Adipose-Derived Stem Cells Improve Angiogenesis and Lymphangiogenesis in a Hypoxic Dermal Regeneration Model In Vitro
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Isolation and Characterization of ASCs
2.2. Cell Culture
2.3. Scaffold Preparation and Cell-Seeding
2.4. Ribonucleic Acid (RNA)-Extraction
2.5. Multiplex-Quantitative Polymerase Chain Reaction (qPCR)
2.6. Enzyme-Linked Immunosorbent Assay (ELISA)
2.7. Statistical Evaluation and Graph Illustrations
3. Results
3.1. Hypoxic Conditions and ASC Co-Culture Improve Angiogenic and Lymphangiogenic Gene and Protein Expression in Scaffolds after 24 h
3.1.1. Short-Term Effects on Gene Expression
Lymphangiogenesis
Angiogenesis
3.1.2. Short-Term Effects on Protein Expression
Lymphangiogenesis
Angiogenesis
3.2. Long-Term Treatment of Hypoxia and ASC Co-Culture in Scaffolds Induces Angiogenic and Lymphangiogenic Gene and Protein Expression
3.2.1. Long-Term Effects on Gene Expression
Lymphangiogenesis
Angiogenesis
3.2.2. Long-Term Effects on Protein Expression
Lymphangiogenesis
Angiogenesis
3.3. Biocompatibility of Collagen-Scaffolds for Endothelial and Lymph Endothelial Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sen, C.K.; Gordillo, G.M.; Roy, S.; Kirsner, R.; Lambert, L.; Hunt, T.K.; Gottrup, F.; Gurtner, G.C.; Longaker, M.T. Human skin wounds: A major and snowballing threat to public health and the economy. Wound Repair Regen. 2009, 17, 763–771. [Google Scholar] [CrossRef] [PubMed]
- Martinengo, L.; Olsson, M.; Bajpai, R.; Soljak, M.; Upton, Z.; Schmidtchen, A.; Car, J.; Järbrink, K. Prevalence of chronic wounds in the general population: Systematic review and meta-analysis of observational studies. Ann. Epidemiol. 2019, 29, 8–15. [Google Scholar] [CrossRef] [PubMed]
- Olsson, M.; Järbrink, K.; Divakar, U.; Bajpai, R.; Upton, Z.; Schmidtchen, A.; Car, J. The humanistic and economic burden of chronic wounds: A systematic review. Wound Repair Regen. 2019, 27, 114–125. [Google Scholar] [CrossRef]
- Agarwal, P.; Kukrele, R.; Sharma, D. Vacuum assisted closure (VAC)/negative pressure wound therapy (NPWT) for difficult wounds: A review. J. Clin. Orthop. Trauma 2019, 10, 845–848. [Google Scholar] [CrossRef]
- Järbrink, K.; Ni, G.; Sönnergren, H.; Schmidtchen, A.; Pang, C.; Bajpai, R.; Car, J. The humanistic and economic burden of chronic wounds: A protocol for a systematic review. Syst. Rev. 2017, 6, 15. [Google Scholar] [CrossRef]
- Karimkhani, C.; Dellavalle, R.P.; Coffeng, L.E.; Flohr, C.; Hay, R.J.; Langan, S.M.; Nsoesie, E.O.; Ferrari, A.J.; Erskine, H.E.; Silverberg, J.I.; et al. Global Skin Disease Morbidity and Mortality: An Update From the Global Burden of Disease Study 2013. JAMA Dermatol. 2017, 153, 406–412. [Google Scholar] [CrossRef] [PubMed]
- Rey, S.; Luo, W.; Shimoda, L.A.; Semenza, G.L. Metabolic reprogramming by HIF-1 promotes the survival of bone marrow–derived angiogenic cells in ischemic tissue. Blood 2011, 117, 4988–4998. [Google Scholar] [CrossRef]
