | 33.33 | 0 | 0.00 | 0 | 0.00 | 1 | 25.00 | 6 | 11.54 |
LP7 | 1 | 6.67 | 0 | 0.00 | 0 | 0.00 | 1 | 25.00 | 2 | 3.85 |
LP12 | 1 | 6.67 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 | 1 | 1.92 |
LP13 | 0 | 0.00 | 0 | 0.00 | 2 | 6.67 | 0 | 0.00 | 2 | 3.85 |
Year | Source | ST | Serogroup | FlaA | PilE | Asd | Mip | Momps | ProA | NeuA | No. of Isolates |
---|---|---|---|---|---|---|---|---|---|---|---|
2015–2016 | HW | 1101 | LP1 | 6 | 6 | 15 | 3 | 9 | 14 | 11 | 1 |
2202 | LP1 | 2 | 10 | 17 | 14 | 21 | 14 | 8 | 3 | ||
2201 | LP1 | 17 | 6 | 15 | 3 | 9 | 14 | 11 | 1 | ||
2203 | LP1 | 6 | 6 | 15 | 3 | 9 | 4 | 3 | 3 | ||
2204 | LP1 | 6 | 6 | 15 | 3 | 4 | 4 | 13 | 3 | ||
2197 | LP2 | 3 | 5 | 1 | 7 | 14 | 11 | 8 | 1 | ||
2198 | LP2 | 6 | 10 | 15 | 7 | 17 | 4 | 3 | 1 | ||
2199 | LP2 | 7 | 5 | 1 | 7 | 14 | 32 | 8 | 1 | ||
2205 | LP2 | 17 | 10 | 15 | 7 | 17 | 14 | 11 | 1 | ||
87 | LP3 | 2 | 10 | 3 | 28 | 9 | 4 | 13 | 5 | ||
961 | LP3 | 2 | 10 | 3 | 28 | 9 | 14 | 11 | 3 | ||
1469 | LP3 | 2 | 6 | 17 | 3 | 9 | 11 | 11 | 3 | ||
2196 | LP2, LP3, LP13 | 6 | 6 | 15 | 3 | 4 | 14 | 11 | 4 | ||
CW | 9 | LP3 | 3 | 10 | 1 | 3 | 14 | 9 | 11 | 2 | |
1226 | LP7, LP6 | 7 | 10 | 17 | 28 | 13 | 11 | 3 | 2 | ||
SW-H1 | 1226 | LP1 | 7 | 10 | 17 | 28 | 13 | 11 | 3 | 3 | |
SW-H2 | 7 | LP1 | 1 | 4 | 3 | 1 | 1 | 1 | 6 | 3 | |
1230 | LP5 | 7 | 6 | 17 | 6 | 13 | 11 | 40 | 3 | ||
114 | LP6 | 3 | 6 | 1 | 6 | 14 | 11 | 9 | 1 | ||
1226 | LP2, LP3, LP6, LP7, LP12 | 7 | 10 | 17 | 28 | 13 | 11 | 3 | 8 | ||
2009–2014 | CW | ST1226 | LP6 | 7 | 10 | 17 | 28 | 13 | 11 | 3 | 5 |
ST1234 | LP6 | 1 | 6 | 17 | 28 | 13 | 11 | 3 | 1 | ||
ST1227 | LP7 | 11 | 14 | 16 | 19 | 15 | 13 | 3 | 1 | ||
ST1228 | Lp12, LP5 | 8 | 6 | 34 | 9 | 2 | 8 | 3 | 2 | ||
ST1229 | LP6 | 9 | 10 | 17 | 6 | 13 | 11 | 3 | 1 | ||
ST1146 | LP1 | 6 | 10 | 15 | 28 | 9 | 14 | 11 | 1 | ||
ST583 | LP6 | 7 | 6 | 17 | 28 | 13 | 11 | 3 | 1 | ||
ST1230 | LP5 | 7 | 6 | 17 | 6 | 13 | 11 | 40 | 2 | ||
ST1 | LP1 | 1 | 4 | 3 | 1 | 1 | 1 | 1 | 7 |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license ( http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, L.; Li, Y.; Wang, X.; Shangguan, Z.; Zhou, H.; Wu, Y.; Wang, L.; Ren, H.; Hu, Y.; Lin, M.; et al. High Prevalence and Genetic Polymorphisms of Legionella in Natural and Man-Made Aquatic Environments in Wenzhou, China. Int. J. Environ. Res. Public Health 2017, 14, 222. https://doi.org/10.3390/ijerph14030222
Zhang L, Li Y, Wang X, Shangguan Z, Zhou H, Wu Y, Wang L, Ren H, Hu Y, Lin M, et al. High Prevalence and Genetic Polymorphisms of Legionella in Natural and Man-Made Aquatic Environments in Wenzhou, China. International Journal of Environmental Research and Public Health. 2017; 14(3):222. https://doi.org/10.3390/ijerph14030222
Chicago/Turabian StyleZhang, Leyi, Yi Li, Xin Wang, Zhihui Shangguan, Haijian Zhou, Yuejin Wu, Lianghuai Wang, Hongyu Ren, Yun Hu, Meifen Lin, and et al. 2017. "High Prevalence and Genetic Polymorphisms of Legionella in Natural and Man-Made Aquatic Environments in Wenzhou, China" International Journal of Environmental Research and Public Health 14, no. 3: 222. https://doi.org/10.3390/ijerph14030222
APA StyleZhang, L., Li, Y., Wang, X., Shangguan, Z., Zhou, H., Wu, Y., Wang, L., Ren, H., Hu, Y., Lin, M., & Qin, T. (2017). High Prevalence and Genetic Polymorphisms of Legionella in Natural and Man-Made Aquatic Environments in Wenzhou, China. International Journal of Environmental Research and Public Health, 14(3), 222. https://doi.org/10.3390/ijerph14030222