Antioxidant Peptides from Miiuy Croaker Swim Bladders: Ameliorating Effect and Mechanism in NAFLD Cell Model through Regulation of Hypolipidemic and Antioxidant Capacity
Abstract
1. Introduction
2. Results
2.1. Hypolipidemic Capacity of FSGLR (S7) and GIEWA (S10) in OA-Induced NAFLD Cell Model
2.1.1. Effects of BPs (S1-S10) on Viability of HepG2 Cells
2.1.2. Effects of BPs (S1–S10) on Lipid Accumulation in OA-Induced NAFLD Cell Model
2.1.3. Effects of FSGLR (S7) and GIEWA (S10) on Hypolipidemic Activity
2.1.4. Effects of FSGLR (S7) and GIEWA (S10) on Expression Levels of Genes Involved in Lipid Metabolism in OA-Induced NAFLD Cell Model
2.2. Antioxidant Activity of FSGLR (S7) and GIEWA (S10) in OA-Induced NAFLD Cell Model
2.2.1. Effects of FSGLR (S7) and GIEWA (S10) on ROS Levels in OA-Induced NAFLD Cell Model
2.2.2. Effects of FSGLR (S7) and GIEWA (S10) on Antioxidant Activity in OA-Induced NAFLD Cell Model
2.3. Molecular Docking Analysis
3. Discussion
3.1. NAFLD and OA-Induced NAFLD Cell Model
3.2. Functions of FSGLR (S7) and GIEWA (S10) in Ameliorating Lipid Metabolism
3.3. Functions of FSGLR (S7) and GIEWA (S10) in Regulating Intracellular Antioxidant System
4. Materials and Methods
4.1. Materials and Chemical Reagents
4.2. HepG2 Cell Culture and Establishment of OA-Induced NAFLD Model of HepG2 Cells
4.3. Determination of Cell Viability, TC, TG, MDA, and Antioxidant Enzymes
4.4. Oil Red O Staining Assay
4.5. In Vitro Hypolipidemic Activity Analysis
4.6. Intracellular ROS Level Analysis
4.7. Molecular Docking
4.8. Preparation of Protein Extract of HepG2 Cells
4.9. Fluorescence Quantitative PCR Analysis
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lazarus, J.V.; Mark, H.E.; Anstee, Q.M.; Arab, J.P.; Batterham, R.L.; Castera, L.; Cortez-Pinto, H.; Crespo, J.; Cusi, K.; Dirac, M.A.; et al. Advancing the global public health agenda for NAFLD: A consensus statement. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 60–78. [Google Scholar] [CrossRef]
- Huang, D.Q.; EISerag, H.B.; Loomba, R. Global epidemiology of NAFLD-related HCC: Trends, predictions, risk factors and prevention. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 223–238. [Google Scholar] [CrossRef] [PubMed]
- Pouwels, S.; Sakran, N.; Graham, Y.; Leal, A.; Pintar, T.; Yang, W.; Kassir, R.; Singhal, R.; Mahawar, K.; Ramnarain, D. Non-alcoholic fatty liver disease (NAFLD): A review of pathophysiology, clinical management and effects of weight loss. BMC Endocr. Disord. 2022, 22, 63. [Google Scholar] [CrossRef]
- Liao, M.C.; Sun, C.Y.; Li, R.; Li, W.J.; Ge, Z.M.; Adu-Frimpong, M.; Xu, X.M.; Yu, J.N. Amelioration action of gastrodigenin rhamno-pyranoside from moringa seeds on non-alcoholic fatty liver disease. Food Chem. 2022, 379, 132087. [Google Scholar] [CrossRef] [PubMed]
- Paternostro, R.; Trauner, M. Current treatment of non-alcoholic fatty liver disease. J. Intern. Med. 2022, 292, 190–204. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Fernández-Galilea, M.; Martínez-Fernández, L.; González-Muniesa, P.; Pérez-Chávez, A.; Martínez, J.A.; Moreno-Aliaga, M.J. Oxidative stress and non-alcoholic fatty liver disease: Effects of omega-3 fatty acid supplementation. Nutrients 2019, 11, 872. [Google Scholar] [CrossRef] [PubMed]