- Yeh, L.-C.; Chen, S.-P.; Liao, F.-H.; Wu, T.-H.; Huang, Y.-T.; Lin, S.-Y. The Bioactive Core and Corona Synergism of Quantized Gold Enables Slowed Inflammation and Increased Tissue Regeneration in Wound Hypoxia. Int. J. Mol. Sci. 2020, 21, 1699. [Google Scholar] [CrossRef]
- Chávez, M.N.; Fuchs, B.; Moellhoff, N.; Hofmann, D.; Zhang, L.; Selão, T.T.; Giunta, R.E.; Egaña, J.T.; Nickelsen, J.; Schenck, T.L. Use of photosynthetic transgenic cyanobacteria to promote lymphangiogenesis in scaffolds for dermal regeneration. Acta Biomater. 2021, 126, 132–143. [Google Scholar] [CrossRef]
- Schenck, T.L.; Hopfner, U.; Chávez, M.N.; Machens, H.-G.; Somlai-Schweiger, I.; Giunta, R.E.; Bohne, A.V.; Nickelsen, J.; Allende, M.L.; Egaña, J.T. Photosynthetic biomaterials: A pathway towards autotrophic tissue engineering. Acta Biomater. 2015, 15, 39–47. [Google Scholar] [CrossRef]
- Beegle, J.; Lakatos, K.; Kalomoiris, S.; Stewart, H.; Isseroff, R.R.; Nolta, J.A.; Fierro, F.A. Hypoxic Preconditioning of Mesenchymal Stromal Cells Induces Metabolic Changes, Enhances Survival, and Promotes Cell Retention In Vivo. Stem Cells 2015, 33, 1818–1828. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.; Kim, S.-M.; Sung, J.-H. Cellular and molecular stimulation of adipose-derived stem cells under hypoxia. Cell Biol. Int. 2014, 38, 553–562. [Google Scholar] [CrossRef]
- Wang, Z.; Feng, C.; Liu, H.; Meng, T.; Huang, W.; Long, X.; Wang, X. Hypoxic Pretreatment of Adipose-Derived Stem Cells Accelerates Diabetic Wound Healing via circ-Gcap14 and HIF-1α/VEGF Mediated Angiopoiesis. Int. J. Stem Cells 2021, 14, 447–454. [Google Scholar] [CrossRef]
- Shu, S.; Wang, Y.; Zheng, M.; Liu, Z.; Cai, J.; Tang, C.; Dong, Z. Hypoxia and Hypoxia-Inducible Factors in Kidney Injury and Repair. Cells 2019, 8, 207. [Google Scholar] [CrossRef]
- Han, Y.; Ren, J.; Bai, Y.; Pei, X.; Han, Y. Exosomes from hypoxia-treated human adipose-derived mesenchymal stem cells enhance angiogenesis through VEGF/VEGF-R. Int. J. Biochem. Cell Biol. 2019, 109, 59–68. [Google Scholar] [CrossRef]
- Choi, J.R.; Yong, K.W.; Wan Safwani, W.K.Z. Effect of hypoxia on human adipose-derived mesenchymal stem cells and its potential clinical applications. Cell Mol. Life Sci. 2017, 74, 2587–2600. [Google Scholar] [CrossRef]
- An, Y.; Lin, S.; Tan, X.; Zhu, S.; Nie, F.; Zhen, Y.; Gu, L.; Zhang, C.; Wang, B.; Wei, W.; et al. Exosomes from adipose-derived stem cells and application to skin wound healing. Cell Prolif. 2021, 54, e12993. [Google Scholar] [CrossRef] [PubMed]
- Qazi, T.H.; Mooney, D.J.; Duda, G.N.; Geissler, S. Biomaterials that promote cell-cell interactions enhance the paracrine function of MSCs. Biomaterials 2017, 140, 103–114. [Google Scholar] [CrossRef]
- Wan, X.; Xie, M.-K.; Xu, H.; Wei, Z.-W.; Yao, H.-J.; Wang, Z.; Zheng, D.-C. Hypoxia-preconditioned adipose-derived stem cells combined with scaffold promote urethral reconstruction by upregulation of angiogenesis and glycolysis. Stem Cell Res. Ther. 2020, 11, 535. [Google Scholar] [CrossRef]
- Baraniak, P.R.; McDevitt, T.C. Stem cell paracrine actions and tissue regeneration. Regen. Med. 2010, 5, 121–143. [Google Scholar] [CrossRef] [PubMed]
