High Glucose Induces Late Differentiation and Death of Human Oral Keratinocytes
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Proliferation Assay
2.3. Migration Assay
2.4. Real-Time PCR
2.5. Flow Cytometry
2.6. Statistical Analysis
3. Results
3.1. High Glucose Impedes the Proliferation of Oral Keratinocytes
3.2. High Glucose Inhibits Migration of Oral Keratinocytes
3.3. High Glucose Induces Oral Keratinocyte Cell Death
3.4. High Glucose Upregulates Expression of Late Differentiation Markers in Oral Keratinocytes
3.5. High Glucose Downregulates the Expression of Enzymatic Antioxidants
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Winning, T.A.; Townsend, G.C. Oral mucosal embryology and histology. Clin. Dermatol. 2000, 18, 499–511. [Google Scholar] [CrossRef] [Scilit]
- Brizuela, M.; Winters, R. Histology, Oral Mucosa; StatPearls: Tampa, FL, USA, 2021. [Google Scholar]
- Dale, B.A.; Salonen, J.; Jones, A.H. New approaches and concepts in the study of differentiation of oral epithelia. Crit. Rev. Oral Biol. Med. Off. Publ. Am. Assoc. Oral Biol. 1990, 1, 167–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.-Y.; Squier, C. The Ultrastructure of the Oral Epithelium; Pergamon Press: Oxford, UK, 1984; pp. 7–30. [Google Scholar]
- Rodrigues, M.; Kosaric, N.; Bonham, C.A.; Gurtner, G.C. Wound Healing: A Cellular Perspective. Physiol. Rev. 2019, 99, 665–706. [Google Scholar]
- Guo, S.; Dipietro, L.A. Factors affecting wound healing. J. Dent. Res. 2010, 89, 219–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gröne, A. Keratinocytes and cytokines. Vet. Immunol. Immunopathol. 2002, 88, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Uchi, H.; Terao, H.; Koga, T.; Furue, M. Cytokines and chemokines in the epidermis. J. Dermatol. Sci. 2000, 24 (Suppl. 1), S29–S38. [Google Scholar] [PubMed]
- Hans, M.; Madaan Hans, V. Epithelial antimicrobial peptides: Guardian of the oral cavity. Int. J. Pept. 2014, 2014, 370297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Braff, M.H.; Gallo, R.L. Antimicrobial peptides: An essential component of the skin defensive barrier. Curr. Top. Microbiol. Immunol. 2006, 306, 91–110. [Google Scholar] [PubMed]
- Alzoubi, F.; Joseph, B.; Andersson, L. Healing of soft tissue lacerations in diabetic-induced rats. Dent. Traumatol. Off. Publ. Int. Assoc. Dent. Traumatol. 2017, 33, 438–443. [Google Scholar] [CrossRef] [Scilit]
- Brizeno, L.A.; Assreuy, A.M.; Alves, A.P.; Sousa, F.B.; de Silva, B.P.G.; de Sousa, S.C.; Lascane, N.A.; Evangelista, J.S.; Mota, M.R. Delayed healing of oral mucosa in a diabetic rat model: Implication of TNF-α, IL-1β and FGF-2. Life Sci. 2016, 155, 36–47. [Google Scholar] [CrossRef] [Scilit]
- Yamano, S.; Kuo, W.P.; Sukotjo, C. Downregulated gene expression of TGF-βs in diabetic oral wound healing. J. Cranio-Maxillofac. Surg. 2013, 41, e42–e48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Devlin, H.; Garland, H.; Sloan, P. Healing of tooth extraction sockets in experimental diabetes mellitus. J. Oral Maxillofac. Surg. Off. J. Am. Assoc. Oral Maxillofac. Surg. 1996, 54, 1087–1091. [Google Scholar] [CrossRef] [Scilit]
- Desta, T.; Li, J.; Chino, T.; Graves, D.T. Altered fibroblast proliferation and apoptosis in diabetic gingival wounds. J. Dent. Res. 2010, 89, 609–614. [Google Scholar] [CrossRef] [Scilit]
- Buranasin, P.; Mizutani, K.; Iwasaki, K.; Pawaputanon Na Mahasarakham, C.; Kido, D.; Takeda, K.; Izumi, Y. High glucose-induced oxidative stress impairs proliferation and migration of human gingival fibroblasts. PLoS ONE 2018, 13, e0201855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kido, D.; Mizutani, K.; Takeda, K.; Mikami, R.; Matsuura, T.; Iwasaki, K.; Izumi, Y. Impact of diabetes on gingival wound healing via oxidative stress. PLoS ONE 2017, 12, e0189601. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.H.; Ruegger, P.R.; Lebig, E.G.; VanSchalkwyk, S.; Jeske, D.R.; Hsiao, A.; Borneman, J.; Martins-Green, M. High Levels of Oxidative Stress Create a Microenvironment That Significantly Decreases the Diversity of the Microbiota in Diabetic Chronic Wounds and Promotes Biofilm Formation. Front. Cell. Infect. Microbiol. 2020, 10, 259. [Google Scholar] [CrossRef] [Scilit]