- Vancells, L.P.; Viñas, E.E.; Sacanella, M.E. Overview of non-alcoholic fatty liver disease (NAFLD) and the role of sugary food consumption and other dietary components in its development. Nutrients 2021, 13, 1442. [Google Scholar] [CrossRef]
- Li, L.; Fu, J.Q.; Sun, J.; Liu, D.; Chen, C.J.; Wang, H.H.; Hou, Y.Y.; Xu, Y.Y.; Pi, J.B. Is Nrf2-ARE a potential target in NAFLD mitigation? Curr. Opin. Toxicol. 2019, 13, 35–44. [Google Scholar] [CrossRef]
- Li, W.; Alazawi, W. Non-alcoholic fatty liver disease. Clin. Med. 2020, 20, 509–512. [Google Scholar] [CrossRef]
- Silva, F.P.; Inada, A.C.; Ribeiro, F.M.; Granja, A.D.; Freitas, K.C.; Avellaneda, G.R.C.; Aragão do Nascimento, N.V.; Aiko, H.P. An overview of novel dietary supplements and food ingredients in patients with metabolic syndrome and non-alcoholic fatty liver disease. Molecules 2018, 23, 877. [Google Scholar] [CrossRef]
- Cao, C.W.; Xiao, Z.C.; Ge, C.R.; Wu, Y.L. Animal by-products collagen and derived peptide, as important components of innovative sustainable food systems-a comprehensive review. Crit. Rev. Food Sci. Nutr. 2022, 62, 8703–8727. [Google Scholar] [CrossRef]
- Sun, J.; Zhou, C.Y.; Cao, J.X.; He, J.; Sun, Y.Y.; Dang, Y.L.; Pan, D.D.; Xia, Q. Purification and characterization of novel antioxidative peptides from duck liver protein hydrolysate as well as their cytoprotection against oxidative stress in HepG2 cells. Front. Nutr. 2022, 9, 848289. [Google Scholar] [CrossRef]
- Ngoh, Y.Y.; Gan, C.Y. Enzyme-assisted extraction and identification of antioxidative and α-amylase inhibitory peptides from Pinto beans (Phaseolus vulgaris cv. Pinto). Food Chem. 2016, 190, 331–337. [Google Scholar] [CrossRef]
- Yang, X.R.; Qiu, Y.T.; Zhao, Y.Q.; Chi, C.F.; Wang, B. Purification and characterization of antioxidant peptides derived from protein hydrolysate of the marine bivalve mollusk Tergillarca granosa. Mar. Drugs 2019, 17, 251. [Google Scholar] [CrossRef]
- Suo, S.K.; Zhao, Y.Q.; Wang, Y.M.; Pan, X.Y.; Chi, C.F.; Wang, B. Seventeen novel angiotensin converting enzyme (ACE) inhibitory peptides from protein hydrolysate of Mytilus edulis: Isolation, identification, molecular docking study, and protective function on HUVECs. Food Funct. 2022, 13, 7831–7846. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.Y.; Zhao, Y.Q.; Wang, Y.M.; Yang, X.R.; Chi, C.F.; Wang, B. Gelatins and antioxidant peptides from Skipjack tuna (Katsuwonus pelamis) skins: Purification, characterization, and cytoprotection on ultraviolet-A injured human skin fibroblasts. Food Biosci. 2022, 50, 102138. [Google Scholar] [CrossRef]
- Guo, Q.Y.; Chen, P.F.; Chen, X.G. Bioactive peptides derived from fermented foods: Preparation and biological activities. J. Funct. Foods 2023, 101, 105422. [Google Scholar] [CrossRef]
- Mao, S.-Y.; Suo, S.-K.; Wang, Y.-M.; Chi, C.-F.; Wang, B. Systematical investigation on anti-Fatigue function and underlying mechanism of high Fischer ratio oligopeptides from Antarctic krill on exercise-induced fatigue in mice. Mar. Drugs 2024, 22, 322. [Google Scholar] [CrossRef] [PubMed]
- Sun, K.L.; Gao, M.; Wang, Y.Z.; Li, X.R.; Wang, P.; Wang, B. Antioxidant peptides from protein hydrolysate of marine red algae Eucheuma cottonii: Preparation, identification, and cytoprotective mechanisms on H2O2 oxidative damaged HUVECs. Front. Microbiol. 2022, 13, 791248. [Google Scholar] [CrossRef] [PubMed]