- Caplan, A.I.; Correa, D. The MSC: An Injury Drugstore. Cell Stem Cell 2011, 9, 11–15. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Xu, Y.; Zhong, Z.; Wu, Y.; Zhao, J.; Wang, Y.; Cheng, H.; Kong, M.; Zhang, F.; Chen, Q.; et al. A Large-Scale Investigation of Hypoxia-Preconditioned Allogeneic Mesenchymal Stem Cells for Myocardial Repair in Nonhuman Primates: Paracrine Activity Without Remuscularization. Circ. Res. 2016, 118, 970–983. [Google Scholar] [CrossRef] [PubMed]
- Skiles, M.L.; Sahai, S.; Rucker, L.; Blanchette, J.O. Use of Culture Geometry to Control Hypoxia-Induced Vascular Endothelial Growth Factor Secretion from Adipose-Derived Stem Cells: Optimizing a Cell-Based Approach to Drive Vascular Growth. Tissue Eng. Part A 2013, 19, 2330–2338. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Sun, A.; Zou, Y.; Ge, J. Inducible metabolic adaptation promotes mesenchymal stem cell therapy for ischemia: A hypoxia-induced and glycogen-based energy prestorage strategy. Arterioscler. Thromb. Vasc. Biol. 2014, 34, 870–876. [Google Scholar] [CrossRef] [PubMed]
- Hsiao, S.T.; Lokmic, Z.; Peshavariya, H.; Abberton, K.M.; Dusting, G.J.; Lim, S.Y.; Dilley, R.J. Hypoxic Conditioning Enhances the Angiogenic Paracrine Activity of Human Adipose-Derived Stem Cells. Stem Cells Dev. 2013, 22, 1614–1623. [Google Scholar] [CrossRef]
- Przybyt, E.; Krenning, G.; Brinker, M.G.; Harmsen, M.C. Adipose stromal cells primed with hypoxia and inflammation enhance cardiomyocyte proliferation rate in vitro through STAT3 and Erk1/2. J. Transl. Med. 2013, 11, 39. [Google Scholar] [CrossRef]
- Mallon, E.C.; Ryan, T.J. Lymphedema and wound healing. Clin. Dermatol. 1994, 12, 89–93. [Google Scholar] [CrossRef]
- Lu, Y.; Yang, Y.; Xiao, L.; Li, S.; Liao, X.; Liu, H. Autocrine and Paracrine Effects of Vascular Endothelial Cells Promote Cutaneous Wound Healing. BioMed Res. Int. 2021, 2021, 6695663. [Google Scholar] [CrossRef]
- Wang, X.; Zheng, Y.; Wu, H.; Tian, S.; Wu, M.; Luo, P.; Zhang, F.; Fang, H.; Li, H.; Xia, Z. Transplantation of HUVECs with genetically modified Nogo-B accelerates wound-healing in nude mice. Am. J. Transl. Res. 2019, 11, 2866–2876. [Google Scholar]
- D’Alessandro, S.; Magnavacca, A.; Perego, F.; Fumagalli, M.; Sangiovanni, E.; Prato, M.; Dell’Agli, M.; Basilico, N. Effect of Hypoxia on Gene Expression in Cell Populations Involved in Wound Healing. BioMed Res. Int. 2019, 2019, 2626374. [Google Scholar] [CrossRef]
- Chopra, H.; Kumar, S. Biopolymer-based Scaffolds for Tissue Engineering Applications. Curr. Drug Targets 2021, 22, 282–295. [Google Scholar] [CrossRef]
- Chaudhari, A.A.; Vig, K.; Baganizi, D.R.; Sahu, R.; Dixit, S.; Dennis, V.; Singh, S.R.; Pillai, S.R. Future Prospects for Scaffolding Methods and Biomaterials in Skin Tissue Engineering: A Review. Int. J. Mol. Sci. 2016, 17, 1974. [Google Scholar] [CrossRef] [PubMed]
- Brown, S.J.; Surti, F.; Sibbons, P.; Hook, L. Wound healing properties of a fibrin-based dermal replacement scaffold. Biomed. Phys. Eng. Express 2021, 8, 015025. [Google Scholar] [CrossRef] [PubMed]
