Inhibition of Retinoblastoma Cell Growth by Boswellic Acid Through Activation of the Suppressing Nuclear Factor—κB Activation

Abstract

Background and Objectives: Despite the development of treatment methods and the emergence of alternative new approaches in recent years, the visual prognosis of retinoblastoma contains deficiencies and this situation increases the need for the development of new treatment approaches. The cytotoxic and apoptosis-inducing effects of the combination of boswellic acid (BA), which has been determined to have significant potential in preclinical and clinical studies of various diseases, and Cisplatin (Cis), a potent chemotherapy agent, were investigated on the human retinoblastoma cell line (Y79). Materials and Methods: The cytotoxic effect of BA and Cis on Y79 cells was determined by the water soluble tetrazolium-1 (WST-1) test, the apoptotic rate of the cells was determined by annexin V staining, and the gene expressions of Protein53 (p53), Caspase-3 and Nuclear factor kappa B (NF-κB), which play an important role in apoptosis, were determined by RT-qPCR analysis. Interleukin 1-beta (IL1-β), tumor necrosis factor-α (TNF-α) and interferon γ (IFN-γ) levels were analyzed in cell lysates obtained from the experimental groups. Results: The combination of BA and Cis selectively inhibited the growth of Y79 cells and modulated NF-κB signaling, potentially through post-translational regulatory mechanisms. Moreover, it induced apoptosis by increasing p53 and Caspase-3 expressions, confirming its pro-apoptotic effects. Additionally, the combination treatment was associated with a reduction in inflammatory cytokine levels (TNF-α, IL1-β), suggesting a potential regulatory effect on inflammation-related pathways rather than direct inhibition of NF-κB activation. Conclusions: These findings suggest that BA combined with Cis inhibits Y79 retinoblastoma cell growth by inducing apoptosis and modulating NF-κB signaling. While NF-κB mRNA levels increased, reduced inflammatory cytokines and enhanced apoptosis suggest potential post-translational regulation. Further studies are needed to confirm NF-κB protein-level effects and in vivo efficacy.

1. Introduction

Retinoblastoma is the most common intraocular tumor of childhood. It develops from the inner layer of the eye (retina), where the optic nerves are located, and usually grows into the eyeball. Patients are diagnosed on average around the age of two. Approximately 80% of children are diagnosed before the age of three. As can be understood, retinoblastoma is usually a disease of young children. However, there is a risk of tumor development up to the age of six or seven [1,2]. The main goal of retinoblastoma treatment is to protect the patient’s life and then to save the eye and visual function. The treatment methods used today are approaching this goal, but they bring with them significant side effects and heavy costs to the patient and the healthcare system. Therefore, alternative treatment searches continue.

In recent years, natural products have been shown to have effective results against retinoblastoma, either in combination with standard drugs or alone [3,4]. Current treatment options for retinoblastoma are radiotherapy, chemotherapy, thermotherapy and brachytherapy [5]. Many complications arise due to traditional treatments. Secondary cancers caused by traditional treatments also occur in younger people [6]. The importance of plant-derived natural products in cancer treatment cannot be ignored. Many drugs used in current treatment such as Paclitaxel, camptothecin, etoposide, vinblastine and vincristine are plant-derived natural products [7]. Effective results of the combination of plant-derived agents and Cisplatin have been reported in many cancer treatments. Boswellic acid, which contains many triterpenes, has been shown to have apoptotic, cytostatic and antiproliferative activities against different cancers both in vivo and in vitro [8,9]. It has also been reported that BA can increase apoptosis together with chemotherapeutic agents. It has been reported to prevent invasive cancers as a result of inhibition of NF-κB-regulated gene expression [10]. Moreover, it prevents mitochondrial apoptosis by activating activated Caspase-8 to Caspase-3 [11].

NF-κB is an important transcription factor in cells and has an important role in the immune system through various cellular responses [12]. Research confirms that inflammation is closely related to the formation and development of cancers, and NF-κB, a key molecule linking chronic inflammation to cancer [13], is an important subject of antitumor studies.

In this study, we investigate the impact of BA and its combination with Cis on Y79 retinoblastoma cells, focusing on cell viability, apoptosis induction, NF-κB modulation, and inflammatory cytokine levels. Our findings aim to provide insights into the therapeutic potential of BA in retinoblastoma management and contribute to the development of alternative treatment strategies.

