Next Article in Journal
Soybean Polysaccharides Increase the Stability of Lansoprazole Enteric Coated Pellets
Next Article in Special Issue
Aronia Berry Extract Inhibits Cancer Stemness and Overcomes 5-Fluorouracil Resistance by Targeting TLR3/NF-κB Signaling in Colorectal Cancer
Previous Article in Journal
Correction: Iațentiuc et al. From Ototoxicity to Otoprotection: Mechanism and Protective Strategies in Cisplatin Therapy. Pharmaceuticals 2025, 18, 1543
Previous Article in Special Issue
Therapeutic Potential of Gynostemma pentaphyllum (Thunb.) Makino Against COVID-19 Identified Through Network Pharmacology
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pharmaceuticals
Volume 19
Issue 2
10.3390/ph19020212
pharmaceuticals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Qingfei Tongluo Jiedu Formula Regulates M2 Macrophage Polarization via the Butyric Acid-GPR109A-MAPK Pathway for the Treatment of Mycoplasma pneumoniae Pneumonia

by
Zhilin Liu
,
Qiuyue Fan
,
Ruohan Sun
and
Yonghong Jiang
*
Longhua Clinical Medical College, Shanghai University of Traditional Chinese Medicine, 725 Wanping South Road, Xuhui District, Shanghai 200032, China
*
Author to whom correspondence should be addressed.
Pharmaceuticals 2026, 19(2), 212; https://doi.org/10.3390/ph19020212
Submission received: 3 December 2025 / Revised: 16 January 2026 / Accepted: 20 January 2026 / Published: 26 January 2026
(This article belongs to the Special Issue Network Pharmacology of Natural Products, 2nd Edition)
Browse Figures
Versions Notes

Abstract

Background: Mycoplasma pneumoniae pneumonia (MPP) is a common community-acquired pneumonia in children. Increasing drug resistance highlights the need for more effective treatments with fewer side effects. The Qingfei Tongluo Jiedu formula (QTJD) has demonstrated clinical efficacy against MPP; however, its underlying mechanisms remain unclear. This study aimed to explore the mechanism of QTJD on MPP using network pharmacology and in vitro experiments. Methods: Network pharmacology was used to identify the active compounds and signaling pathways of QTJD in MPP. QTJD-containing serum was prepared, and primary mouse lung and bone marrow cells were isolated to examine the effects of QTJD on macrophage polarization through butyric acid. Cell viability assays, flow cytometry, and quantitative reverse transcription-polymerase chain reaction were performed. GPR109−/− cells were used to confirm the receptor mediating butyric acid’s action, and Western blotting was employed to assess the MAPK signaling pathway. Results: QTJD promoted macrophage polarization and alleviated the inflammatory response caused by Mycoplasma pneumoniae. High-performance liquid chromatography-electrospray ionization mass spectrometry combined with network pharmacology identified 20 active compounds. Protein-protein interaction analysis revealed 10 core target, including JUN and Tumor Necrosis Factor (TNF), while enrichment analysis highlighted pathways such as Mitogen-Activated Protein Kinase (MAPK) and Phosphoinositide 3-Kinase-Protein Kinase B. Experimental validation demonstrated that QTJD reduced M1 markers (CD86, CXCL10) by increasing butyrate levels (p < 0.01) and enhanced M2 markers (CD206, Arg-1, MRC-1), promoting M2 polarization. QTJD inhibited ERK1/2, p38, and JNK1/2 (p < 0.01). In GPR109A−/− mice macrophages, QTJD suppressed p38 and JNK1/2 (p < 0.01) but showed no effect on ERK1/2 (p > 0.05), confirming involvement of the butyrate-GPR109A-MAPK pathway. Conclusions: QTJD effectively alleviates MPP by regulating macrophage polarization through the butyrate-GPR109A-MAPK pathway. Future studies should explore how QTJD modulates pulmonary immunity through gut microbiota and butyrate production and elucidate its immunoregulatory mechanisms along the gut-lung axis using multi-omics approaches.

1. Introduction

MPP is the most common community-acquired pneumonia in children, the pathogenesis of which remains unclear, and is usually self-limiting with a good prognosis [1]. However, in severe cases, it can cause inflammatory reactions in the lungs and throughout the body, inducing asthma and affecting multiple systems, including the gastrointestinal tract, circulatory system, and nervous system. In critical cases, it can be life-threatening [2]. The Mycoplasma pneumoniae (MP) outbreak cycle occurs every 3–7 years [3]; however, isolation and protective measures during the coronavirus disease 2019 epidemic reduced exposure to MP and infection detection [4,5], resulting in a delayed re-emergence of MPP [6]. The current treatment of choice for MPP is anti-inflammatory with macrolide antibacterial drugs, including azithromycin and clarithromycin [7], which can relieve symptoms of MPP. However, their gastrointestinal irritation, which causes intestinal flora disorders, can lead to adverse effects such as cardiovascular and liver damage [8]. In recent years, the prevalence of macrolide-resistant MP has increased worldwide, particularly in parts of Asia, especially China, where it exceeds 90% [3,9]. Second-line antibiotics, such as quinolones and tetracyclines, have potential adverse effects in children younger than 8 years [10,11]. Furthermore, the clinical efficacy of current treatment regimens has decreased, making the search for highly effective treatment with minimal side effects crucial for the diagnosis and prognosis of MPP.
Macrophages are the most numerous immune effectors in the lungs and critical cells in innate immunity [12]. Macrophages can be classically and alternatively activated to polarize into M1 and M2 phenotypes, respectively. The phosphorylation of ERK1/2, JNK1/2, and p38 pathways in MAPK is a key response in macrophage polarization [13,14]. Signal transducer and activator of transcription 1 is a critical factor in M1 macrophage polarization and is associated with the upregulation of interleukin 6 (IL-6), tumor necrosis factor-alpha (TNF-α), and Cluster of Differentiation 86 (CD86), which are involved in the clearance of pathogens, mediation of reactive oxygen species-induced tissue injury, and impaired tissue rejuvenation. In contrast, signal transducer and activator of transcription 6 and 3 proteins play essential roles in M2 polarization. It upregulates the expression of IL-10, arginase 1, mannose receptor (MRC-1), and Cluster of Differentiation 206 (CD206) [15], which promotes tissue repair and healing, removes fragmented and apoptotic cells, and possesses strong phagocytic and pro-regulatory properties, thus effectively inhibiting inflammation and serving as a critical factor in alleviating pneumonia. It also has phagocytic, solid, and pro-peritoneal properties and can effectively suppress inflammatory response in a meaningful way to alleviate pneumonia [16].
The intestinal tract is the largest immune organ of the body, containing hundreds of millions of bacteria, archaea, fungi, viruses, and protozoa. The interaction between the altered intestinal flora and respiratory flora disorders through the mucosal immune system is referred to as the “intestinal-pulmonary axis.” Diversity and abundance of the flora are both reduced in pneumonia [17]. A preclinical trial analyzed by 16S rRNA gene sequencing found similar results. The abundance of intestinal Rumenococci, Clostridium butyricum, Lactobacillus, and Bifidobacterium in the affected children was lower than that in healthy children, and the abundance of intestinal Rumenococci and C. butyricum in children with wheezing MPP was considerably lower [18]. Ruminococcus luteus and C. butyricum are important butyric acid-producing bacteria [19]. Butyric acid is a short-chain fatty acid produced by intestinal anaerobic bacteria in the proximal colon (including the ascending and transverse colons) through the fermentation of indigestible dietary fibers and carbohydrates [20]. It plays an important role in maintaining energy and immune homeostasis in the body. It can activate G-protein-coupled receptors (GPCRs) and inhibit histone deacetylase (HDAC) by affecting the migration of immune cells [21]. GPCRs form the largest and most functionally diverse superfamily of membrane proteins in eukaryotic organisms [22]. Butyric acid primarily regulates immunity and metabolism by activating GPR41, GPR43, and GPR109A [23], with GPR109A showing high specificity and sensitivity to butyric acid. Among short-chain fatty acids (SCFAs), only butyric acid can activate GPR109A at a low threshold. GPR109A is expressed in the immune system in monocytes, macrophages, and neutrophils [24], where it functions by regulating pathways such as mitogen-activated protein kinase (MAPK), phosphoinositide 3-kinase (PI3K), and mechanistic target of rapamycin (mTOR). MAPK is a crucial pathway mediating inflammatory responses and is involved in macrophage polarization induction [25].
Clinically, the Qingfei Tongluo formula has been used to treat MPP for decades, with its efficacy validated in both clinical practice [26] and in vivo/in vitro studies [27,28,29]. Building upon this foundation, the modified Qingfei Tongluo Jiedu formula (QTJD) has been developed, comprising the following nine herbal components: Cortex mori (Sang Bai Pi), Cortex lycii (Di Gu Pi), Polygonum cuspidatum (Hu Zhang), Scutellaria barbata (Ban Zhi Lian), Persicae semen (Tao Ren), Pheretima (Di Long), Perillae fructus (Su Zi), Lepidii semen (Ting Li Zi), and Glycyrrhiza uralensis (Gan Cao). Some studies have demonstrated the efficacy of QTJD in suppressing systemic inflammatory responses induced by MP infection. In vivo and in vitro investigations have revealed that QTJD exerted therapeutic effects against MPP by increasing butyrate-producing bacteria in the intestinal tract of mice, elevating butyrate levels, and activating the GPR109A receptor to inhibit the NLRP3-caspase-1-IL-1β pathway [30]. Notably, individual herbs with channel-collateral regulating properties, such as P. cuspidatum and S. barbata, exhibit direct inhibitory effects against MP in vitro. In a previous study, this formula significantly reduced TNF-α and IL-6 levels, inhibited NF-κB activation, and decreased LOX-1 and PLA2 expression, while upregulating RvD1 and PD1 levels in MPP model mice [31]. QTJD, as a traditional Chinese medicine compound, has demonstrated promising clinical efficacy in treating MPP. It offers a potentially effective alternative or complementary therapy that is less likely to induce drug resistance, addressing the global public health crisis of rising antibiotic resistance rates during MPP treatment. Moreover, this represents a shift from traditional “direct bactericidal” approaches toward “host modulation”, controlling infection by reshaping the gut microbiota and regulating immune balance. The efficacy of QTJD offers novel biological insights, particularly through mechanisms such as the “gut-lung axis.” As a multi-targeted, holistic treatment, this traditional Chinese herbal formula may simultaneously achieve comprehensive effects: reducing inflammatory damage, repairing the intestinal barrier, and modulating systemic immunity.
This study aimed to explore the mechanism of action of QTJD on MPP using network pharmacology and in vitro experiments. We hypothesized that QTJD affects macrophage polarization through butyrate-GPR109A regulation of inflammatory pathways.