- Dong, X.M.; Suo, S.K.; Wang, Y.M.; Zeng, Y.H.; Chi, C.F.; Wang, B. High Fischer ratio oligopeptides from Antarctic krill: Ameliorating function and mechanism to alcoholic liver injury through regulating AMPK/Nrf2/IκBα pathways. J. Funct. Foods 2024, 122, 106537. [Google Scholar] [CrossRef]
- Lv, S.; Hu, B.; Ran, S.-Z.; Zhang, M.; Chi, C.-F.; Wang, B. Antioxidant Peptides from Hizikia fusiformis: A Study of the Preparation, Identification, Molecular Docking, and Cytoprotective Function of H2O2-Damaged A549 Cells by Regulating the Keap1/Nrf2 Pathway. Foods 2025, 14, 400. [Google Scholar] [CrossRef]
- Yan, W.-Z.; Wang, J.; Wang, Y.-M.; Zeng, Y.-H.; Chi, C.-F.; Wang, B. Optimization of the preparation process and ameliorative efficacy in osteoporotic rats of peptide–calcium chelates from Skipjack tuna (Katsuwonus pelamis) meat. Foods 2024, 13, 2778. [Google Scholar] [CrossRef]
- Qiao, Q.Q.; Luo, Q.B.; Suo, S.K.; Zhao, Y.Q.; Chi, C.F.; Wang, B. Preparation, characterization, and cytoprotective effects on HUVECs of fourteen novel angiotensin-I-converting enzyme inhibitory peptides from protein hydrolysate of tuna processing by-products. Front. Nutr. 2022, 9, 868671. [Google Scholar] [CrossRef] [PubMed]
- Sheng, Y.; Qiu, Y.T.; Wang, Y.M.; Chi, C.F.; Wang, B. Novel antioxidant collagen peptides of Siberian sturgeon (Acipenserbaerii) cartilages: The preparation, characterization, and cytoprotection of H2O2-damaged human umbilical vein endothelial cells (HUVECs). Mar Drugs. 2022, 20, 325. [Google Scholar] [CrossRef]
- Islam, M.S.; Wang, H.; Admassu, H.; Sulieman, A.A.; Wei, F.A. Health benefits of bioactive peptides produced from muscle proteins: Antioxidant, anti-cancer, and anti-diabetic activities. Process Biochem. 2022, 116, 116–125. [Google Scholar] [CrossRef]
- Chen, H.R.; Qi, X.F.; Guan, K.F.; Wang, R.C.; Li, Q.M.; Ma, Y. Tandem mass tag-based quantitative proteomics analysis reveals the effects of the α-lactalbumin peptides GINY and DQW on lipid deposition and oxidative stress in HepG2 cells. J. Dairy Sci. 2023, 106, 2271–2288. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.R.; Qi, X.F.; Guan, K.F.; Wang, R.C.; Li, Q.M.; Ma, Y. Peptides released from bovine α-lactalbumin by simulated digestion alleviated free fatty acids-induced lipid accumulation in HepG2 cells. J. Funct. Foods 2021, 85, 104618. [Google Scholar] [CrossRef]
- Jin, R.; Aweya, J.J.; Lin, R.; Weng, W.; Shang, J.; Wang, D.; Fan, Y.; Yang, S. The bioactive peptide VLATSGPG regulates the abnormal lipid accumulation and inflammation induced by free fatty acids in HepG2 cells via the PERK signaling pathway. J. Funct. Foods 2023, 104, 105515. [Google Scholar] [CrossRef]
- Marthandam, A.S.; Wang, T.; Su, W.T.; Lin, W.T. Short tetra-peptide from soy-protein hydrolysate attenuates hyperglycemia associated damages in H9c2 cells and ICR mice. J. Food Biochem. 2018, 42, e12638. [Google Scholar] [CrossRef]
- Wanezaki, S.; Saito, S.; Inoue, N.; Tachibana, N.; Shirouchi, B.; Sato, M.; Yanagita, T.; Nagao, K. Soy β-conglycinin peptide attenuates obesity and lipid abnormalities in obese model OLETF rats. J. Oleo. Sci. 2020, 69, 495–502. [Google Scholar] [CrossRef]