- Tonndorf, R.; Aibibu, D.; Cherif, C. Isotropic and Anisotropic Scaffolds for Tissue Engineering: Collagen, Conventional, and Textile Fabrication Technologies and Properties. Int. J. Mol. Sci. 2021, 22, 9561. [Google Scholar] [CrossRef] [PubMed]
- Hopfner, U.; Schenck, T.-L.; Chávez, M.-N.; Machens, H.-G.; Bohne, A.-V.; Nickelsen, J.; Giunta, R.-E.; Egaña, J.-T. Development of photosynthetic biomaterials for in vitro tissue engineering. Acta Biomater. 2014, 10, 2712–2717. [Google Scholar] [CrossRef] [PubMed]
- Chávez, M.N.; Moellhoff, N.; Schenck, T.L.; Egaña, J.T.; Nickelsen, J. Photosymbiosis for Biomedical Applications. Front. Bioeng. Biotechnol. 2020, 8, 577204. [Google Scholar] [CrossRef]
- Krüger, J.P.; Machens, I.; Lahner, M.; Endres, M.; Kaps, C. Initial Boost Release of Transforming Growth Factor-β3 and Chondrogenesis by Freeze-Dried Bioactive Polymer Scaffolds. Ann. Biomed. Eng. 2014, 42, 2562–2576. [Google Scholar] [CrossRef]
- Rohman, G.; Langueh, C.; Ramtani, S.; Lataillade, J.-J.; Lutomski, D.; Senni, K.; Changotade, S. The Use of Platelet-Rich Plasma to Promote Cell Recruitment into Low-Molecular-Weight Fucoidan-Functionalized Poly(Ester-Urea-Urethane) Scaffolds for Soft-Tissue Engineering. Polymers 2019, 11, 1016. [Google Scholar] [CrossRef]
- Blum, J.C.; Schenck, T.L.; Birt, A.; Giunta, R.E.; Wiggenhauser, P.S. Artificial decellularized extracellular matrix improves the regenerative capacity of adipose tissue derived stem cells on 3D printed polycaprolactone scaffolds. J. Tissue Eng. 2021, 12, 20417314211022242. [Google Scholar] [CrossRef]
- Bunnell, B.A.; Flaat, M.; Gagliardi, C.; Patel, B.; Ripoll, C. Adipose-derived stem cells: Isolation, expansion and differentiation. Methods 2008, 45, 115–120. [Google Scholar] [CrossRef]
- Kuhlmann, C.; Schenck, T.L.; Tluczynski, K.; Aszodi, A.; Metzger, P.; Giunta, R.; Wiggenhauser, P.S. Experimental approach to nasal septal cartilage regeneration with adipose tissue-derived stem cells and decellularized porcine septal cartilage. Xenotransplantation 2021, 28, e12660. [Google Scholar] [CrossRef]
- Frykberg, R.G.; Banks, J.; Deptuła, M.; Karpowicz, P.; Wardowska, A.; Sass, P.; Sosnowski, P.; Mieczkowska, A.; Filipowicz, N.; Dzierżyńska, M.; et al. Challenges in the Treatment of Chronic Wounds. Adv. Wound Care 2015, 4, 560–582. [Google Scholar] [CrossRef]
- Kyaw, B.M.; Järbrink, K.; Martinengo, L.; Car, J.; Harding, K.; Schmidtchen, A. Need for Improved Definition of “Chronic Wounds” in Clinical Studies. Acta Derm. Venereol. 2018, 98, 157–158. [Google Scholar] [CrossRef]
- Walker, N.; Rodgers, A.; Birchall, N.; Norton, R.; MacMahon, S. Leg ulcers in New Zealand: Age at onset, recurrence and provision of care in an urban population. N. Z. Med. J. 2002, 115, 286–289. [Google Scholar]
- Guyatt, G.H.; Feeny, D.H.; Patrick, D.L. Measuring health-related quality of life. Ann. Intern. Med. 1993, 118, 622–629. [Google Scholar] [CrossRef] [PubMed]
- Posnett, J.; Franks, P.J. The burden of chronic wounds in the UK. Nurs. Times 2008, 104, 44–45. [Google Scholar] [PubMed]