2. Material and Methods

2.1. Cell Culture

Human retinoblastoma cell line Y79 was obtained from American Type Culture Collection (ATCC^® HTB-18^TM, Manassas, VA, USA). Y79 was used to determine the effects of boswellic acid and Cisplatin on inflammation, oxidative stress and apoptosis in retinoblastoma cancer. The Y79 cell line was commercially obtained (ATCC) and the medium used for the propagation of its cells was prepared to contain 10% (v/v) Fetal bovine serum (Gibco, ThermoFisher, Waltham, MA, USA), 100 µg/mL streptomycin (Invitrogen, ThermoFisher, USA) and RPMI-1640 (Sigma-Aldrich, Merck, St. Louis, MO, USA). After the applications to the cells, all incubations were carried out in a sterile environment with 5% CO₂ and 37 °C incubator that maintained the balance.

2.2. Determination of Boswellic Acid and Cisplatin Concentration

Acetyl-11-Keto-Beta-Boswellic Acid (Santa Cruz, CA, USA) and CISPLATIN DBL (Hospira Australia Pty Ltd., Mulgrave-Victoria, Australia) were obtained commercially. Optimization experiments were performed for BA and Cis concentrations of 0.5 μM, 1 μM, 2 μM, 5 μM, 10 μM, 25 μM, 50 μM, 75 μM and 100 μM and the lethal dose of BA and Cis on human retinoblastoma cancer cells were determined. A total of 5 mg of BA in the stock was dissolved in DMSO and then divided into aliquots by adding distilled water. To determine the concentration, WST-1 assay was performed to determine the lethal dose of BA and Cis on human retinoblastoma cancer cells. WST-1 test was performed to determine half maximal inhibitory concentration (IC₅₀) doses.

2.3. WST-1 Assay

In order to determine cell proliferation, 0.5 μM, 1 μM, 2 μM, 5 μM, 10 μM, 25 μM, 50 μM, 75 μM and 100 μM BA and Cis concentrations were added to Y79 cancer cells and incubated for 24, 48 and 72 h with 3 repetitions for each ratio. Then, WST-1 test was applied. Cells grown in 96-well culture dishes were completely removed from the culture medium to perform WST-1 assay and incubated with 10% WST-1 reagent in the dark for 4 h. After this incubation period, a 540 nM measurement was performed on a 96-well culture dish spectrophotometer (Biotek, EL_X800, SpectraLab, Lathamn, NY, USA) [14].

2.4. Apoptotic Staining

Tali™ Apoptosis Kit - Annexin V Alexa Fluor™ 488 & Propidium Iodide (Invitrogen™, ThermoFisfer, USA) was used for apoptosis determination. In this method, cells were stained using Annexin V AlexaFluor^® 488 and propidiumiodide. Apoptotic cells are green, dead cells are red, and live cells show little or no fluorescence. Application was made with the 48 h doses (BA (IC₅₀), Cis (IC₅₀) and BA (IC₅₀)+Cis (IC₅₀)) determined in the previous step and centrifugation was performed. Then, 200 µL of 1X Annexin binding buffer was added to the cells collected at the bottom of the tube. Next, 5 µL of Annexin V AlexaFluor^® 488 (Component A) was added to 100 µL of the mixture and kept in the dark for 20 min. Centrifugation was performed again and 100 µL of 1X Annexin binding buffer was added to the cells that settled at the bottom and vortexed. Then, 1 μL of Tali^® PropidiumIodide (PI, component B) solution was added to the final mixture and incubated in the dark for 5 min. Then, 25 μL of the mixture was taken and dropped onto special slides prepared for Tali and reading was performed with the analysis program. This was photographed using the Thermo EVOS^® FL ImagingSystem using brightfield mode and fluorescence mode, using a DAPI filter at 20x objective magnification.

2.5. Inflammatory Cytokines Levels

To determine the anti-inflammatory effect of BA (IC₅₀), Cis (IC₅₀) and BA (IC₅₀)+Cis (IC₅₀) in Y79 cells for 48 h, TNF-α (Invitrogen, Cat #13-7341-81), IL1-β (Invitrogen, Cat #PA1-84913) and IFN-γ (Invitrogen, Cat #14-7311-81) levels were determined in cell lysates using a multiplate reader device at 540 nm using specific commercial kits (ThermoFisher, USA ). The obtained data were divided by the total protein concentrations of the samples. Thus, normalized cytokine levels were expressed as ng/mg-protein or pg/mg-protein.