- Mijiti, M.; Mori, R.; Huang, B.; Tsukamoto, K.; Kiriyama, K.; Sutoh, K.; Nagaoka, S. Anti-obesity and hypocholesterolemic actions of protamine-derived peptide RPR (Arg-Pro-Arg) and protamine in high-fat diet-induced C57BL/6J Mice. Nutrients 2021, 13, 2501. [Google Scholar] [CrossRef]
- Ye, H.D.; Xu, Y.; Sun, Y.N.; Liu, B.Y.; Chen, B.B.; Liu, G.; Cao, Y.; Miao, J.Y. Purification, identification and hypolipidemic activities of three novel hypolipidemic peptides from tea protein. Food Res. Int. 2023, 165, 112450. [Google Scholar] [CrossRef]
- Kaewdang, O.; Benjakul, S. Effect of ethanolic extract of coconut husk on gel properties of gelatin from swim bladder of yellowfin tuna. LWT 2015, 62, 955–961. [Google Scholar] [CrossRef]
- Zhao, W.H.; Chi, C.F.; Zhao, Y.Q.; Wang, B. Preparation, physicochemical and antioxidant properties of acid- and pepsin-soluble collagens from the swim bladders of miiuy croaker (Miichthys miiuy). Mar Drugs 2018, 16, 161. [Google Scholar] [CrossRef]
- Kaewdang, O.; Benjakul, S.; Kaewmanee, T.; Kishimura, H. Characteristics of collagens from the swim bladders of yellowfin tuna (Thunnus albacares). Food Chem. 2014, 155, 264–270. [Google Scholar] [CrossRef]
- Pal, G.K.; Suresh, P.V. Physico-chemical characteristics and fibril-forming capacity of carp swim bladder collagens and exploration of their potential bioactive peptides by in silico approaches. Int. J. Biol. Macromol. 2017, 101, 304–313. [Google Scholar] [CrossRef] [PubMed]
- Hong, H.; Zheng, Y.Y.; Song, S.J.; Zhang, Y.Q.; Zhang, C.; Liu, J.; Luo, Y.K. Identification and characterization of DPP-IV inhibitory peptides from silver carp swim bladder hydrolysates. Food Biosci. 2020, 38, 100748. [Google Scholar] [CrossRef]
- Zhao, W.H.; Luo, Q.B.; Pan, X.; Chi, C.F.; Sun, K.L.; Wang, B. Preparation, identification, and activity evaluation of ten antioxidant peptides from protein hydrolysate of swim bladders of miiuy croaker (Miichthys miiuy). J. Funct. Foods 2018, 47, 503–511. [Google Scholar] [CrossRef]
- Sheng, Y.; Wang, W.Y.; Wu, M.F.; Wang, Y.M.; Zhu, W.Y.; Chi, C.F.; Wang, B. Eighteen novel bioactive peptides from Monkfish (Lophius litulon) swim bladders: Production, identification, antioxidant activity, and stability. Mar Drugs 2023, 21, 169. [Google Scholar] [CrossRef]
- Zhao, X.; Qian, Y.; Li, G.J.; Tan, J. Preventive effects of the polysaccharide of Larimichthys crocea swim bladder on carbon tetrachloride (CCl4)-induced hepatic damage. Chin. J. Nat. Med. 2015, 13, 521–528. [Google Scholar] [CrossRef]
- Pan, Y.X.; Wang, P.P.; Zhang, F.M.; Yu, Y.L.; Zhang, X.; Lin, L.; Linhardt, R.J. Glycosaminoglycans from fish swim bladder: Isolation, structural characterization and bioactive potential. Glycoconj. J. 2018, 35, 87–94. [Google Scholar] [CrossRef]
- Chen, J.; Zhou, S.Y.; Wang, Z.; Liu, S.C.; Li, R.; Jia, X.J.; Chen, J.P.; Liu, X.F.; Song, B.B.; Zhong, S.Y. Anticoagulant and anti-inflammatory effects of a degraded sulfate glycosaminoglycan from swimming bladder. Food Res Int. 2022, 157, 111444. [Google Scholar] [CrossRef]
- FAO. The State of World Fisheries and Aquaculture 2022. 2022. Available online: https://www.fao.org/3/cc0461en/online/sofia/2022/capture-fisheries-production.html (accessed on 16 August 2024).