- Xu, F.; Othman, B.; Lim, J.; Batres, A.; Ponugoti, B.; Zhang, C.; Yi, L.; Liu, J.; Tian, C.; Hameedaldeen, A.; et al. Foxo1 inhibits diabetic mucosal wound healing but enhances healing of normoglycemic wounds. Diabetes 2015, 64, 243–256. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Graves, D.T. Keratinocyte Function in Normal and Diabetic Wounds and Modulation by FOXO1. J. Diabetes Res. 2020, 2020, 3714704. [Google Scholar] [CrossRef] [Scilit]
- Ko, K.I.; Sculean, A.; Graves, D.T. Diabetic wound healing in soft and hard oral tissues. Transl. Res. J. Lab. Clin. Med. 2021, 236, 72–86. [Google Scholar] [CrossRef] [Scilit]
- Hu, S.C.; Lan, C.E. High-glucose environment disturbs the physiologic functions of keratinocytes: Focusing on diabetic wound healing. J. Dermatol. Sci. 2016, 84, 121–127. [Google Scholar] [CrossRef] [Scilit]
- Lan, C.C.; Liu, I.H.; Fang, A.H.; Wen, C.H.; Wu, C.S. Hyperglycaemic conditions decrease cultured keratinocyte mobility: Implications for impaired wound healing in patients with diabetes. Br. J. Dermatol. 2008, 159, 1103–1115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spravchikov, N.; Sizyakov, G.; Gartsbein, M.; Accili, D.; Tennenbaum, T.; Wertheimer, E. Glucose effects on skin keratinocytes: Implications for diabetes skin complications. Diabetes 2001, 50, 1627–1635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Terashi, H.; Izumi, K.; Deveci, M.; Rhodes, L.M.; Marcelo, C.L. High glucose inhibits human epidermal keratinocyte proliferation for cellular studies on diabetes mellitus. Int. Wound J. 2005, 2, 298–304. [Google Scholar] [CrossRef] [Scilit]
- Cai, Z.; Liu, Z.G. Execution of RIPK3-regulated necrosis. Mol. Cell. Oncol. 2014, 1, e960759. [Google Scholar] [CrossRef] [Scilit]
- Li, D.; Meng, L.; Xu, T.; Su, Y.; Liu, X.; Zhang, Z.; Wang, X. RIPK1-RIPK3-MLKL-dependent necrosis promotes the aging of mouse male reproductive system. eLife 2017, 6, e27692. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Okano, J.; Kojima, H.; Katagi, M.; Nakagawa, T.; Nakae, Y.; Terashima, T.; Kurakane, T.; Kubota, M.; Maegawa, H.; Udagawa, J. Hyperglycemia Induces Skin Barrier Dysfunctions with Impairment of Epidermal Integrity in Non-Wounded Skin of Type 1 Diabetic Mice. PLoS ONE 2016, 11, e0166215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moll, R.; Divo, M.; Langbein, L. The human keratins: Biology and pathology. Histochem. Cell Biol. 2008, 129, 705–733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nithya, S.; Radhika, T.; Jeddy, N. Loricrin—An overview. J. Oral Maxillofac. Pathol. JOMFP 2015, 19, 64–68. [Google Scholar] [CrossRef] [Scilit]
- Presland, R.B.; Dale, B.A. Epithelial structural proteins of the skin and oral cavity: Function in health and disease. Crit. Rev. Oral Biol. Med. Off. Publ. Am. Assoc. Oral Biol. 2000, 11, 383–408. [Google Scholar] [CrossRef] [Scilit]
- Rollenhagen, C.; Wollert, T.; Langford, G.M.; Sundstrom, P. Stimulation of cell motility and expression of late markers of differentiation in human oral keratinocytes by Candida albicans. Cell. Microbiol. 2009, 11, 946–966. [Google Scholar] [CrossRef] [Scilit]
- Rubin, J.S.; Bottaro, D.P.; Chedid, M.; Miki, T.; Ron, D.; Cheon, G.; Taylor, W.G.; Fortney, E.; Sakata, H.; Finch, P.W.; et al. Keratinocyte growth factor. Cell Biol. Int. 1995, 19, 399–411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Werner, S. Keratinocyte growth factor: A unique player in epithelial repair processes. Cytokine Growth Factor Rev. 1998, 9, 153–165. [Google Scholar] [CrossRef] [Scilit]