2. Results

2.1. HPLC/ESI-MS Determined the Active Ingredients in QTJD

A total of 20 active ingredients were identified, including Syringaldehyde, Gancaonin U, Glyinflanin A, Quercetin-3-O-β-d-glucose-7-O-β-d-gentiobiosiden, Arachic acid, Luteolin, Resveratrol, Apigenin, Luteolin 7-O-glucuronide, Gancaonin A, Glycyrrhizin, Sinapinic acid, Citric acid, Amygdalinic acid, Tryptophan, Mulberroside C, Licuraside, Polydatin, Rosmarinic acid, and Glycyrrhizic Acid (Appendix A).

2.2. Network Pharmacology Results Analysis

2.2.1. Potential Targets of QTJD for the Treatment of MPP

To explore the potential targets of QTJD for treating MPP, 20 chemicals were imported into the SwissTargetPrediction (STP) database after obtaining the CAS numbers or structures-data file of potentially active compounds from PubChem. Compounds with prediction scores greater than 0 were selected for further analysis, ultimately mapping a list of potential drug targets for QTJD-active compounds (Figure 1a). To identify disease targets, we searched the Online Mendelian Inheritance in Man, GeneCard, DrugBank, and Genetic Association Databases using the keyword “Mycoplasma pneumoniae” and obtained the disease targets after deduplication. Candidate component targets and MPP-related targets were imported into the Venny online software to construct the intersecting targets of the QTJD and MPP, and 92 intersecting targets were found out of 257 QTJD targets and 1767 MPP targets (Figure 1b,c).

2.2.2. Protein–Protein Interaction (PPI) Network Construction

To study and visualize the linkage of drug-disease common targets, we imported drug–disease common targets into the STRING database, specifying “human” as a protein species. We set the minimum interaction threshold to 0.4 and generated protein-protein interaction (PPI) networks (Figure 2).

2.2.3. GO and KEGG Pathway Enrichment Analysis

To further explore the potential pathways for QTJD treatment of MPP, GO and KEGG were used to perform enrichment analysis using the DAVID database, and the results were visualized using a bioinformatics platform. The statistical significance threshold for enrichment analysis was set at p ≤ 0.05 (Figure 3), and KEGG analyzed the top 40 pathways. The darker red color indicates higher significance. KEGG analysis results revealed 163 pathways, including pathways in cancer, PI3K-Akt, MAPK, HIF-1, T cell receptor, TNF, and AGE-RAGE, involving cancer, immunity, infection, metabolism, and cellular signaling. Among these, inflammatory pathways such as MAPK, PI3K-Akt, and TNF signaling may be relevant pathways in the mechanism of QTJD treating MPP (Figure 3e). Activation of the MAPK pathway led to macrophage M1 polarization and exacerbated the inflammatory response, suggesting that QTJD has the potential to regulate MPP-induced macrophage polarization (Figure 3f).

2.2.4. Molecular Docking Results

Ten key ccore target (STAT3, AKT1, CASP3, ESR1, HIF1A, CTNNB1, CCND1, JUN, SRC, TNF) and nine representative active compounds from QTJD (Luteolin, Apigenin, Gancaonin U, Gancaonin A, Rosmarinic acid, Glycyrrhizin A, Resveratrol, Amygdalinic acid, Mulberroside C) were subjected to molecular docking. All binding energies were negative. Notably, GPCRs exert their effects by regulating the MAPK pathway [32,33,34], and JUN serves as a key protein in the PPI network and a core target in MAPK. To validate the downstream pathways of QTJD in treating MPP, we employed JUN alongside all key compounds of QTJD (Luteolin, Apigenin, Gancaonin U, Gancaonin A, Rosmarinic acid, Glycyrrhizin A, Resveratrol, Mulberroside C). All compounds yielded affinity values below −1.2 kcal/mol, as demonstrated through 3D and 2D visualizations (Figure 4). These results indicate that QTJD may exert its effects through the MAPK pathway.

2.3. Cell Experiment Results

2.3.1. QTJD Parties Inhibit MPP Inflammatory Responses

To screen the optimal drug-containing serum concentration for the subsequent study, we first determined the macrophage inhibition rate of the blank control group, MP model group, and QTJD high-, medium-, and low-dose groups using CCK-8. The macrophage inhibition rate = [(Ac − As)/(Ac − Ab)] × 100%, where As represents experimental group absorbance, Ac represents MP group absorbance, and Ab represents control group absorbance. Compared with the blank group, the AM inhibition rate of the MP group was higher (p < 0.01). However, the macrophage inhibition rate in the high-dose group was significantly lower than that of the model group (p < 0.05). The difference in macrophage inhibition rates between the medium- and low-dose groups and the model group was not significant (Figure 5).

2.3.2. QTJD Modulates Macrophage Polarization via Butyric Acid

Our preliminary clinical and animal studies have found that QTJD increases the abundance of butyric acid-producing bacteria, including Rumenococci and C. butyricum, in the intestinal microbiota, thereby raising butyric acid levels in vivo. To investigate whether QTJD regulates macrophage polarization by increasing butyric acid concentration for MPP treatment, we extracted lung macrophages from mice using alveolar lavage fluid. We used butyric acid as a positive control. The results showed that in MP-infected macrophages, QTJD significantly increased macrophage cell viability (p < 0.05) (Figure 6a). It significantly decreased the expression of CD86 and CXCL10 (M1 markers) while significantly increasing the expression of CD206 and Arg-1 and MRC-1 (M2 markers) (p < 0.01) (Figure 6b,c). QTJD also induced an increase in the anti-inflammatory cytokine IL-10 in macrophages, inhibited the production of pro-inflammatory cytokines IL-6 and TNF-a (Figure 6d), and promoted macrophage polarization to the M2, which had the same effect as that of the butyric acid group, with no substantial difference between the two groups. Collectively, QTJD increased butyric acid levels, favored macrophage polarization to the M2 phenotype, and inhibited macrophage polarization to the M1 phenotype.

2.3.3. QTJD Regulates Macrophage Polarization via Butyric Acid-GPR109A

GPR109A is a receptor through which butyric acid acts, and the results of the in vivo experiments showed that QTJD operated through the butyric acid-GPR109A pathway with niacin serving as a specific GPR109A activator. To verify that QTJD regulates macrophage polarization through butyric acid-GPR109A, we extracted bone marrow macrophages from wild-type mice and GPR109A−/− mice, respectively. The results showed that the wild-type bone marrow macrophages in MP-infected macrophage conditions in the QTJD, butyric acid, and nicotinic acid groups significantly increased cell viability and decreased expression of CD86 and CXCL10 (M1 markers). They also show significantly increased CD206, Arg-1, and MRC-1 (M2 marker) (p < 0.01) expression, induced an increase in macrophage IL-10, inhibited IL-6 and TNF-α production, and promoted macrophage polarization to M2, similar to the results in lung macrophages. GPR109A−/− bone marrow macrophages showed opposite results, with no remarkable differences in cell viability, CD86 and CXCL10 (M1 markers), CD206, Arg-1, and MRC-1 (M2 markers), or the cytokine IL-10, IL-6, and TNF-α levels among macrophages in the MP model, QTJD, butyric acid, and nicotinic acid groups. Thus, QTJD promoted macrophage polarization to the M2 phenotype through the butyric acid-GPR109A pathway to alleviate the inflammatory response (Figure 7).

2.3.4. Effect of QTJD on MAPK Pathway

The previous network pharmacology analysis pathways through which QTJD acted for MPP treatment highlight the MAPK pathway as an important pathway involved in cellular immunity and macrophage polarization. To further explore how QTJD regulates macrophage polarization through the butyric acid-GPR109A pathway, we extracted bone marrow macrophages from the wild-type mice and the GPR109A−/− mice, respectively. The results indicated that in wild-type bone marrow macrophages, the QTJD, butyric acid, and nicotinic acid groups significantly inhibited the ERK1/2, p38, and JNK1/2 pathways compared with the model group (p < 0.01) (Figure 8a). No significant difference was observed in the effect of GPR109A−/− bone marrow macrophages on the ERK1/2, p38, and JNK1/2 pathways in the butyric acid and nicotinic acid groups compared with the model group. In comparison with the model group, no significant difference was observed in the effect of QTJD on the ERK1/2 pathway. However, QTJD significantly inhibited the p38 and JNK1/2 pathways compared with the model, butyric acid and nicotinic acid groups (p < 0.01) (Figure 8b). In brief, GPR109A affects macrophage polarization primarily through MAPK, particularly ERK1/2.

3. Discussion

This study identified the mechanism by which QTJD treats MPP through network pharmacology and in vitro validation. The results indicate that QTJD inhibits macrophages by regulating the butyrate-GPR109A-MAPK axis, preventing M1 polarization of macrophages and suppressing IL-6 and TNF-α expression (Figure 9). This study reveals that QTJD alleviates MPP through the gut microbiota metabolite butyrate-GPR109A-MAPK pathway, providing a novel therapeutic approach for MPP.