- Cai, S.Y.; Wang, Y.M.; Zhao, Y.Q.; Chi, C.F.; Wang, B. Cytoprotective effect of antioxidant pentapeptides from the protein hydrolysate of swim bladders of miiuy croaker (Miichthys miiuy) against H2O2-mediated human umbilical vein endothelial cell (HUVEC) injury. Int. J. Mol. Sci. 2019, 20, 5425. [Google Scholar] [CrossRef]
- Kumar, A.; Chauhan, S. Pancreatic lipase inhibitors: The road voyaged and successes. Life Sci. 2021, 271, 119115. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.Q.; Ren, X.R.; Geng, J.; Chen, S.C.; Wang, Q.L.; Liu, C.Q.; Xiao, J.H.; Huang, D.W. Identification, characterization and hypolipidemic effect of novel peptides in protein hydrolysate from Protaetia brevitarsis larvae. Food Res. Int. 2024, 176, 113813. [Google Scholar] [CrossRef]
- Jiang, Z.Y.; Lu, M.C.; Xu, L.L.; Yang, T.T.; Xi, M.Y.; Xu, X.L.; Guo, X.K.; Zhang, X.J.; You, Q.D.; Sun, H.P. Discovery of potent Keap1-Nrf2 protein-protein interaction inhibitor based on molecular binding determinants analysis. J. Med. Chem. 2014, 57, 2736–2745. [Google Scholar] [CrossRef] [PubMed]
- Vellur, S.; Pavadai, P.; Babkiewicz, E.; Ram Kumar Pandian, S.; Maszczyk, P.; Kunjiappan, S. An In Silico Molecular Modelling-Based Prediction of Potential Keap1 Inhibitors from Hemidesmus indicus (L.) R.Br. against Oxidative-Stress-Induced Diseases. Molecules 2023, 28, 4541. [Google Scholar] [CrossRef]
- Thanapirom, K.; Tsochatziscorresponding, E.A. Non-alcoholic fatty liver disease (NAFLD) and the quest for effective treatments. Hepatobiliary Surg. Nutr. 2019, 8, 77–79. [Google Scholar] [CrossRef]
- Day, C.P.; James, O.F. Steatohepatitis: A tale of two “hits”? Gastroenterology 1998, 114, 842–845. [Google Scholar] [CrossRef]
- Ipsen, D.H.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell. Mol. Life Sci. 2018, 75, 3313–3327. [Google Scholar] [CrossRef]
- Badmus, O.O.; Hillhouse, S.A.; Anderson, C.D.; Hinds, T.D.; Stec, D.E. Molecular mechanisms of metabolic associated fatty liver disease (MAFLD): Functional analysis of lipid metabolism pathways. Clin. Sci. 2022, 136, 1347–1366. [Google Scholar] [CrossRef]
- Heeren, J.; Scheja, L. Metabolic-associated fatty liver disease and lipoprotein metabolism. Mol. Metab. 2021, 50, 101238. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.T.; Duan, Q.H.; Wu, R.X.; Harris, E.; Su, Q.Z. Pathophysiological communication between hepatocytes and non-parenchymal cells in liver injury from NAFLD to liver fibrosis. Adv. Drug Deliv. Rev. 2021, 176, 113869. [Google Scholar] [CrossRef]
- Donato, M.T.; Tolosa, L.; Gómez-Lechón, M.J. Culture and functional characterization of human hepatoma HepG2 cells. Methods Mol. Biol. 2015, 1250, 77–93. [Google Scholar] [PubMed]
- Miey, P.; Jeong, H.Y.; You, S.L.; Hae, J.L. Lonicera caerulea extract attenuates non-alcoholic fatty liver disease in free fatty acid-induced HepG2 hepatocytes and in high fat diet-fed mice. Nutrients 2019, 11, 494. [Google Scholar] [CrossRef]
- Li, J.D.; Wang, T.Q.; Liu, P.P.; Yang, F.Y.; Wang, X.D.; Zheng, W.L.; Sun, W.L. Hesperetin ameliorates hepatic oxidative stress and inflammation via the PI3K/AKT-Nrf2-ARE pathway in oleic acid-induced HepG2 cells and a rat model of high-fat diet-induced NAFLD. Food Funct. 2021, 2, 3898–3918. [Google Scholar] [CrossRef]