- Werner, S.; Peters, K.G.; Longaker, M.T.; Fuller-Pace, F.; Banda, M.J.; Williams, L.T. Large induction of keratinocyte growth factor expression in the dermis during wound healing. Proc. Natl. Acad. Sci. USA 1992, 89, 6896–6900. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baltzis, D.; Eleftheriadou, I.; Veves, A. Pathogenesis and treatment of impaired wound healing in diabetes mellitus: New insights. Adv. Ther. 2014, 31, 817–836. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Basu, P.; Kim, J.H.; Saeed, S.; Martins-Green, M. Using systems biology approaches to identify signalling pathways activated during chronic wound initiation. Wound Repair Regen. Off. Publ. Wound Health Soc. Eur. Tissue Repair Soc. 2021, 29, 881–898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ram, M.; Singh, V.; Kumar, D.; Kumawat, S.; Gopalakrishnan, A.; Lingaraju, M.C.; Gupta, P.; Tandan, S.K.; Kumar, D. Antioxidant potential of bilirubin-accelerated wound healing in streptozotocin-induced diabetic rats. Naunyn-Schmiedeberg's Arch. Pharmacol. 2014, 387, 955–961. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Q.Y.; Wang, G.G.; Li, W.; Jiang, Y.X.; Lu, X.H.; Zhou, P.P. Heme Oxygenase-1 Promotes Delayed Wound Healing in Diabetic Rats. J. Diabetes Res. 2016, 2016, 9726503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lan, C.C.; Wu, C.S.; Huang, S.M.; Wu, I.H.; Chen, G.S. High-glucose environment enhanced oxidative stress and increased interleukin-8 secretion from keratinocytes: New insights into impaired diabetic wound healing. Diabetes 2013, 62, 2530–2538. [Google Scholar] [CrossRef] [Scilit]







| Targets | Forward (5′—3′) | Reverse (5′—3′) |
|---|---|---|
| GAPDH | CAGGGCTGCTTTTAACTCTGG | TGGGTGGAATCATATTGGAACA |
| loricrin | CGAAGGAGTTGGAGGTGTTT | GGCTTCTTCCAGGTAGGTTAAG |
| KRT1 | ATCAATCTCGGTTGGATTCG | TCCTGCTGCAAGTTGTCAAG |
| KRT10 | GCTGACCTGGAGATGCAAAT | AGCATCTTTGCGGTTTTGTT |
| KRT13 | CAGCAGATCCAGGGACTCAT | TCTGGCACTCCATCTCACTG |
| KGF1 (FGF7) | CGTGCTTCCACCTCGTCT | TCTCCTGGGTCCTTTCA |
| KGF2 (FGF10) | GAGGCTGCAGTGAGCTATAATC | CCTTCCTTCCTTCCTGTCTTTC |
| SOD1 | CCAGTGCAGGGCATCATCAA | TCTTCATCCTTTGGCCCACC |
| CAT | CGGACATGGTCTGGGACTTC | AACTGCCTCCCCATTTGCAT |
| HO1 | ACATCCAGCTCTTTGAGGAGT | TGAGTGTAAGGACCCATCGGA |
| NFR2 | TTCTCCCAATTCAGCCAGCC | AACGTAGCCGAAGAAACCTCA |
| Caspase 3 | ACT GGA CTG TGG CAT TGA | GAG CCA TCC TTT GAA TTT CGC |
| Caspase 7 | TGG TAG CAG TGG GAT TTG TG | CTG AAG AGG GAC GGT ACA AAC |
| RIPK3 | CATAGGAAGTGGGGCTACGAT | AATTCGTTATCCAGACTTGCCAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, J.; Han, C.; Chen, D.; Trivedi, H.M.; Bangash, H.I.; Chen, L. High Glucose Induces Late Differentiation and Death of Human Oral Keratinocytes. Curr. Issues Mol. Biol. 2022, 44, 4015-4027. https://doi.org/10.3390/cimb44090275
Shi J, Han C, Chen D, Trivedi HM, Bangash HI, Chen L. High Glucose Induces Late Differentiation and Death of Human Oral Keratinocytes. Current Issues in Molecular Biology. 2022; 44(9):4015-4027. https://doi.org/10.3390/cimb44090275
Chicago/Turabian StyleShi, Junhe, Chen Han, Dandan Chen, Harsh M. Trivedi, Hiba I. Bangash, and Lin Chen. 2022. "High Glucose Induces Late Differentiation and Death of Human Oral Keratinocytes" Current Issues in Molecular Biology 44, no. 9: 4015-4027. https://doi.org/10.3390/cimb44090275
APA StyleShi, J., Han, C., Chen, D., Trivedi, H. M., Bangash, H. I., & Chen, L. (2022). High Glucose Induces Late Differentiation and Death of Human Oral Keratinocytes. Current Issues in Molecular Biology, 44(9), 4015-4027. https://doi.org/10.3390/cimb44090275