2.6. Total RNA Isolation and cDNA Synthesis

In order to detect changes in gene expression of cultured cells as a result of BA (IC₅₀), Cis (IC₅₀) and BA (IC₅₀)+Cis (IC₅₀) treatment for 48 h, RNAs of cancer cells were purified with RNA isolation kit (ThermoFisher, USA). After isolation, RNA concentration was measured with a spectrophotometer and converted to cDNA with cDNA synthesis kit (Life Technologies, ThermoFisher, USA) as 1 μg total RNA. Amplification of target genes was performed with SYBR green dye in a LightCycler 480-II (ThermoFisher, USA ) real-time quantitative PCR device. Target gene and appropriately selected reference genes were amplified in the same panel. PCR conditions were applied as 10 min incubation at 95 °C, followed by 45 cycles of 15 s denaturation at 95 °C, 1 min annealing and extension at 60 °C. The Ct values of the peaks obtained during the amplification process were used to determine gene expressions and gene expressions were calculated with the 2^−∆∆Ct method. The primers used to investigate changes in the expression of these genes are given below in 5′-3′ order.

• NF-κB: F: GCG CAT CCA GAC CAA CAA TAA C, R: GCC GAA GCT GCA TGG ACA CT
• p53: F: CACGAGCGCTGCTCAGATAGC, R: ACAGGCACAAACACGCACAAA
• Caspase-3: F: GGTATTGAGACAGACAGTGG, R: CATGGGATCTGTTTCTTTGC
• β-Actin: F: CCTCTGAACCCTAAGGCCAAC, R: TGCCACAGGATTCCATACCC

2.7. Gene Ontologies (GO)

Three types of gene ontologies (GOs) were performed on possible target genes: cellular component, biological process and molecular function. The STRİNG program was used to evaluate these data. The rationale behind performing GO analysis in our study was to comprehensively characterize the biological processes, molecular functions and cellular components associated with the differentially expressed genes upon boswellic acid treatment in retinoblastoma cells. By conducting GO analysis, we aimed to identify key biological pathways, understand the functional relevance of differentially expressed genes and strengthen data interpretation. Instead of focusing solely on individual genes, GO analysis allows us to identify broader biological trends, helping to elucidate the molecular mechanisms underlying boswellic acid’s inhibitory effects, particularly in relation to NF-κB suppression. This approach provides an unbiased validation of our findings by linking gene expression changes to known tumor-suppressive or apoptotic pathways.

2.8. Statistical Analysis

The raw data compiled as a result of laboratory analyses were defined as mean ± standard deviation. SPSS 20.0 software was preferred for statistical evaluations. In statistical evaluation, whether there was a statistical difference in parameters showing normal distribution was determined with the ANOVA test. Whether there was a statistical difference between groups in parameters not showing normal distribution was determined with the Kruskal–Wallis test. The groups between which the difference occurred were determined with the Mann–Whitney U test. Expression levels of genes showing statistical differences were indicated with (*) in the graphs.

3. Results

3.1. WST-1 Analysis Findings

To determine the cytotoxicity of boswellic acid and Cisplatin in Y79 cells, eight different doses ranging from 0.5 to 100 μM were used. It was seen that the cytotoxicity of BA and Cis increased at doses of 0.5 μM and higher. It was determined that they might have high cytotoxicity at doses of 2 μM and above. Figure 1, prepared based on WST-1 analysis data, shows that BA and Cis decreased cell viability in a dose-dependent manner. The obtained data were evaluated by probit analysis, and the acute mean toxic dose (IC₅₀) of BA in Y79 cells was determined as 2.82 μM after 24 h exposure, as 2.06 μM for 48 h and as 1.84 μM for 72 h. The IC₅₀ dose of Cis was determined as 2.96 μM for 24 h, 2.16 μM for 48 h and 1.48 μM for 72 h (Figure 1).

These results suggest that both Cisplatin and boswellic acid exhibit cytotoxic effects on Y79 cells, with increasing potency over time.

3.2. Inflammatory Cytokines Levels Findings

When the effects of Cis on inflammation in Y79 cells were examined, it was seen that the changes in TNF-α, IL1-β and IFN-γ levels were significant when compared to the control group. The highest decrease occurred in IL1-β in the Cis group. When the BA group was compared with the control group, there was no significant difference in terms of the effect on inflammation in the cells. When the control group was compared with the BA+Cis group, the decrease in TNF-α and IL1-β levels was significant (p < 0.05), while the decrease in IFN-γ was not significant (p > 0.05) (Figure 2).

3.3. Annexin V Apoptotic Staining Findings

The findings show that BA can increase the therapeutic effect when combined with chemotherapy drugs used in many cancer treatments. It has been shown that BA can exhibit a synergistic effect with Cis and can also play a preventive role against Cis toxicity (Figure 3).

Overall, the results suggest that boswellic acid enhances apoptosis in retinoblastoma cells, both alone and in combination with Cisplatin, supporting its potential as an anticancer agent.