- Nussbaum, S.R.; Carter, M.J.; Fife, C.E.; DaVanzo, J.; Haught, R.; Nusgart, M.; Cartwright, D. An Economic Evaluation of the Impact, Cost, and Medicare Policy Implications of Chronic Nonhealing Wounds. Value Health 2018, 21, 27–32. [Google Scholar] [CrossRef] [PubMed]
- Zimna, A.; Kurpisz, M. Hypoxia-Inducible Factor-1 in Physiological and Pathophysiological Angiogenesis: Applications and Therapies. BioMed Res. Int. 2015, 2015, 549412. [Google Scholar] [CrossRef]
- Zhang, Q.; Yan, Q.; Yang, H.; Wei, W. Oxygen sensing and adaptability won the 2019 Nobel Prize in Physiology or medicine. Genes Dis. 2019, 6, 328–332. [Google Scholar] [CrossRef]
- NobelPrize.org. The Nobel Prize in Physiology or Medicine 2019: Nobel Prize Outreach AB 2022. 2019. Available online: https://www.nobelprize.org/prizes/medicine/2019/summary/ (accessed on 29 December 2022).
- Hwang, O.K.; Noh, Y.W.; Hong, J.T.; Lee, J.-W. Hypoxia Pretreatment Promotes Chondrocyte Differentiation of Human Adipose-Derived Stem Cells via Vascular Endothelial Growth Factor. Tissue Eng. Regen. Med. 2020, 17, 335–350. [Google Scholar] [CrossRef]
- Liu, J.; Hao, H.; Xia, L.; Ti, D.; Huang, H.; Dong, L.; Tong, C.; Hou, Q.; Zhao, Y.; Liu, H.; et al. Hypoxia Pretreatment of Bone Marrow Mesenchymal Stem Cells Facilitates Angiogenesis by Improving the Function of Endothelial Cells in Diabetic Rats with Lower Ischemia. PLoS ONE 2015, 10, e0126715. [Google Scholar] [CrossRef]
- Rey, S.; Semenza, G.L. Hypoxia-inducible factor-1-dependent mechanisms of vascularization and vascular remodelling. Cardiovasc. Res. 2010, 86, 236–242. [Google Scholar] [CrossRef]
- Liu, Y.; Cox, S.R.; Morita, T.; Kourembanas, S. Hypoxia regulates vascular endothelial growth factor gene expression in endothelial cells. Identification of a 5′ enhancer. Circ. Res. 1995, 77, 638–643. [Google Scholar] [CrossRef]
- Gerber, H.-P.; Condorelli, F.; Park, J.; Ferrara, N. Differential Transcriptional Regulation of the Two Vascular Endothelial Growth Factor Receptor Genes: Flt-1, but not Flk-1/KDR, is up-regulated by hypoxia. J. Biol. Chem. 1997, 272, 23659–23667. [Google Scholar] [CrossRef]
- Kallio, P.J.; Pongratz, I.; Gradin, K.; McGuire, J.; Poellinger, L. Activation of hypoxia-inducible factor 1α: Posttranscriptional regulation and conformational change by recruitment of the Arnt transcription factor. Proc. Natl. Acad. Sci. USA 1997, 94, 5667–5672. [Google Scholar] [CrossRef] [PubMed]
- Manalo, D.J.; Rowan, A.; Lavoie, T.; Natarajan, L.; Kelly, B.D.; Ye, S.Q.; Garcia, J.G.N.; Semenza, G.L. Transcriptional regulation of vascular endothelial cell responses to hypoxia by HIF-1. Blood 2005, 105, 659–669. [Google Scholar] [CrossRef]
- Forsythe, J.A.; Jiang, B.H.; Iyer, N.V.; Agani, F.; Leung, S.W.; Koos, R.D.; Semenza, G.L. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol. Cell. Biol. 1996, 16, 4604–4613. [Google Scholar] [CrossRef] [PubMed]
- Moroz, E.; Carlin, S.; Dyomina, K.; Burke, S.; Thaler, H.T.; Blasberg, R.; Serganova, I. Real-Time Imaging of HIF-1α Stabilization and Degradation. PLoS ONE 2009, 4, e5077. [Google Scholar] [CrossRef] [PubMed]