3.1. Network Pharmacology Analysis of Compound Mass Spectrometry Components and Key Pathway Screening

Macrolide antibiotics, including azithromycin, are the first-line drugs for the treatment of MPP [35]. However, refractory mycoplasma infections and severe MPP are gradually increasing due to the interference of antibiotics with intestinal dysbiosis as well as the increase in resistance of MPP [36,37]. Therefore, it is crucial to seek a highly effective treatment modality. Based on the foundation of TCM combined with clinical practice, the group proposed treating MPP using the theory of “complex disease,” represented by QTJD, composed of Cortex mori, Cortex lycii, P. cuspidatum, S. barbata, Persicae semen, Pheretima, Perillae fructus, Lepidii semen, and G. uralensis. This formula has proven effective in treating MPP in the clinic, but the mechanism of action remains unclear.
The multi-component and multi-target characteristics of TCM compounding have both favorable and unfavorable effects. Alternatively, individualized treatment, multi-drug compounding and reconciliation, and multi-method action [38,39] are clinically effective with minimal side effects. However, the active ingredients and mechanism of action of TCM compounds are difficult to clarify. In this study, 20 active ingredients, including eugenol, glycyrrhizin, quercetin, arachidonic acid, lignoceric acid, and albuterol, were determined in QTJD using an HPLC/ESI-MS assay and network pharmacology. These compounds were found to regulate the MAPK signaling pathway when treating MPP.

3.2. QTJD Treats MPP by Regulating Macrophage Polarization via the Butyrate-GPR109A Axis

The innate immune system is the first weapon of invading microorganisms [40]. Macrophages are considered the vanguard of the immune response in the lungs and are critical regulators of host innate immunity during bacterial infections and pneumonia. Following MPP infection, tracheal macrophages promote lymphangiogenesis of VEGF-C and VEGF-D, suggesting that macrophages play a crucial role in lymphangiogenesis during acute inflammation [41]. Additionally, macrophages can be classically or alternatively activated to polarize into pro-inflammatory M1-type and anti-inflammatory M2-type cells, respectively, which is an essential pathway for macrophages in immune regulation [42]. Liang et al. [43]. demonstrated that Yes-associated protein 1 (YAP1) inhibitors alleviate lipopolysaccharide (LPS)-induced pulmonary inflammatory injury by promoting M2 macrophage polarization. Similarly, our results showed that QTJD inhibited MP-induced macrophage activation and significantly reduced the expression of M1 markers, such as CD86, CXCL10, MRC-1, and other M1 markers, while significantly increasing the expression of CD206, Arg-1, and other M2 markers, alleviating the inflammatory response caused by MPP.
The immune crosstalk between intestinal flora and lung microbiota primarily operates in three ways, including direct migration of immune cells (ILC2s, ILC3s, TH17) [44,45], metabolites transported to the lungs via blood circulation (SCFAs), and soluble microbial fraction transfer [46,47]. Our preliminary clinical and animal experiments have demonstrated that QTJD can regulate the dysbiosis of the intestinal flora caused by MPP, increase the abundance and production of butyric acid in the intestine, and enhance butyric acid production. Butyric acid plays a vital role in immunomodulation. A small portion of it can be transported to the lungs through the hepatic portal vein, where it plays a role in the circulatory system [48]. Most of the butyric acid can be used in the intestines to regulate immune cells and cytokine production, including ILC2s and Treg/TH17 cells. Therefore, in this experiment, we prepared QTJD-containing sera that included immune cell migration and the transfer of soluble microbial components. The results showed no significant difference between the QTJD-containing serum group and the butyric acid group in regulating the polarization of lung macrophages. The in vitro experiments demonstrated that QTJD could exert its effects by increasing butyric acid.
The mechanism of action of butyric acid includes the inhibition of histone deacetylase (HDAC) [49] to regulate gene expression and the activation of G protein-coupled receptors (GPR41, GPR43, and GPR109A). Previous animal experiments conducted by our research group showed that butyric acid inhibited the NLRP3-caspase-1-IL-1β pathway by activating the GPR109A receptor and the treatment of MPP. Our research obtained similar results, specific GPR109A activator niacin promoted macrophage M2-type polarization and inhibited inflammatory response, which was not remarkably different from the butyric acid or QTJD groups. Conversely, the GPR109A−/− macrophages, QTJD group, butyric acid group, and niacin group did not show significant differences compared with the MP model group, which proved that QTJD regulated macrophage polarization primarily through the butyric acid-GPR109A.

3.3. Mechanism of MAPK Signaling Pathway Mediating Macrophage Polarization Regulation by GPR109A

The butyric acid-GPR109A receptor can regulate MAPK, PI3K, mTOR, and other pathways. Among them, MAPK is a group of evolutionarily conserved serine-threonine kinases that can be classified into four subfamilies, each representing one of the four classical MAPK pathways [50]. MAPK also plays a vital role in regulating systemic macrophage polarization [51,52]. In the locomotor system, osteoarthritis is aggravated by LPS and IFN-γ, which activate the MAPK signaling pathway, including p-JNK, p-ERK, and p-P38, to increase the M1 phenotype [53]. Simultaneously, ginsenoside (Kin) dose-dependently inhibits MAPK signaling, reducing its activation and highly expressing CD206 and Arg-1, phenotypic markers of M2; repolarized M1 macrophages to M2 phenotype, which could be helpful in treating osteoarthritis [54]. In the context of metabolic diseases, puerarin can reduce the release of inflammatory mediators by inhibiting the activation of p38 MAPK and ERK1/2, exert anti-inflammatory effects, enhance the expression of IL-10 and Arg-1, and increase the polarization of macrophages to the M2 phenotype, which synergistically improves diabetic wounds [55]. Ou-mei pills are also validated to inhibit the MAPK signaling pathway through a combination of network pharmacology and experimental validation, increasing the M2 phenotype for treating IBD [56]. The exact mechanism is also observed in macrophages in the lungs, where they can regulate the polarization of lung macrophages by inhibiting the MAPK signaling pathway to treat chronic lung diseases. To further clarify the mechanism of action of QTJD, based on KEGG pathway analysis and the results of several studies, we used Western blotting to explore the MAPK pathway downstream of GPR109A. The results showed that GPR109A could inhibit the MAPK pathway, particularly ERK1/2. Similarly, multiple in vitro studies have consistently demonstrated that macrophage M2 polarization can be regulated through the ERK1/2 pathway of the MAPK signaling cascade [57,58], suggesting that QTJD can regulate macrophage polarization through the butyric acid-GPR109A-MAPK (ERK1/2) pathway to alleviate MPP. Additionally, GPR109A macrophages did not activate JUN1/2 and p38 of MAPK, possibly due to the multi-targeting of the herbal complex, and the multi-method action inhibited the JUN1/2 and p38 pathways of MAPK, among other macrophage responses.

3.4. Advantages and Limitations

This study combines network pharmacology with in vitro experiments to provide insights into the immunomodulatory mechanisms of traditional Chinese medicine in treating MP infection. It offers an alternative or complementary therapeutic approach targeting the “gut-lung axis” for MPP treatment, which is holistic, regulates the entire system, and is less likely to induce drug resistance. However, several limitations exist in the research process. First, although our prior animal studies demonstrated that QTJD and butyrate increased fecal butyrate concentrations in MPP-infected mice, this study did not address butyrate levels in drug-containing serum. Additionally, interspecies differences in gut microbiota composition and butyrate concentrations may exist between rats and mice. Second, to explore QTJD’s potential as an alternative or adjunct therapy against antibiotic resistance beyond its immunomodulatory effects, our team should conduct further studies on resistance and antimicrobial activity. Due to the multi-targeted and multi-pathway nature of traditional Chinese medicine, the precise mechanisms of action for QTJD and its individual herbal components remain difficult to determine. Therefore, the specific pathways and mechanisms of QTJD and its intestinal metabolites (including butyrate) within the lung-gut axis remain to be elucidated. This can be explored through methods such as histological tracing, fluorescent labeling, and isotope analysis. Concurrently, multi-omics analysis and single-cell sequencing technologies can further clarify the mechanisms of action of individual compounds within QTJD.

4. Materials and Methods

4.1. Instruments and Reagents

The instruments and reagents used in this study are as follows: Sodium butyrate (Beijing Solarbio Technology Co., Beijing, China; IS0190), MP international standard strain MPFH (ATCC, Manassas, VA, USA, catalogue number ATCC15531), MP strain culture medium PPLO (catalogue number: LA7090), procured from Beijing Solarbio Technology Co., Ltd. Niacin (Beijing, China, batch number: 20220803) procured from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Fetal bovine serum (GIBCO, Waltham, MA, USA), RPMI-1640 (Biosharp, Beijing, China), CCK-8 (Biosharp), penicillin-streptomycin mixture (100×) (Solarbio, Beijing, China), DM (Biosharp), FBS (Gibco, USA), M-CSF (Solarbio), erythrocyte lysate (Solarbio), fluorescence quantitative polymerase chain reaction instrument (Shanghai Hongshi Medical Science & Technology Co., Ltd., Shanghai, China), Palm Centrifuge (Biyuntian, Shanghai, China), trypsin-EDTA (0.25%) (Solarbio), vortex mixer, ultra-clean bench (Su Jing Antai, Suzhou, China), and ultra-micro spectrophotometer (Wuyi Technology, Hangzhou, China).