3.4. RT-PCR Findings

Treatment of Y79 cells with BA and Cis resulted in an increase in NF-κB, p53 and Caspase-3 gene expression. The effects of BA and Cis on apoptosis (p53 and Caspase-3) and proliferation (NF-κB) in Y79 cells were determined by comparing the mRNA expression levels of each group of analyzed genes with the control group. When BA+Cis was applied to Y79 cells at an IC₅₀ dose for 48 h, it was seen that apoptotic p53 and Caspase-3 gene expressions were stimulated at a statistically significant level compared to the control group (Figure 4). When BA+Cis was applied to Y79 cells at an IC₅₀ dose for 48 h, it was determined that the expression levels of NF-κB gene showed statistically significant differences compared to the control group (Figure 4). Among the apoptotic genes, the highest effect of p53 and Caspase-3 was observed only in the Cis-applied group, while the highest effect of NF-κB was observed in the Cis-applied group.

Overall, these results suggest that boswellic acid enhances the apoptotic markers (p53 and Caspase-3) while modulating NF-κB expression, potentially contributing to its anticancer effects when combined with Cisplatin.

3.5. Enrichment Analysis

Analysis findings show only important functions (Figure 5 and Figure 6). Target genes were found to be involved in various cellular components in the biological process category, such as I-κB kinase/NF-κB signaling, NF-κB-inducing kinase signaling, etc. (Figure 6). In terms of cellular components, there was the NF-κB complex, I-κB/NF-κB complex, intracellular protein-containing complex. It was found that the molecular function category exhibited roles such as transferrin receptor binding, I-κB kinase activity, identical protein binding (Figure 5). KEGG pathway enrichment analysis of target genes was performed with STRING program. The findings showed that 120 genes were involved in the enrichment process and 90 pathways were apoptosis related, exhibiting a significant correlation with target genes (p < 0.05). Basically, C-type lectin receptor signaling pathway, NF-κB signaling pathway and TNF signaling pathway are shown (Figure 6).

4. Discussion

The results of this study demonstrate that BA, in combination with Cis, effectively inhibits the growth of Y79 retinoblastoma cells by inducing apoptosis and modulating NF-κB signaling. WST-1 analysis revealed that both BA and Cis exhibited dose- and time-dependent cytotoxic effects on Y79 cells, with IC₅₀ values decreasing over time. The BA + Cis combination showed the strongest inhibitory effect on cell viability, suggesting a potential synergistic interaction between the two agents. Our findings further show that BA enhances the expression of apoptotic markers p53 and Caspase-3, supporting its pro-apoptotic role in retinoblastoma cells. However, NF-κB mRNA expression was upregulated in all treatment groups, with the highest levels observed in the Cis-treated group, while BA treatment alone exhibited relatively lower NF-κB expression. This suggests that although BA does not directly suppress NF-κB transcription, it may modulate its functional activity through post-translational mechanisms such as phosphorylation, nuclear translocation, or interaction with inhibitory proteins. The BA + Cis combination resulted in an intermediate NF-κB expression level, implying a potential regulatory effect rather than direct inhibition. Given the complexity of NF-κB signaling, further research is required to investigate NF-κB protein levels, phosphorylation status, and nuclear translocation to determine the exact mechanism by which BA influences this pathway in retinoblastoma cells.

New drugs are being developed by utilizing natural resources to treat many diseases. Although it is more expensive and laborious to discover and develop new therapeutic agents in natural resources, it provides an abundant source for new drugs. Natural resources continue to be a rich and abundant source of potential new drugs. One of these sources is boswellic acid. BA has very strong biological and pharmacological potentials and contains pentacyclic triterpenoids that attract the attention of synthetic and medicinal chemistry. It shows that natural BA and its synthetic derivatives can play an important role in the treatment of many inflammatory diseases, especially cancer. Moreover, BA have been used in the treatment of various diseases in formulations with active compounds [15]. Particular combination ideas are extremely important in reducing toxicity and resistance. Moreover, the interactions of BA with other anticancer drugs should be fully investigated, because they are expected to increase synergism with anticancer and anti-inflammatory effects. The most important challenge in drug discovery is to eliminate drug resistance and to ensure the development of molecules with a new target. Therefore, we investigated the effects of the combination of BA with a potent anticancer agent Cis and the obtained results confirm the synergism. While apoptotic gene expressions increased, an increase in anti-inflammatory biochemical parameters was also observed. In other words, while killing cancer cells, it creates a microenvironment that will allow healthy cells to survive.