- Han, Y.; Gong, T.; Zhang, C.; Dissanayaka, W.L. HIF-1α Stabilization Enhances Angio-/Vasculogenic Properties of SHED. J. Dent. Res. 2020, 99, 804–812. [Google Scholar] [CrossRef]
- Schreml, S.; Szeimies, R.; Prantl, L.; Karrer, S.; Landthaler, M.; Babilas, P. Oxygen in acute and chronic wound healing. Br. J. Dermatol. 2010, 163, 257–268. [Google Scholar] [CrossRef]
- Mustoe, T.A.; O’Shaughnessy, K.; Kloeters, O. Chronic Wound Pathogenesis and Current Treatment Strategies: A Unifying Hypothesis. Plast. Reconstr. Surg. 2006, 117, 35S–41S. [Google Scholar] [CrossRef]
- Zhao, R.; Liang, H.; Clarke, E.; Jackson, C.; Xue, M. Inflammation in Chronic Wounds. Int. J. Mol. Sci. 2016, 17, 2085. [Google Scholar] [CrossRef]
- Harmon, B.V.; Allan, D.J. Apoptosis. Adv. Genet. 1997, 35, 35–56. [Google Scholar] [PubMed]
- Ferrara, N. Vascular endothelial growth factor and the regulation of angiogenesis. Recent Prog. Horm. Res. 2000, 55, 15–35, discussion 35–36. [Google Scholar]
- Zhang, Q.-X.; Magovern, C.J.; Mack, C.A.; Budenbender, K.T.; Ko, W.; Rosengart, T.K. Vascular Endothelial Growth Factor Is the Major Angiogenic Factor in Omentum: Mechanism of the Omentum-Mediated Angiogenesis. J. Surg. Res. 1997, 67, 147–154. [Google Scholar] [CrossRef] [PubMed]
- Risau, W. Angiogenic growth factors. Prog. Growth Factor Res. 1990, 2, 71–79. [Google Scholar] [CrossRef] [PubMed]
- Park, J.E.; Keller, G.A.; Ferrara, N. The vascular endothelial growth factor (VEGF) isoforms: Differential deposition into the subepithelial extracellular matrix and bioactivity of extracellular matrix-bound VEGF. Mol. Biol. Cell 1993, 4, 1317–1326. [Google Scholar] [CrossRef]
- Waltenberger, J.; Mayr, U.; Pentz, S.; Hombach, V. Functional Upregulation of the Vascular Endothelial Growth Factor Receptor KDR by Hypoxia. Circulation 1996, 94, 1647–1654. [Google Scholar] [CrossRef]
- Mole, D.R.; Blancher, C.; Copley, R.R.; Pollard, P.J.; Gleadle, J.M.; Ragoussis, J.; Ratcliffe, P.J. Genome-wide Association of Hypoxia-inducible Factor (HIF)-1α and HIF-2α DNA Binding with Expression Profiling of Hypoxia-inducible Transcripts. J. Biol. Chem. 2009, 284, 16767–16775. [Google Scholar] [CrossRef]
- Schödel, J.; Oikonomopoulos, S.; Ragoussis, J.; Pugh, C.W.; Ratcliffe, P.J.; Mole, D.R. High-resolution genome-wide mapping of HIF-binding sites by ChIP-seq. Blood 2011, 117, e207–e217. [Google Scholar] [CrossRef]
- Guneta, V.; Zhou, Z.; Tan, N.S.; Sugii, S.; Wong, M.T.C.; Choong, C. Recellularization of decellularized adipose tissue-derived stem cells: Role of the cell-secreted extracellular matrix in cellular differentiation. Biomater. Sci. 2017, 6, 168–178. [Google Scholar] [CrossRef]
- Saaristo, A.; Tammela, T.; Farkkilā, A.; Kärkkäinen, M.; Suominen, E.; Yla-Herttuala, S.; Alitalo, K. Vascular endothelial growth factor-C accelerates diabetic wound healing. Am. J. Pathol. 2006, 169, 1080–1087. [Google Scholar] [CrossRef] [PubMed]
- Resources USDoHaH. Premarket Approvel (PMA) FDA Home: U.S. Food and Drug Administration. [Updated 11/08/2021]. 2021. Available online: https://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfpma/pma.cfm?id=P900033S042 (accessed on 9 November 2021).