4.2. Preparation of QTJD

QTJD consisted of Morus alba bark (Sang Bai Pi), Lycium barbarum bark (Di Gu Pi), P. cuspidatum root (Hu Zhang), S. barbata root (Ban Zhi Lian), Prunus persica seed (Tao Ren), Pheretima (Di Long), Perilla frutescens fruit (Su Zi), Lepidium semen (Ting Li Zi), and G. uralensis (Gan Cao), purchased from Longhua Hospital affiliated with Shanghai University of Traditional Chinese Medicine (Shanghai, China). The drugs conformed to the standards described in the 2020 edition of the Pharmacopoeia of the People’s Republic of China. Clinically, MP frequently affects children. Referencing the pharmacopoeia, the total dosage ranged between 1/2 and 2/3. Based on clinical practice, the dry weight ratio of the QTJD formulation was 2:2:2:2:2:2:2:2:1, with a total dry weight of 51 g for the nine herbs. The components of QTJD are listed in Table 1. The herbal materials for the clear decoction were soaked for half an hour. After soaking, the materials underwent two rounds of decoction. The resulting decoction liquids were filtered and concentrated to 27.3 mL of crude drug decoction. Drying yielded 15.5 g of dry extract, with a calculated dry extract yield of 30.4%. with a drug-to-extract ratio (DER) of 3.29:1 [59] (i.e., 3.29 g crude drug yields 1 g dry extract). The dry extract was thoroughly ground with a 0.5% sodium carboxymethylcellulose solution and diluted to a final concentration of 0.56 g/mL (dry extract basis) to prepare an oral suspension.

4.3. The Active Components of QTJD Were Analyzed Using High-Performance Liquid Chromatography–Electrospray Ionization Mass Spectrometry (HPLC/ESI-MS)

Positive and negative ion modes were determined by HPLC/ESI-MS for the mixed aqueous extract of nine herbal medicines, as reported in our previous report (Appendix A).

4.4. Network Pharmacology

4.4.1. Screening of QTJD-Active Ingredients

The Chemical Abstracts Service (CAS) numbers of the active ingredients determined by HPLC/ESI-MS were obtained by searching the PubChem database (https://pubchem.ncbi.nlm.nih.gov/) [60]. Subsequently, the CAS numbers were input into the SwissTargetPrediction platform (http://www.swisstargetprediction.ch/, accessed on 19 January 2026) [61,62,63] to predict and complement their associated protein targets. Finally, compounds obtained from various databases were combined, and any duplicate entries were eliminated using the UniProt database (https://www.uniprot.org/) [64] to convert the names of targets associated with these. The validated compounds and drug targets were imported into Cytoscape 3.7.1 software (Informer Technologies, Inc., Los Angeles, CA, USA) [65], and a “compound-target” network diagram was created.

4.4.2. Identification of Disease-Related Targets

Using “MPP” as the keyword, we used the OMIM database (https://omim.org/), the DrugBank database (https://go.drugbank.com/) [66,67], the GeneCards database (https://www.genecards.org/) [68], the GAD database (https://geneticassociationdb.nih.gov/) (accessed on 21 July 2024) [69], etc., to identify the targets of “Mycoplasma pneumoniae”, and obtained the disease targets after deduplication. Candidate targets and MP-associated targets were imported into Venny2.1.0 online software (https://bioinfogp.cnb.csic.es/tools/venny/, accessed on 19 January 2026) to construct a clear-lung and clear-vessel solution and create a Venn diagram of the intersecting targets of QTJD and MPP.

4.4.3. Building a Protein–Protein Interaction (PPI) Network

The PPI network was constructed by importing the common intersecting target proteins of QTJD and MPP into the STRING database (https://www.string-db.org/) [70]. The species was set to “Homo sapiens”, and the confidence level was set to >0.4. The PPI network was visualized using Cytoscape 3.7.1. Hub target and potential functional modules were further analyzed using the plugins cytoHubba and MCODE.

4.4.4. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Enrichment Analysis

To elucidate the effects of the candidate components of QTJD on MPP, GO and KEGG enrichment analyses were performed using the DAVID database (https://davidbioinformatics.nih.gov/) [71,72], and the results were visualized using a bioinformatics platform (bioinformatics.com.cn). The significance threshold for the enrichment analysis was set at p ≤ 0.05. The DAVID data were analyzed in R 4.3.3 (R Foundation for Statistical Computing, Vienna, Austria) [73,74,75,76] to map the pathways and enrich the intersecting targets onto the pathway maps.

4.4.5. Molecular Docking

Retrieve the three-dimensional structures of active compounds and their corresponding target proteins from the PubChem database and the Protein Data Bank (https://www.rcsb.org/), respectively. AutoDock 4 software (The Scripps Research Institute, La Jolla, CA, USA) [77] was used to perform flexible docking of key targets in the intersecting targets with the core components in QTJD. A negative binding energy indicates that the compound exhibits binding activity towards the receptor. A binding energy below −1.2 kcal/mol signifies strong binding activity [78]. And PyMol 3.0 software (Schrödinger, LLC, New York, NY, USA) [79] was used to visualize the docking sites in three dimensions and use Ligplot+ 2.2.5 [80] for 2D visualization.

4.5. QTJD-Containing Serum Preparation

Forty SPF-grade Sprague-Dawley rats (male, 6 weeks old, weighing 200 ± 10 g) were purchased from Shanghai Slaughter Laboratory Animal Co. (Shanghai, China) and acclimatized for 1 week. The rats were randomly categorized into four groups: high-dose (High group), medium-dose (Medium group), low-dose (Low group), and blank (CON group) (n = 10). Sample size calculations were based on prior animal studies evaluating butyrate concentrations in mouse feces following MP infection and after QTJD treatment. Calculations were performed using software (version 3.1.9.7, G*Power) [81]. QTJD was administered by gavage, and the dose conversion for rats was performed using a pharmacological experimental method. The total crude drug amount of QTJD is 51 g. Based on a standard human body weight of 70 kg, the human dose is calculated as 0.73 g crude drug/kg/day. According to the body surface area-based dose equivalent conversion principle (using a human-to-rat coefficient of 6.3), the rat clinical equivalent dose is calculated to be approximately 4.6 g crude drug/kg/day. Based on this, three experimental dose groups—low, medium, and high—were established at approximately 1, 2, and 4 times the clinical equivalent dose, respectively. The low-dose group received QTJD 1.4 g dry extract/kg/day (4.6 crude drug/kg/day), the medium-dose group received QTJD 2.8 g dry extract/kg/day (9.2 crude drug/kg/day), and the high-dose group received QTJD 5.6 g dry extract/kg/day (18.4 crude drug/kg/day) at a concentration of 0.56 g/mL (dry extract basis), with the volume of the drug by gavage set at 2 mL/day. The blank group was administered 2 mL/200 g of saline once daily for 7 days. Samples with improper drug administration, issues during blood collection (e.g., incorrect timing, severe hemolysis, clotting, or contamination), or inadequate serum processing were excluded to ensure consistent and reliable serum quality. No samples were excluded in this study. At the final dose, rats were given 3% pentobarbital intraperitoneally to anesthetize them. Blood was collected from the abdominal aorta and labeled. The serum was centrifuged and inactivated in a water bath. The serum was then filtered and stored in a refrigerator at −80 °C for subsequent in vitro experiments.

4.6. Cell Experiments

4.6.1. MP Culture

After thawing, the MP strain was introduced into the liquid culture medium, and 1 mL of the bacterial solution was aspirated and maintained at 37 °C under 5% CO2. The culture is complete when the medium changes from red to translucent yellow without precipitation.

4.6.2. Cell Culture

Acquisition of Lung Macrophages
Alveolar-derived macrophages (AM) were obtained by collecting alveolar lavage fluid from wild-type C57BL/6 mice (n = 5). One milliliter of pre-cooled lavage fluid [90% Dulbecco’s modified Eagle medium (DMEM)—high glucose, 10% FBS, 1% double antibody, and 100 ng/mL macrophage colony-stimulating factor (M-CSF)] was injected into the lungs, and the infusion was repeated four to five times. The collected lung lavage fluid was centrifuged, and the supernatant was discarded, resulting in a precipitation of cells. The cells were resuspended and inoculated with 90% DMEM high glucose medium, 10% FBS, 1% double antibody, and 100 ng/mL M-CSF culture medium at 37 °C. The culture system was subsequently incubated at 37 °C for 24 h, after which the unattached cells were washed away. The remaining adherent cells were AM cells. The blank control group was cultured with normal serum. The MP group was cultured with normal serum and infected with 1 mL of MP at 1 × 107 CCU/mL for 3 h. The butyrate and nicotinic acid groups had 1 mM butyrate and nicotinic acid, respectively, added to the cell culture medium and incubated for 12 h, then infected with 1 mL of MP at 1 × 107 CCU/mL for 3 h. QTJD group: Cell culture medium supplemented with low, medium, and high concentrations (10%) of Chinese herbal medicine-containing serum. After incubation for 12 h, cells were infected with 1 mL of MP at a concentration of 1 × 107 CCU/mL for 3 h. The cell activity was determined by CCK-8 after 24 h of incubation.
Acquisition of Bone Marrow-Derived Macrophages (BMDM)
Bilateral femurs and tibiae from C57BL/6 and GPR109a knockout (GPR109A−/−) mice (n = 5) were isolated to obtain BMDM. The femur was obtained by stripping the leg muscles from the hind limbs of mice and transferring it to pre-cooled phosphate-buffered saline (PBS) containing 2% bis-antibodies. The femoral epiphysis was washed three times, and the femur was rinsed repeatedly using 5 mL of pre-cooled wash solution. The rinsing solution was collected, filtered through a 70 µm cell sieve to remove residual bone and tissue, and then centrifuged at 4 °C, 280× g. The supernatants were discarded, and the BMDM were cultured in a 37 °C implantation solution (DMEM + 10% FBS). The supernatant was discarded, and the precipitate was resuspended in a 37 °C planting solution (DMEM + 10% FBS +1% dual antibody + 100 µg/mL M-CSF) and incubated at 37 °C in an incubator. The cells were categorized into the normal control serum group, MP model group, QTJD serum group, butyric acid group, and nicotinic acid group. Bone marrow-derived macrophages were collected (days 5–7) for CCK-8, flow cytometry, polymerase chain reaction, enzyme-linked immunosorbent assay (ELISA), and protein blotting.