- Wang, Y.M.; Pan, X.; He, Y.; Chi, C.F.; Wang, B. Hypolipidemic activities of two pentapeptides (VIAPW and IRWWW) from miiuy croaker (Miichthys miiuy) muscle on lipid accumulation in HepG2 cells through regulation of AMPK pathway. Appl. Sci. 2020, 10, 817. [Google Scholar] [CrossRef]
- Shi, W.; Hou, T.; Guo, D.J.; He, H. Evaluation of hypolipidemic peptide (Val-Phe-Val-Arg-Asn) virtual screened from chickpea peptides by pharmacophore model in high-fat diet-induced obese rat. J. Funct. Foods 2019, 54, 136–145. [Google Scholar] [CrossRef]
- Shi, W.; Hou, T.; Liu, W.; Guo, D.J.; He, H. The hypolipidemic effects of peptides prepared from cicer arietinum in ovariectomized rats and HepG2 cells. J. Sci. Food Agric. 2019, 99, 576–586. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Pan, X.; Chi, C.F.; Sun, K.L.; Wang, B. Ten new pentapeptides from protein hydrolysate of miiuy croaker (Miichthys miiuy) muscle: Preparation, identification, and antioxidant activity evaluation. LWT 2019, 105, 1–8. [Google Scholar] [CrossRef]
- Deng, X.J.; Hou, Y.; Zhou, H.J.; Li, Y.; Xue, Z.Q.; Xue, X.T.; Huang, G.; Huang, K.L.; He, X.Y.; Xu, W.T. Hypolipidemic, anti-inflammatory, and anti-atherosclerotic effects of tea before and after microbial fermentation. Food Sci. Nutr. 2021, 9, 1160–1170. [Google Scholar] [CrossRef]
- Ao, N.; Yang, J.; Wang, X.C.; Du, J. Glucagon-like peptide-1 preserves non-alcoholic fatty liver disease through inhibition of the endoplasmic reticulum stress associated pathway. Hepatol. Res. 2016, 46, 343–353. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zhou, F.; Jiang, H.; Wang, Z.; Hua, C.; Zhang, Y. Chicory (Cichorium intybus L.) polysaccharides attenuate high-fat diet induced non-alcoholic fatty liver disease via AMPK activation. Int. J. Biol. Macromol. 2018, 118, 886–895. [Google Scholar] [CrossRef]
- Liu, X.; Hao, J.J.; Zhang, L.J.; Zhao, X.; He, X.X.; Li, M.M.; Zhao, X.L.; Wu, J.D.; Qiu, P.J.; Yu, G.L. Activated AMPK explains hypolipidemic effects of sulfated low molecular weight guluronate on HepG2 cells. Eur. J. Med. Chem. 2014, 85, 304–310. [Google Scholar] [CrossRef]
- He, A.Y.; Chen, X.W.; Tan, M.; Chen, Y.L.; Lu, D.L.; Zhang, X.Y.; Dean, J.M.; Razani, B.; Lodhi, I.J. Acetyl-CoA derived from hepatic peroxisomal β-oxidation inhibits autophagy and promotes steatosis via mTORC1 activation. Mol. Cell. 2020, 79, 30–42. [Google Scholar] [CrossRef]
- Wan, P.; Chen, D.K.; Chen, H.; Zhu, X.; Chen, X.L.; Sun, H.L.; Pan, J.Y.; Cai, B. Hypolipidemic effects of protein hydrolysates from Trachinotus ovatus and identification of peptides implied in bile acid-binding activity using LC-ESI-Q-TOF-MS/MS. RSC Adv. 2020, 10, 20098–20109. [Google Scholar] [CrossRef]
- Hong, T.; Chen, Y.Y.; Li, X.Y.; Lu, Y. The role and mechanism of oxidative stress and nuclear receptors in the development of NAFLD. Oxid. Med. Cell. Longev. 2021, 2021, 6889533. [Google Scholar] [CrossRef]