- Habanjar, O.; Diab-Assaf, M.; Caldefie-Chezet, F.; Delort, L. 3D Cell Culture Systems: Tumor Application, Advantages, and Disadvantages. Int. J. Mol. Sci. 2021, 22, 12200. [Google Scholar] [CrossRef] [PubMed]
- Hassan, W.U.; Greiser, U.; Wang, W. Role of adipose-derived stem cells in wound healing. Wound Repair Regen. 2014, 22, 313–325. [Google Scholar] [CrossRef]
- Hay, R.J.; Johns, N.E.; Williams, H.C.; Bolliger, I.; Dellavalle, R.P.; Margolis, D.J.; Marks, R.; Naldi, L.; Weinstock, M.A.; Wulf, S.K.; et al. The Global Burden of Skin Disease in 2010: An Analysis of the Prevalence and Impact of Skin Conditions. J. Investig. Dermatol. 2014, 134, 1527–1534. [Google Scholar] [CrossRef] [PubMed]






| Gene | Full Name | NCBI Reference | Fwd. Primer | Sequence (5′-3′) | Rev. Primer |
|---|---|---|---|---|---|
| HIF1A | Hypoxia inducible factor 1 alpha | NM_001530.4 | CATCTCCATC TCCTACCCAC | (FAM)AGTGCCACATCATCACCATATAGAGATACTCAA(BHQ1) | TCCTTTTCCTGCTCTGTTTG |
| PROX1 | Prospero homeobox 1 | NM_001270616.2 | AGCGAGAAGGCAACAACAAAG | (TET) CCA AAC TCC TTA CAA CCG GAA GGC AAA CA(BHQ1) | TGCGACATG-GCAGTGTTCAG |
| VEGFA | Vascular endothelial growth factor A | NM_001025366.3 | CGCTTACTCTCA CCTGCTTC | (JOE)ACTCGCCCTCATCCTCTTC- CTGCTCCC(TQ2) | CAACCACTC-ACACACACAC |
| VEGFA | Vascular endothelial growth factor A | NM_001025366.3 | TGCCCGCTGCT GTCTAAT | (ATTO647N) GCC TCC CTG GCC CCC ATC CCT GTG (BBQ650) | TCTCCGCTCTGAGCAAGG |
| VEGFB | Vascular endothelial growth factor B | NM_003377.5 | AGTGGGGGAAC AAAGAGGAG | (HEX)AGCCCAGGCAGAAGCT GCTCTAGGAC(BHQ1) | GAGACAAGGGATGGCAGAAG |
| VEGFC | vascular endothelial growth factor C | NM_005429.5 | TGGCAACATAAC AGAGAACAG | (TexRed)CCAACCTCAACTCAA GGACAGAAGAGACT(TQ3) | CCAAACTCCTTCCCCACATC |
| FLT1 (VEGFR1) | Fms related receptor tyrosine kinase 1 | NM_001159920.2 | CCTGCAAGATT CAGGCAC | (TET)TGTCACTGTTGCTAACT TTCAGGCTCGGA(BHQ1) | ACTGCTATCATCTCCGAACTC |
| KDR (VEGFR2) | Kinase insert domain receptor | NM_002253.4 | GTGAAGAATGG AGAAGTGTGG | (YAKYE) AGT ACC CTT GTT ATC CAA GCG GCA AAT (BHQ1) | TCTCCCGACTTTGTTGACC |
| FLT4 (VEGFR3) | Fms related tyrosine kinase 4 (FLT4) | NM_002020.5 | TCCTCCTCCTC CTCATCTTC | (ROX) CCA CGC AGA CAT CAA GAC GGG CTA CCT (BHQ2) | GTATTCGCATTGCTCTCC |
| Step | Cycles | Process | Temperature (°C) | Retention Time (s) |
|---|---|---|---|---|
| 1 | 1 | Initial denaturation | 95 | 120 |
| 2 | 40 | Denaturation | 95 | 30 |
| Annealing | 60 | 60 | ||
| Detection | 68 | 30 |
| Protein | Full Name | Kit | Manufacturer | Range | Sensitivity |