4.6.3. CCK-8 Method to Screen for Optimal Concentration of QTJD-Containing Serum

Cells in the logarithmic growth phase were digested with trypsin. A total of 100 µL was transferred into a 96-well culture plate at a density of 5 × 103 cells/well. The cells were divided into the MP model group and the QTJD high-, medium-, and low-dose groups. Each cell type was inoculated into three identical wells as duplicate wells per plate. A total of 100 µL of culture medium was used as a blank control. The cells were then cultured in 5% CO2 at 37 °C for 0 and 48 h. Subsequently, CCK-8 and serum-free essential medium were mixed in a volume ratio of 1:10 and incubated in an incubator for 1 h. Absorbance at 450 nm was measured using an enzyme meter, and the value for each plate was recorded.

4.6.4. Macrophage Activity Assay

Cells were treated with the blank control, MP, QTJD (optimal concentration), and butyrate group for 0 and 48 h. Cell Counting Kit-8 (CCK-8) solution was mixed with serum-free essential basal medium at a 1:10 volume ratio. A 100 µL aliquot of this mixture was added to each well containing the test samples and incubated at 37 °C in a 5% CO2 incubator for 1 h. Absorbance at 450 nm was measured using a microplate reader and recorded.

4.6.5. Flow Cytometry: Detection of CD86\CD206 Level

The cells were collected into centrifuge tubes, washed 2–3 times with PBS, and resuspended by adding PBS. Except for the blank group, the dyes M0: F4/80, M1: CD80, and M2: CD206 were added and incubated at 4 °C for 30 min. The cells were subsequently washed, PBS was added, and the samples were centrifuged. The supernatant was discarded, and a machine assay was performed. The data were analyzed using FlowJo10.8.1 (FlowJo™ v10.8 Software, BD Life Sciences, Lakes, NJ, USA) [82].

4.6.6. RT-PCR: Detection of CXCL10, MRC-1, Arg-1 Levels

Tissue was lysed with Trizol reagent, and total ribonucleic acid was extracted and examined for concentration and purity. Complementary deoxyribonucleic acid (cDNA) was synthesized by reverse transcription using a reverse transcription kit. A volume of 2 μL of cDNA was used as the template, and SYBR Green was used to detect CXCL10, MRC-1, and Arg-1 levels in the sample. The amplification was carried out by SYBR Green under the following reaction conditions: 95 °C for 10 min, 95 °C for 15 s, 60 °C for 1 min, 40 cycles. This was followed by 95 °C for 15 s, 95 °C for 1 min, and 95 °C for 15 s. Amplification was carried out according to the 2−ΔΔCt method. The primers required for the experiment are shown in Table 2.

4.6.7. ELISA: Determination of TNF-α, IL-6 and IL-10 in the Supernatants

The optical density of the samples was measured at the corresponding wavelengths using the Elabscience kit instructions (Wuhan, China).

4.6.8. Western Blot Analysis of MAPK

Macrophage-containing samples were lysed in radioimmunoprecipitation assay buffer with phosphatase/protease inhibitors, followed by protein quantification using the bicinchoninic acid assay. After denaturation (100 °C, 5 min), equal protein amounts mixed with loading buffer were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes. Membranes were blocked with 5% bovine serum albumin (1 h), subsequently incubated overnight at 4 °C with primary antibodies targeting p38MAPK, p-p38MAPK, p44/42MAPK, p-p44/42MAPK, SAPK/JNK/, p-SAPK/JNK, Tubulin, and β-Actin. After washing, membranes were probed with horseradish peroxidase-conjugated secondary antibodies (anti-rabbit or anti-mouse immunoglobulin G [IgG], 1 h, RT). Protein bands were visualized via the Odyssey Infrared Imaging System and quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA) [83] for grayscale analysis.

4.6.9. Statistical Analysis

Data were processed and plotted using GraphPad Prism 10.1.2 software (GraphPad Software, San Diego, CA, USA) [84]. Normally distributed quantitative data were expressed as mean ± standard deviation. Intergroup differences were analyzed using one-way analysis of variance (ANOVA) for normally distributed data, followed by Tukey’s multiple comparison test. Non-normally distributed data were analyzed using the Kruskal–Wallis test. Differences were considered statistically significant when the P value was less than 0.05.

5. Conclusions

This study confirms that QTJD can improve MPP-induced lung injury by regulating macrophage polarization through the core mediator of the gut–lung axis mediator butyric acid-GPR109A-MAPK. These findings offer an innovative immunotherapy for treating MPP. Building upon future research into drug resistance, it holds promise for pioneering a highly promising non-antibiotic treatment pathway to address the increasingly urgent challenge of drug-resistant severe MPP. Future follow-up studies should integrate multi-omics and single-cell sequencing technologies to investigate the mechanism of QTJD in regulating “flora-metabolism-immunity” and further evaluate the therapeutic potential of QTJD in other inflammatory lung diseases. These findings indicate the importance of optimizing the active ingredients of QTJD to provide a new direction for clinical and anti-inflammatory drug development.

Author Contributions

Conceptualization, Z.L.; methodology, Z.L.; software, Z.L.; validation, Y.J.; formal analysis, R.S. and Q.F.; resources, Y.J.; data curation, Z.L. and Q.F.; writing—original draft preparation, Z.L.; writing—review and editing, Y.J.; visualization, Z.L.; supervision, Y.J.; project administration, Y.J.; funding acquisition, Y.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China, Nos. 82174127 and 82374515.

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Animal Care and Use Committee of SHRM (Approval number SYXK(hu)2021-0007 and retrospective approval date 7 October 2023).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
MPP Mycoplasma pneumoniae pneumonia
QTJDQingfei Tongluo Jiedu formula
PPIProtein–protein interaction
GPR109AG-protein-coupled receptor 109A
MAPKMitogen-activated protein kinase
mTORMechanistic target of rapamycin
TNFTumor necrosis factor
ILInterleukin
STATSignal transducer and activator of transcription
CDCluster of Differentiation
HPLC/ESI-MSHigh-performance liquid chromatography–electrospray ionization mass spectrometry
CASChemical Abstracts Service
GADGenetic Association Database
GOGene Ontology
KEGGKyoto Encyclopedia of Genes and Genomes
PI3K/AktPhosphoinositide 3-Kinase/Protein Kinase B
GPCRsG-protein-coupled receptor
SCFAsShort-chain fatty acids
16SrDNA16S rRNA genes
NF-κBNuclear factor kappa-light-chain-enhancer of activated B cells
LOX-1Lectin-like oxidized low-density lipoprotein receptor 1
PLA2Phospholipase A2
RvD1Resolvin D1
PD1Programmed cell death protein 1
GPR109−/−G-protein-coupled receptor 109 knockout mice
FBSFetal bovine serum
RPMIRoswell Park Memorial Institute (medium)
CCK-8Cell Counting Kit-8
DMEMDulbecco’s modified Eagle medium
M-CSFMacrophage colony-stimulating factor

Appendix A

Pharmaceuticals 19 00212 g0a1
Figure A1. The aqueous extract of QTJD was characterised by HPLC/ESI-MS. (a) Active constituents 1–12 (b) Active constituents 13–20.
Figure A1. The aqueous extract of QTJD was characterised by HPLC/ESI-MS. (a) Active constituents 1–12 (b) Active constituents 13–20.
Pharmaceuticals 19 00212 g0a1
Title of data: Determination of active ingredients in QTJD by HPLC/ESI-MS method.
Description of data: The water extract of nine mixed Chinese medicinal materials was measured by high-performance liquid chromatography coupled with electrospray mass spectrometry (HPLC/ESI-MS) in positive-ion and negative mode. Twenty compounds (1–20), with retention times of 0.9 min, 1.1 min, 5.2 min, 5.9 min, 10.0 min, 14.2 min, 14.8 min, 15.4 min, 17.8 min, 21.0 min, 22.7 min, 23.1 min, 1.4 min, 3.2 min, 3.7 min, 4.4 min, 14.5 min, 14.7 min, 17.0 min, and 21.8 min, were identified: Syringaldehyde (1), Gancaonin U (2), Glyinflanin A (3), Quercetin-3-O-β-d-glucose-7-O-β-d-gentiobiosiden (4), Arachic acid (5), Luteolin (6), Resveratrol (7), Apigenin (8), Luteolin 7-O-glucuronide (9), Gancaonin A (10), Glycyrrhizin (11), Sinapinic acid (12), Citric acid (13), Amygdalinic acid (14), Tryptophan (15), Mulberroside C (16), Licuraside (17), Polydatin (18), Rosmarinic acid (19) and Glycyrrhizic Acid (20). These 20 compounds were unambiguously identified by comparing the retention times and the MS data with the reference standards.