- Wang, W.Y.; Zhao, Y.Q.; Zhao, G.X.; Chi, C.F.; Wang, B. Antioxidant peptides from collagen hydrolysate of redlip croaker (Pseudosciaena polyactis) scales: Preparation, characterization, and cytoprotective effects on H2O2-damaged HepG2 cells. Mar. Drugs 2020, 18, 156. [Google Scholar] [CrossRef]
- Wang, Y.Z.; Zhao, Y.Q.; Wang, Y.M.; Zhao, W.H.; Wang, P.; Chi, C.F.; Wang, B. Antioxidant peptides from Antarctic Krill (Euphausia superba) hydrolysate: Preparation, identification and cytoprotection on H2O2-induced oxidative stress. J. Funct. Foods 2021, 86, 104701. [Google Scholar] [CrossRef]
- Ren, X.Y.; Miao, B.T.; Cao, H.J.; Tian, X.X.; Shen, L.J.; Yang, Z.S.; Yuan, F.L.; Ding, Y.P. Monkfish (Lophius litulon) peptides ameliorate high-fat-diet-induced nephrotoxicity by reducing oxidative stress and inflammation via regulation of intestinal flora. Molecules 2022, 28, 245. [Google Scholar] [CrossRef]
- Ye, J.N.; Tian, X.X.; Wang, Q.F.; Zheng, J.W.; Yang, Y.Z.; Xu, B.G.; Zhang, S.; Yuan, F.L.; Yang, Z.S. Monkfish peptides mitigate high fat diet-induced hepatic steatosis in mice. Mar. Drugs 2022, 20, 312. [Google Scholar] [CrossRef]
- Zheng, S.L.; Wang, Y.Z.; Zhao, Y.Q.; Chi, C.F.; Zhu, W.Y.; Wang, B. High Fischer ratio oligopeptides from hard-shelled mussel: Preparation and hepatoprotective effect against acetaminophen-induced liver injury in mice. Food Biosci. 2023, 53, 102638. [Google Scholar] [CrossRef]
- Liang, C.; Li, Y.; Bai, M.; Huang, Y.X.; Yang, H.; Liu, L.; Wang, S.Y.; Yu, C.L.; Song, Z.B. Hypericin attenuates nonalcoholic fatty liver disease and abnormal lipid metabolism via the PKA-mediated AMPK signaling pathway in vitro and in vivo. Pharmacol. Res. 2020, 153, 104657. [Google Scholar] [CrossRef] [PubMed]
- Yao, Z.C.; Song, S.M.; Li, X.L.; Wang, W.T.; Ren, P.; Wang, H.Y.; Xie, Y.; Li, Z.N. Corn peptides ameliorate nonalcoholic fatty liver disease by suppressing endoplasmic reticulum stress via the AMPKα/Sirt1 pathway in vivo and in vitro. J. Funct. Foods 2022, 93, 105063. [Google Scholar] [CrossRef]
- Wang, L.; Li, M.; Yu, B.T.; Shi, S.J.; Liu, J.Y.; Zhang, R.Y.; Ayada, I.; Verstegen, M.M.A.; van der Laan, L.J.W.; Peppelenbosch, M.P.; et al. Recapitulating lipid accumulation and related metabolic dysregulation in human liver-derived organoids. J. Mol. Med. 2022, 100, 471–484. [Google Scholar] [CrossRef]
- Hu, X.M.; Wang, Y.M.; Zhao, Y.Q.; Chi, C.F.; Wang, B. Antioxidant peptides from the protein hydrolysate of monkfish (Lophius litulon) muscle: Purification, identification, and cytoprotective function on HepG2 cells damage by H2O2. Mar. Drugs 2020, 18, 153. [Google Scholar] [CrossRef]
- Cai, S.B.; Wang, O.; Wang, M.Q.; He, J.F.; Wang, Y.; Zhang, D.; Zhou, F.; Ji, B.Q. In vitro inhibitory effect on pancreatic lipase activity of subfractions from ethanol extracts of fermented Oats (Avena sativa L.) and synergistic effect of three phenolic acids. J. Agric. Food Chem. 2012, 60, 7245–7251. [Google Scholar] [CrossRef] [PubMed]
- Jafar, S.; Kamal, H.; Mudgil, P.; Hassan, H.M.; Maqsood, S. Camel whey protein hydrolysates displayed enhanced cholesteryl esterase and lipase inhibitory, anti-hypertensive and anti-haemolytic properties. LWT 2018, 98, 212–218. [Google Scholar] [CrossRef]