|---|---|---|---|---|---|
| HIF1a | hypoxia-induced factor 1-alpha | HIF1A Human ELISA Kit | Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA | 81.92–20,000 pg/mL | <30 pg/mL |
| PROX1 | Prospero homeobox 1 | PROX1 ELISA Kit | EIAab Science Inc., Houston, Texas, USA | 0.156–10 ng/mL | <0.057 ng/mL |
| VEGFA | Vascular endothelial growth factor A | VEGF-A Cell Lysates Human ELISA Kit | Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA | 8.23–6000 pg/mL | <10 pg/mL |
| VEGFB | Vascular endothelial growth factor B | Human VEGF-B ELISA Kit | Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA | 0.4–100 ng/mL | <0.4 ng/mL |
| VEGFC | Vascular endothelial growth factor C | VEGF-C Human ELISA Kit | Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA | 0.23–15.0 ng/mL | <0.057 ng/mL |
| FLT1 (VEGFR1) | Fms related receptor tyrosine kinase 1 | VEGFR1/Flt-1 Quantikine ELISA Kit | R&D Systems; Minneapolis, MN, USA | 31.3–2000 pg/mL | <8.46 pg/mL |
| KDR (VEGFR2) | Kinase insert domain receptor | Human VEGFR2/KDR Quantikine ELISA Kit | R&D Systems; Minneapolis, MN, USA | 78.1–5000 pg/mL | <11.4 pg/mL |
| FLT4 (VEGFR3) | Fms related tyrosine kinase 4 (FLT4) | Human sVEGFR3/Flt-4 DuoSet ELISA Kit | R&D Systems; Minneapolis, MN, USA | 0.9 pg/mL–50 ng/mL | <90 pg/mL |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fuchs, B.; Birt, A.; Moellhoff, N.; Kuhlmann, C.; Giunta, R.E.; Wiggenhauser, P.S. Adipose-Derived Stem Cells Improve Angiogenesis and Lymphangiogenesis in a Hypoxic Dermal Regeneration Model In Vitro. Medicina 2023, 59, 706. https://doi.org/10.3390/medicina59040706
Fuchs B, Birt A, Moellhoff N, Kuhlmann C, Giunta RE, Wiggenhauser PS. Adipose-Derived Stem Cells Improve Angiogenesis and Lymphangiogenesis in a Hypoxic Dermal Regeneration Model In Vitro. Medicina. 2023; 59(4):706. https://doi.org/10.3390/medicina59040706
Chicago/Turabian StyleFuchs, Benedikt, Alexandra Birt, Nicholas Moellhoff, Constanze Kuhlmann, Riccardo E. Giunta, and Paul Severin Wiggenhauser. 2023. "Adipose-Derived Stem Cells Improve Angiogenesis and Lymphangiogenesis in a Hypoxic Dermal Regeneration Model In Vitro" Medicina 59, no. 4: 706. https://doi.org/10.3390/medicina59040706
APA StyleFuchs, B., Birt, A., Moellhoff, N., Kuhlmann, C., Giunta, R. E., & Wiggenhauser, P. S. (2023). Adipose-Derived Stem Cells Improve Angiogenesis and Lymphangiogenesis in a Hypoxic Dermal Regeneration Model In Vitro. Medicina, 59(4), 706. https://doi.org/10.3390/medicina59040706