In vitro studies on different cancer cell lines have highlighted the strong anticancer properties of BA. It has been reported that BA treatment in the colon cancer cell line HCT-116 caused a decrease in cyclin-dependent kinases such as cyclin D, cyclin E, CDK2 and CDK4 [16]. In another study, Acetyl-beta boswellic acid and BA stopped the activity of I-κB kinase in chemotherapeutic androgen-independent PC-3 prostate cancer cells in vitro and in vivo, inhibiting activated NF-κB signaling, reducing proliferation and leading to cell death [17]. It has been shown that apoptosis induced by TNF and chemotherapeutic agents is more effective and suppresses TNF-dependent invasion. In pancreatic cancer cell lines, BA treatment has been shown to inhibit the expression of NF-κB, and thus suppress COX-2 and MMP-9 genes. In addition, in an experimental adenomatous polyposis model in which BA and aspirin were applied, it was shown that BA caused regression in adenomatous polyps by modulating the Wnt/β-catenin pathway and the NF-κB/COX-2 pathway in mice [18]. It was found that inhibition of NF-κB with an extract containing Boswellia decreased the expressions of VEGF, TNF-α and MCP-1 and improved mouse liver granuloma [19]. It was shown that apoptosis was induced and tumor regression was triggered by the reduction in NF-κB in cancers treated with 3-α-Butyryloxy-β-boswellic acid, a semi-synthetic analog of BA [20]. Colorectal cancer is one of the most common cancers. In HT-29 human colon cancer cells, Boswellia serrata (B. serrata) has anticancer activity. A significant difference was observed in B. serrata-treated HT-29 compared to the control group [21].

In the presented study, it was determined that oxidative stress and, accordingly, apoptotic genes p53 and Caspase-3 mRNA expression levels were stimulated due to the increase in IL1-β and IFN-gamma levels in the group to which BA was applied at a 48 h IC₅₀ dose (Figure 4). Indeed, studies have indicated that cytosolic and mitochondrial reactive oxygen species, which can also play an active role in p53 stimulation, can be effective in the induction of apoptosis [22]. However, a difference was observed in the experimental group to which BA+Cis was applied compared to the control group in terms of oxidative stress and inflammation, and apoptosis was observed to be stimulated. In addition, the presented study is the first study in which natural antioxidant and anticancer agent and a strong chemotherapy agent Cis were applied together. In previous studies, it has been reported that natural sources such as gallic acid and rosmarinic acid exhibit effective anticancer interactions with doxorubicin [23,24]. When we compare the reports of these studies with our results, we see that combination therapy can eliminate secondary effects in many cancer treatments. In addition, cytotoxicity and results that can directly affect survival are seen.

While this study provides valuable insights into the potential therapeutic effects of BA in combination with Cis on Y79 retinoblastoma cells, it has several limitations. First, NF-κB activity was assessed only at the mRNA level, and functional validation through protein expression, phosphorylation status, and nuclear translocation assays was not performed. Future studies should include Western blot and immunofluorescence analysis to confirm whether NF-κB activation is modulated post-translationally. Second, the study was conducted in vitro, and while the results suggest a promising anticancer effect, in vivo models are necessary to evaluate the pharmacokinetics, bioavailability, and systemic effects of BA in retinoblastoma treatment. Lastly, potential off-target effects and interactions with other cellular pathways remain unexplored, requiring further mechanistic studies to fully understand BA’s role in NF-κB signaling and apoptosis regulation.

Future research should focus on elucidating the precise molecular mechanisms by which BA modulates NF-κB signaling, particularly at the protein level. Since our study demonstrated NF-κB mRNA upregulation but lacked functional validation, subsequent investigations should employ Western blot analysis, phosphorylation assays and nuclear translocation studies to determine whether BA affects NF-κB activation post-translationally. Additionally, in vivo studies are crucial to evaluate the bioavailability, pharmacokinetics and systemic efficacy of BA in retinoblastoma models. Further research should also explore potential synergistic or antagonistic effects of BA with other chemotherapeutic agents to optimize combination therapies. Finally, given NF-κB’s dual role in inflammation and apoptosis, future studies should investigate how BA influences NF-κB-dependent gene expression networks and downstream pathways, ensuring a comprehensive understanding of its therapeutic potential in retinoblastoma treatment.

5. Conclusions

This study demonstrates that BA enhances apoptosis and modulates NF-κB signaling in Y79 retinoblastoma cells, particularly when combined with Cis. The combination of BA + Cis exhibited the strongest cytotoxic effect, suggesting a potential synergistic interaction. Our findings indicate that BA increases p53 and Caspase-3 expression, while NF-κB mRNA expression was upregulated, particularly in the Cis-treated group. However, this does not necessarily imply increased functional NF-κB activity, as post-translational regulatory mechanisms may play a role.