References

  1. Wang, Y.S.; Zhou, Y.L.; Bai, G.N.; Li, S.X.; Xu, D.; Chen, L.N.; Chen, X.; Dong, X.Y.; Fu, H.M.; Fu, Z.; et al. Expert consensus on the diagnosis and treatment of macrolide-resistant Mycoplasma pneumoniae pneumonia in children. World J. Pediatr. WJP 2024, 20, 901–914. [Google Scholar] [CrossRef]
  2. Yang, S.; Lu, S.; Guo, Y.; Luan, W.; Liu, J.; Wang, L. A comparative study of general and severe Mycoplasma pneumoniae pneumonia in children. BMC Infect. Dis. 2024, 24, 449. [Google Scholar] [CrossRef]
  3. Meyer Sauteur, P.M.; Beeton, M.L.; Uldum, S.A.; Bossuyt, N.; Vermeulen, M.; Loens, K.; Pereyre, S.; Bébéar, C.; Keše, D.; Day, J.; et al. Mycoplasma pneumoniae detections before and during the COVID-19 pandemic: Results of a global survey, 2017 to 2021. Eurosurveillance 2022, 27, 2100746. [Google Scholar] [CrossRef] [PubMed]
  4. Chen, Y.; Jia, X.; Gao, Y.; Ren, X.; Du, B.; Zhao, H.; Feng, Y.; Xue, G.; Cui, J.; Gan, L.; et al. Increased macrolide resistance rate of Mycoplasma pneumoniae correlated with epidemic in Beijing, China in 2023. Front. Microbiol. 2024, 15, 1449511. [Google Scholar] [CrossRef] [PubMed]
  5. Kutty, P.K.; Jain, S.; Taylor, T.H.; Bramley, A.M.; Diaz, M.H.; Ampofo, K.; Arnold, S.R.; Williams, D.J.; Edwards, K.M.; McCullers, J.A.; et al. Mycoplasma pneumoniae Among Children Hospitalized with Community-acquired Pneumonia. Clin. Infect. Dis. 2019, 68, 5–12. [Google Scholar] [CrossRef]
  6. Meyer Sauteur, P.M.; Beeton, M.L. Mycoplasma pneumoniae: Delayed re-emergence after COVID-19 pandemic restrictions. Lancet Microbe 2024, 5, e100–e101. [Google Scholar] [CrossRef]
  7. Bradley, J.S.; Byington, C.L.; Shah, S.S.; Alverson, B.; Carter, E.R.; Harrison, C.; Kaplan, S.L.; Mace, S.E.; McCracken, G.H., Jr.; Moore, M.R.; et al. The management of community-acquired pneumonia in infants and children older than 3 months of age: Clinical practice guidelines by the Pediatric Infectious Diseases Society and the Infectious Diseases Society of America. Clin. Infect. Dis. 2011, 53, e25–e76. [Google Scholar] [CrossRef]
  8. Gao, L.; Sun, Y. Laboratory diagnosis and treatment of Mycoplasma pneumoniae infection in children: A review. Ann. Med. 2024, 56, 2386636. [Google Scholar] [CrossRef] [PubMed]
  9. Kim, K.; Jung, S.; Kim, M.; Park, S.; Yang, H.J.; Lee, E. Global Trends in the Proportion of Macrolide-Resistant Mycoplasma pneumoniae Infections: A Systematic Review and Meta-analysis. JAMA Netw. Open 2022, 5, e2220949. [Google Scholar] [CrossRef]
  10. Cai, F.; Li, J.; Liang, W.; Wang, L.; Ruan, J. Effectiveness and safety of tetracyclines and quinolones in people with Mycoplasma pneumonia: A systematic review and network meta-analysis. eClinicalMedicine 2024, 71, 102589. [Google Scholar] [CrossRef]
  11. Meyer Sauteur, P.M.; Beeton, M.L. Pneumonia outbreaks due to re-emergence of Mycoplasma pneumoniae. Lancet Microbe 2024, 5, e514. [Google Scholar] [CrossRef]
  12. Xue, Y.; Wang, M.; Han, H. Interaction between alveolar macrophages and epithelial cells during Mycoplasma pneumoniae infection. Front. Cell. Infect. Microbiol. 2023, 13, 1052020. [Google Scholar] [CrossRef]
  13. Shao, J.; Li, J.; Weng, L.; Cheng, K.; Weng, W.; Sun, Q.; Wu, M.; Lin, J. Remote Activation of M2 Macrophage Polarization via Magneto-Mechanical Stimulation to Promote Osteointegration. ACS Biomater. Sci. Eng. 2023, 9, 2483–2494. [Google Scholar] [CrossRef]
  14. Zhao, K.; Huang, Z. TIMP1 promotes microglia M2 polarization through MAPK pathway to ameliorate early brain injury after ischemia. Hereditas 2025, 162, 119. [Google Scholar] [CrossRef]
  15. Chen, S.; Lu, Z.; Wang, F.; Wang, Y. Cathelicidin-WA polarizes E. coli K88-induced M1 macrophage to M2-like macrophage in RAW264.7 cells. Int. Immunopharmacol. 2018, 54, 52–59. [Google Scholar] [CrossRef] [PubMed]
  16. Wen, J.H.; Li, D.Y.; Liang, S.; Yang, C.; Tang, J.X.; Liu, H.F. Macrophage autophagy in macrophage polarization, chronic inflammation and organ fibrosis. Front. Immunol. 2022, 13, 946832. [Google Scholar] [CrossRef] [PubMed]
  17. Koenen, M.H.; de Groot, R.C.A.; de Steenhuijsen Piters, W.A.A.; Chu, M.; Arp, K.; Hasrat, R.; de Bruijn, A.; Estevão, S.C.; van der Vries, E.; Langereis, J.D.; et al. Mycoplasma pneumoniae carriage in children with recurrent respiratory tract infections is associated with a less diverse and altered microbiota. eBioMedicine 2023, 98, 104868. [Google Scholar] [CrossRef] [PubMed]
  18. Jiang, Y.; Bao, C.; Zhao, X.; Chen, Y.; Song, Y.; Xiao, Z. Intestinal bacteria flora changes in patients with Mycoplasma pneumoniae pneumonia with or without wheezing. Sci. Rep. 2022, 12, 5683. [Google Scholar] [CrossRef]
  19. Vital, M.; Karch, A.; Pieper, D.H. Colonic Butyrate-Producing Communities in Humans: An Overview Using Omics Data. mSystems 2017, 2, 10-1128. [Google Scholar] [CrossRef]
  20. Kircher, B.; Woltemate, S.; Gutzki, F.; Schlüter, D.; Geffers, R.; Bähre, H.; Vital, M. Predicting butyrate- and propionate-forming bacteria of gut microbiota from sequencing data. Gut Microbes 2022, 14, 2149019. [Google Scholar] [CrossRef]
  21. Chun, J.; Toldi, G. The Impact of Short-Chain Fatty Acids on Neonatal Regulatory T Cells. Nutrients 2022, 14, 3670. [Google Scholar] [CrossRef]
  22. van der Hee, B.; Wells, J.M. Microbial Regulation of Host Physiology by Short-chain Fatty Acids. Trends Microbiol. 2021, 29, 700–712. [Google Scholar] [CrossRef]
  23. Sivaprakasam, S.; Prasad, P.D.; Singh, N. Benefits of short-chain fatty acids and their receptors in inflammation and carcinogenesis. Pharmacol. Ther. 2016, 164, 144–151. [Google Scholar] [CrossRef] [PubMed]
  24. Tan, J.K.; McKenzie, C.; Mariño, E.; Macia, L.; Mackay, C.R. Metabolite-Sensing G Protein-Coupled Receptors-Facilitators of Diet-Related Immune Regulation. Annu. Rev. Immunol. 2017, 35, 371–402. [Google Scholar] [CrossRef] [PubMed]
  25. Zheng, X.; Jiang, Q.; Han, M.; Ye, F.; Wang, M.; Qiu, Y.; Wang, J.; Gao, M.; Hou, F.; Wang, H. FBXO38 regulates macrophage polarization to control the development of cancer and colitis. Cell. Mol. Immunol. 2023, 20, 1367–1378. [Google Scholar] [CrossRef]
  26. Xiao, Z.; Jiang, Y.; Gao, X.; Lin, S.; Lin, Y.; Liu, X.; Tan, D.; Jiang, Z. Comparison of the ameliorative effects of Qingfei Tongluo formula and azithromycin on Mycoplasma pneumoniae pneumonia. J. Nat. Med. 2017, 71, 685–692. [Google Scholar] [CrossRef]
  27. Liu, X.; Wang, M.; Kan, Q.; Lin, Y.; Jiang, Z. Qingfei Tongluo Formula Mitigates Mycoplasma pneumoniae Infection via the PERK Signaling Pathway. Dis. Markers 2022, 2022, 9340353. [Google Scholar] [CrossRef]
  28. Jiang, Y.H.; Yu, J.E.; Guo, A.H.; Li, X.; Lin, Y.; Jiang, Z.Y.; Xiao, Z. Ameliorative effects of Qingfei Tongluo formula on experimental mycoplasmal pneumonia in mice. J. Nat. Med. 2016, 70, 145–151. [Google Scholar] [CrossRef] [PubMed]
  29. Chen, Y.; Jiang, Y.; Liu, X.; Chen, X.; Fan, Q.; Xiao, Z. Polydatin alleviates mycoplasma pneumoniae-induced injury via inhibition of Caspase-1/GSDMD-dependent pyroptosis. Int. J. Med. Microbiol. 2023, 313, 151586. [Google Scholar] [CrossRef]
  30. Jiang, Y.-H.; Chen, Y.-L.; Fan, Q.-Y.; Liu, X.-H. Intervention effect of Qingfei Tongluo Formula on pyroptosis of Mycoplasma pneumoniae-induced human normal lung epithelial cells BEAS-2B via regulating Caspase-1. J. Guangzhou Univ. Chin. Med. 2023, 40, 450–460. [Google Scholar]
  31. Lü, J.-J.; Zhao, X.-Y.; Jiang, Y.-H. Effects of Polygonum cuspidatum, Scutellaria barbata, and Cryptotympana pustulata extracts on inflammatory factors and lipid metabolism signaling molecules in MPP mice. J. Emerg. Tradit. Chin. Med. 2020, 29, 1344–1347. [Google Scholar]
  32. Goldsmith, Z.G.; Dhanasekaran, D.N. G protein regulation of MAPK networks. Oncogene 2007, 26, 3122–3142. [Google Scholar] [CrossRef] [PubMed]
  33. Naor, Z.; Benard, O.; Seger, R. Activation of MAPK cascades by G-protein-coupled receptors: The case of gonadotropin-releasing hormone receptor. Trends Endocrinol. Metab. TEM 2000, 11, 91–99. [Google Scholar] [CrossRef]