- Lin, Q.; Song, S.; Pei, J.; Zhang, L.; Chen, X.; Jin, H. Preparation and characterization of cysteine-rich collagen peptide and its antagonistic effect on microplastic induced damage to HK-2 cells. Food Biosci. 2024, 61, 104647. [Google Scholar] [CrossRef]
Ligand | Binding Energy with 1LPB (kcal/mol) | Hydrogen Bonds | Hydrophobic Interactions | Binding Energy with 1F6W (kcal/mol) | Hydrogen Bonds | Hydrophobic Interactions |
---|---|---|---|---|---|---|
S7 (FSGLR) | −7.3 | Ser152, Phe77, Asp79, Ala259 | Phe215, Tyr114, Pro180, Ile78 | −8.4 | Gln230, Lys231, Ser225, Trp236, Leu282, Trp227, Ile229 | Tyr526, Leu527, Ile353 |
S10 (GIEWA) | −7.1 | Asn384, Lys367, Asp328, Asp387, Glu385, Arg337 | Pro235, Tyr369, Met234 | −8.5 | Phe351, ys231, Leu224 | Pro300, Ile229, Leu527, Val391, Trp522 |
Orlistat | −7.0 | Gly76, His151, Phe77, His263 | Trp252, Arg256, Leu264, Ile78, Phe215, Ile209 | −6.4 | Lys231 | Tyr526, Trp522, Pro226, Ile399, Val391, Leu527, Ile301 |
Ligand | Binding energy with 2FLU (kcal/mol) | Hydrogen Bonds | Hydrophobic Interactions |
---|---|---|---|
S7 (FSGLR) | −9.5 | Ile559, Ile416, Leu365, Val512, Val465, Val418, Val561, Val608, Val514 | Ala556, Ala466, Val467, Arg415 |
S10 (GIEWA) | −8.6 | Gly367, Val561, Val606, Val418, Val465, Val467 | Cys368, Ala607, Val514, Val369 |
Primer | Sequence (5′−3′) |
---|---|
ACC-F | TGATGTCAATCTCCCCGCAGC |
ACC-R | TTGCTTCTTCTCTGTTTTCTCCCC |
SREBP-1c-F | CCATGGATGCACTTTCGAA |
SREBP-1c-R | CCAGCATAGGGTGGGTCAA |
SREBP-2-F | CTGCAACAACAGACGGTAATGA |
SREBP-2-R | CCATTGGCCGTTTGTGTCAG |
FAS-F | CGGTACGCGACGGCTGCCTG |
FAS-R | GCTGCTCCACGAACTCAAACACCG |
HMGR-F | GGACCCCTTTGCTTAGATGAAA |
HMGR-R | CCACCAAGACCTATTGCTCTG |
CPT1-F | CGTCTTTTGGGATCCACGATT |
CPT1-R | TGTGCTGGATGGTGTCTGTCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.-M.; Ge, M.-X.; Ran, S.-Z.; Pan, X.; Chi, C.-F.; Wang, B. Antioxidant Peptides from Miiuy Croaker Swim Bladders: Ameliorating Effect and Mechanism in NAFLD Cell Model through Regulation of Hypolipidemic and Antioxidant Capacity. Mar. Drugs 2025, 23, 63. https://doi.org/10.3390/md23020063
Wang Y-M, Ge M-X, Ran S-Z, Pan X, Chi C-F, Wang B. Antioxidant Peptides from Miiuy Croaker Swim Bladders: Ameliorating Effect and Mechanism in NAFLD Cell Model through Regulation of Hypolipidemic and Antioxidant Capacity. Marine Drugs. 2025; 23(2):63. https://doi.org/10.3390/md23020063
Chicago/Turabian StyleWang, Yu-Mei, Ming-Xue Ge, Su-Zhen Ran, Xin Pan, Chang-Feng Chi, and Bin Wang. 2025. "Antioxidant Peptides from Miiuy Croaker Swim Bladders: Ameliorating Effect and Mechanism in NAFLD Cell Model through Regulation of Hypolipidemic and Antioxidant Capacity" Marine Drugs 23, no. 2: 63. https://doi.org/10.3390/md23020063
APA StyleWang, Y.-M., Ge, M.-X., Ran, S.-Z., Pan, X., Chi, C.-F., & Wang, B. (2025). Antioxidant Peptides from Miiuy Croaker Swim Bladders: Ameliorating Effect and Mechanism in NAFLD Cell Model through Regulation of Hypolipidemic and Antioxidant Capacity. Marine Drugs, 23(2), 63. https://doi.org/10.3390/md23020063