  34. Yan, Q.; Wang, W.; Fan, Z.; Wei, Y.; Yu, R.; Pan, T.; Wang, N.; Lu, W.; Li, B.; Fang, Z. Chickpea-resistant starch exhibits bioactive function for alleviating atopic dermatitis via regulating butyrate production. Int. J. Biol. Macromol. 2025, 303, 140661. [Google Scholar] [CrossRef]
  35. National institute for Health and Care Excellence (NICE). Pneumonia (Community-Acquired): Antimicrobial Prescribing (NICE Guideline NG138); NICE: Manchester, UK, 2019; Available online: https://www.nice.org.uk/guidance/ng138/resources/pneumonia-communityacquired-antimicrobial-prescribing-pdf-66141726069445 (accessed on 16 October 2023).
  36. Abeles, S.R.; Jones, M.B.; Santiago-Rodriguez, T.M.; Ly, M.; Klitgord, N.; Yooseph, S.; Nelson, K.E.; Pride, D.T. Microbial diversity in individuals and their household contacts following typical antibiotic courses. Microbiome 2016, 4, 39. [Google Scholar] [CrossRef]
  37. Dethlefsen, L.; Relman, D.A. Incomplete recovery and individualized responses of the human distal gut microbiota to repeated antibiotic perturbation. Proc. Natl. Acad. Sci. USA 2011, 108, 4554–4561. [Google Scholar] [CrossRef]
  38. Li, L.; Yao, H.; Wang, J.; Li, Y.; Wang, Q. The Role of Chinese Medicine in Health Maintenance and Disease Prevention: Application of Constitution Theory. Am. J. Chin. Med. 2019, 47, 495–506. [Google Scholar] [CrossRef]
  39. Jafari, S.; Abdollahi, M.; Saeidnia, S. Personalized medicine: A confluence of traditional and contemporary medicine. Altern. Ther. Health Med. 2014, 20, 31–40. [Google Scholar] [PubMed]
  40. Wang, Z.; Hou, Y.; Liu, P.; Wu, R.; Yang, J.; Fan, S.; Peng, Z.; Han, X.; Su, B.; Zhang, C. Membrane integrity changes upon viral infection activate sphingomyelinase SMPDL3B to restrict cGAS-STING signaling via cGAMP degradation. Immunity 2025, 58, 2670–2684.e10. [Google Scholar] [CrossRef]
  41. Chen, X.; Ma, L.; Liu, X.; Wang, J.; Li, Y.; Xie, Q.; Liang, J. Clostridium butyricum alleviates dextran sulfate sodium-induced experimental colitis and promotes intestinal lymphatic vessel regeneration in mice. Ann. Transl. Med. 2022, 10, 341. [Google Scholar] [CrossRef]
  42. Bai, X.; Guo, Y.R.; Zhao, Z.M.; Li, X.Y.; Dai, D.Q.; Zhang, J.K.; Li, Y.S.; Zhang, C.D. Macrophage polarization in cancer and beyond: From inflammatory signaling pathways to potential therapeutic strategies. Cancer Lett. 2025, 625, 217772. [Google Scholar] [CrossRef]
  43. Liang, L.; Xu, W.; Shen, A.; Fu, X.; Cen, H.; Wang, S.; Lin, Z.; Zhang, L.; Lin, F.; Zhang, X.; et al. Inhibition of YAP1 activity ameliorates acute lung injury through promotion of M2 macrophage polarization. MedComm 2023, 4, e293. [Google Scholar] [CrossRef]
  44. Burrows, K.; Ngai, L.; Chiaranunt, P.; Watt, J.; Popple, S.; Forde, B.; Denha, S.; Olyntho, V.M.; Tai, S.L.; Cao, E.Y.; et al. A gut commensal protozoan determines respiratory disease outcomes by shaping pulmonary immunity. Cell 2025, 188, 316–330.e312. [Google Scholar] [CrossRef] [PubMed]
  45. Pu, Z.; Peng, Y.; Chen, X.; Ma, Y.; Liu, Y.; Li, X. “Heat-dissipating, lung-moistening, and constipation-relieving” effects of Siraitiae Fructus total saponins regulated through Gut-lung Axis. Phytomedicine Int. J. Phytother. Phytopharm. 2025, 150, 157755. [Google Scholar] [CrossRef] [PubMed]
  46. Mjösberg, J.; Rao, A. Lung inflammation originating in the gut. Science 2018, 359, 36–37. [Google Scholar] [CrossRef] [PubMed]
  47. Zhao, S.; Zhang, H.; Zhu, H.; Zhao, T.; Tu, J.; Yin, X.; Yang, S.; Zhang, W.; Zhang, F.; Zhang, M.; et al. Gut microbiota promotes macrophage M1 polarization in hepatic sinusoidal obstruction syndrome via regulating intestinal barrier function mediated by butyrate. Gut Microbes 2024, 16, 2377567. [Google Scholar] [CrossRef]
  48. Cummings, J.H.; Pomare, E.W.; Branch, W.J.; Naylor, C.P.; Macfarlane, G.T. Short chain fatty acids in human large intestine, portal, hepatic and venous blood. Gut 1987, 28, 1221–1227. [Google Scholar] [CrossRef]
  49. Schioppa, T.; Nguyen, H.O.; Tiberio, L.; Sozio, F.; Gaudenzi, C.; Passari, M.; Del Prete, A.; Bosisio, D.; Salvi, V. Inhibition of Class I Histone Deacetylase Activity Blocks the Induction of TNFAIP3 Both Directly and Indirectly via the Suppression of Endogenous TNF-α. Int. J. Mol. Sci. 2022, 23, 9752. [Google Scholar] [CrossRef]
  50. Van Gerrewey, T.; Chung, H.S. MAPK Cascades in Plant Microbiota Structure and Functioning. J. Microbiol. 2024, 62, 231–248. [Google Scholar] [CrossRef]
  51. Luo, B.; Ding, X.; Hu, Y.; Tian, M.; Wu, J.; Shi, H.; Lu, X.; Xia, X.; Guan, W.; Jiang, W. Shikonin hastens diabetic wound healing by inhibiting M1 macrophage polarisation through the MAPK signaling pathway. Mol. Immunol. 2025, 177, 73–84. [Google Scholar] [CrossRef]
  52. Zhao, M.; Qin, S.; Wang, J.; Zheng, S.; Ma, X.; Xu, W. Cirsii Herba glycoprotein promotes macrophage M1 polarization through MAPK and NF-κB signaling pathways via interaction with TLR4. Int. J. Biol. Macromol. 2025, 296, 139687. [Google Scholar] [CrossRef] [PubMed]
  53. Yuan, Z.; Jiang, D.; Yang, M.; Tao, J.; Hu, X.; Yang, X.; Zeng, Y. Emerging Roles of Macrophage Polarization in Osteoarthritis: Mechanisms and Therapeutic Strategies. Orthop. Surg. 2024, 16, 532–550. [Google Scholar] [CrossRef] [PubMed]
  54. Zhou, F.; Mei, J.; Han, X.; Li, H.; Yang, S.; Wang, M.; Chu, L.; Qiao, H.; Tang, T. Kinsenoside attenuates osteoarthritis by repolarizing macrophages through inactivating NF-κB/MAPK signaling and protecting chondrocytes. Acta Pharm. Sin. B 2019, 9, 973–985. [Google Scholar] [CrossRef]
  55. Li, S.; Yang, P.; Ding, X.; Zhang, H.; Ding, Y.; Tan, Q. Puerarin improves diabetic wound healing via regulation of macrophage M2 polarization phenotype. Burn. Trauma 2022, 10, tkac046. [Google Scholar] [CrossRef]
  56. Yan, S.; Wei, H.; Jia, R.; Zhen, M.; Bao, S.; Wang, W.; Liu, F.; Li, J. Wu-Mei-Wan Ameliorates Murine Ulcerative Colitis by Regulating Macrophage Polarization. Front. Pharmacol. 2022, 13, 859167. [Google Scholar] [CrossRef]
  57. Pang, X.; Wang, S.S.; Zhang, M.; Jiang, J.; Fan, H.Y.; Wu, J.S.; Wang, H.F.; Liang, X.H.; Tang, Y.L. OSCC cell-secreted exosomal CMTM6 induced M2-like macrophages polarization via ERK1/2 signaling pathway. Cancer Immunol. Immunother. CII 2021, 70, 1015–1029. [Google Scholar] [CrossRef]
  58. Wei, Y.; Liang, M.; Xiong, L.; Su, N.; Gao, X.; Jiang, Z. PD-L1 induces macrophage polarization toward the M2 phenotype via Erk/Akt/mTOR. Exp. Cell Res. 2021, 402, 112575. [Google Scholar] [CrossRef]
  59. Monagas, M.; Brendler, T.; Brinckmann, J.; Dentali, S.; Gafner, S.; Giancaspro, G.; Johnson, H.; Kababick, J.; Ma, C.; Oketch-Rabah, H.; et al. Understanding plant to extract ratios in botanical extracts. Front. Pharmacol. 2022, 13, 981978. [Google Scholar] [CrossRef]
  60. Kim, S.; Chen, J.; Cheng, T.; Gindulyte, A.; He, J.; He, S.; Li, Q.; Shoemaker, B.A.; Thiessen, P.A.; Yu, B.; et al. PubChem 2025 update. Nucleic Acids Res. 2025, 53, D1516–D1525. [Google Scholar] [CrossRef]
  61. Daina, A.; Michielin, O.; Zoete, V. SwissTargetPrediction: Updated data and new features for efficient prediction of protein targets of small molecules. Nucleic Acids Res. 2019, 47, W357–W364. [Google Scholar] [CrossRef] [PubMed]
  62. Daina, A.; Zoete, V. Testing the predictive power of reverse screening to infer drug targets, with the help of machine learning. Commun. Chem. 2024, 7, 105. [Google Scholar] [CrossRef]
  63. Gfeller, D.; Michielin, O.; Zoete, V. Shaping the interaction landscape of bioactive molecules. Bioinformatics 2013, 29, 3073–3079. [Google Scholar] [CrossRef] [PubMed]
  64. Coudert, E.; Gehant, S.; de Castro, E.; Pozzato, M.; Baratin, D.; Neto, T.; Sigrist, C.J.A.; Redaschi, N.; Bridge, A. Annotation of biologically relevant ligands in UniProtKB using ChEBI. Bioinformatics 2023, 39, btac793. [Google Scholar] [CrossRef]
  65. Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [PubMed]
  66. Knox, C.; Wilson, M.; Klinger, C.M.; Franklin, M.; Oler, E.; Wilson, A.; Pon, A.; Cox, J.; Chin, N.E.L.; Strawbridge, S.A.; et al. DrugBank 6.0: The DrugBank Knowledgebase for 2024. Nucleic Acids Res. 2024, 52, D1265–D1275. [Google Scholar] [CrossRef]
  67. Wishart, D.S.; Knox, C.; Guo, A.C.; Cheng, D.; Shrivastava, S.; Tzur, D.; Gautam, B.; Hassanali, M. DrugBank: A knowledgebase for drugs, drug actions and drug targets. Nucleic Acids Res. 2008, 36, D901–D906. [Google Scholar] [CrossRef] [PubMed]
  68. Stelzer, G.; Rosen, N.; Plaschkes, I.; Zimmerman, S.; Twik, M.; Fishilevich, S.; Stein, T.I.; Nudel, R.; Lieder, I.; Mazor, Y.; et al. The GeneCards Suite: From Gene Data Mining to Disease Genome Sequence Analyses. Curr. Protoc. Bioinform. 2016, 54, 1.30.1–1.30.33. [Google Scholar] [CrossRef]
  69. Becker, K.G.; Barnes, K.C.; Bright, T.J.; Wang, S.A. The genetic association database. Nat. Genet. 2004, 36, 431–432. [Google Scholar] [CrossRef]
  70. Szklarczyk, D.; Kirsch, R.; Koutrouli, M.; Nastou, K.; Mehryary, F.; Hachilif, R.; Gable, A.L.; Fang, T.; Doncheva, N.T.; Pyysalo, S.; et al. The STRING database in 2023: Protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023, 51, D638–D646. [Google Scholar] [CrossRef]
  71. Sherman, B.T.; Hao, M.; Qiu, J.; Jiao, X.; Baseler, M.W.; Lane, H.C.; Imamichi, T.; Chang, W. DAVID: A web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. 2022, 50, W216–W221. [Google Scholar] [CrossRef]
  72. Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef]
  73. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2018. [Google Scholar]
  74. Carlson, M. org.Hs.eg.db: Genome Wide Annotation for Human; Bioconductor: Boston, MA, USA, 2023. [Google Scholar]
  75. Wickham, H. ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016. [Google Scholar]
  76. Yu, G.; Wang, L.-G.; H, Y.; He, Q.-Y. clusterProfiler: An R package for comparing biological themes among gene clusters. OMICS J. Integr. Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef] [PubMed]
  77. Morris, G.M.; Huey, R.; Lindstrom, W.; Sanner, M.F.; Belew, R.K.; Goodsell, D.S.; Olson, A.J. AutoDock4 and AutoDockTools4: Automated docking with selective receptor flexibility. J. Comput. Chem. 2009, 30, 2785–2791. [Google Scholar] [CrossRef] [PubMed]
  78. Fu, X.; Xu, Y.; Han, X.; Lin, X.; Wang, J.; Li, G.; Fu, X.; Zhang, M. Exploring the Mechanism of Canmei Formula in Preventing and Treating Recurrence of Colorectal Adenoma Based on Data Mining and Algorithm Prediction. Biol. Proced. Online 2025, 27, 4. [Google Scholar] [CrossRef]
  79. Bramucci, E.; Paiardini, A.; Bossa, F.; Pascarella, S. PyMod: Sequence similarity searches, multiple sequence-structure alignments, and homology modeling within PyMOL. BMC Bioinform. 2012, 13, S2. [Google Scholar] [CrossRef]
  80. Laskowski, R.A.; Swindells, M.B. LigPlot+: Multiple ligand-protein interaction diagrams for drug discovery. J. Chem. Inf. Model. 2011, 51, 2778–2786. [Google Scholar] [CrossRef]
  81. Faul, F.; Erdfelder, E.; Buchner, A.; Lang, A.G. Statistical power analyses using G*Power 3.1: Tests for correlation and regression analyses. Behav. Res. Methods 2009, 41, 1149–1160. [Google Scholar] [CrossRef]
  82. FlowJo, LLC. FlowJo, Version 10.8.1; FlowJo: Ashland, OR, USA, 2023.
  83. Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
  84. GraphPad Software Inc. GraphPad Prism, Version 10.1.2; GraphPad: San Diego, CA, USA, 2023.
Pharmaceuticals 19 00212 g001
Figure 1. (a) Network of the relationship between the active ingredient and target of the Qingfei Tongluo Jiedu formula. (Note: purple circular nodes represent the drug targets, blue diamond nodes represent the active ingredient of the Qingfei Tongluo Jiedu formula, and orange triangles represent the Qingfei Tongluo Jiedu formula.) (b) Venn diagram of Mycoplasma pneumoniae pneumonia-related targets in four disease databases and datasets. (c) Venn diagram of targets appearing in the intersection of the four disease databases, in which the target is the active ingredient of Qingfei Tongluo Jiedu formula.
Figure 1. (a) Network of the relationship between the active ingredient and target of the Qingfei Tongluo Jiedu formula. (Note: purple circular nodes represent the drug targets, blue diamond nodes represent the active ingredient of the Qingfei Tongluo Jiedu formula, and orange triangles represent the Qingfei Tongluo Jiedu formula.) (b) Venn diagram of Mycoplasma pneumoniae pneumonia-related targets in four disease databases and datasets. (c) Venn diagram of targets appearing in the intersection of the four disease databases, in which the target is the active ingredient of Qingfei Tongluo Jiedu formula.
Pharmaceuticals 19 00212 g001
Pharmaceuticals 19 00212 g002
Figure 2. Protein–protein interaction (PPI) network analysis of cross-targets involved in Mycoplasma pneumoniae pneumonia (MPP) treatment with Qingfei Tongluo Jiedu formula. (a,b) PPI networks of cross-targets. (c) Top 10-ranked hub target. (d) Three protein clusters were obtained in the MCODE plugin analysis ((e,f) are all part of subgraph (d)).
Figure 2. Protein–protein interaction (PPI) network analysis of cross-targets involved in Mycoplasma pneumoniae pneumonia (MPP) treatment with Qingfei Tongluo Jiedu formula. (a,b) PPI networks of cross-targets. (c) Top 10-ranked hub target. (d) Three protein clusters were obtained in the MCODE plugin analysis ((e,f) are all part of subgraph (d)).
Pharmaceuticals 19 00212 g002
Pharmaceuticals 19 00212 g003aPharmaceuticals 19 00212 g003b
Figure 3. Cross-targets involved in Mycoplasma pneumoniae pneumonia (MPP) treatment with the Qingfei Tongluo Jiedu formula. (a) Gene Ontology (GO) enrichment analysis of the biological process (BP) bubble map. (b) GO enrichment analysis of the cellular component (CC) bubble map. (c) GO enrichment analysis of the molecular function (MF) bubble map. (d) GO enrichment analysis (the first 20 results of the enrichment analysis of BP, CC, and MF are shown in green, purple, and orange, respectively). (e) Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis bar graphs (the first 40 results) in cross-target areas. (f) Mitogen-Activated Protein Kinase (MAPK) pathway diagram.
Figure 3. Cross-targets involved in Mycoplasma pneumoniae pneumonia (MPP) treatment with the Qingfei Tongluo Jiedu formula. (a) Gene Ontology (GO) enrichment analysis of the biological process (BP) bubble map. (b) GO enrichment analysis of the cellular component (CC) bubble map. (c) GO enrichment analysis of the molecular function (MF) bubble map. (d) GO enrichment analysis (the first 20 results of the enrichment analysis of BP, CC, and MF are shown in green, purple, and orange, respectively). (e) Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis bar graphs (the first 40 results) in cross-target areas. (f) Mitogen-Activated Protein Kinase (MAPK) pathway diagram.
Pharmaceuticals 19 00212 g003aPharmaceuticals 19 00212 g003b
Pharmaceuticals 19 00212 g004aPharmaceuticals 19 00212 g004b
Figure 4. (a) Heatmap of molecular docking between 10 key target genes and 9 key active compounds of QTJD. (b) JUN–Luteolin; (c) JUN–Apigenin; (d) JUN–Gancaonin U; (e) JUN–Gancaonin A; (f) JUN–Rosmarinic acid; (g) JUN–Glycyrrhizin A; (h) JUN–Resveratrol; (i) JUN–Mulberroside C.
Figure 4. (a) Heatmap of molecular docking between 10 key target genes and 9 key active compounds of QTJD. (b) JUN–Luteolin; (c) JUN–Apigenin; (d) JUN–Gancaonin U; (e) JUN–Gancaonin A; (f) JUN–Rosmarinic acid; (g) JUN–Glycyrrhizin A; (h) JUN–Resveratrol; (i) JUN–Mulberroside C.
Pharmaceuticals 19 00212 g004aPharmaceuticals 19 00212 g004b
Pharmaceuticals 19 00212 g005
Figure 5. Cell inhibition rate of serum-containing drug at various concentrations (n = 3). Note: Compared with the control group, *** p < 0.001; compared with the model group, # p < 0.05. MP, Mycoplasma pneumoniae.
Figure 5. Cell inhibition rate of serum-containing drug at various concentrations (n = 3). Note: Compared with the control group, *** p < 0.001; compared with the model group, # p < 0.05. MP, Mycoplasma pneumoniae.
Pharmaceuticals 19 00212 g005
Pharmaceuticals 19 00212 g006
Figure 6. Qingfei Tongluo Jiedu formula (QTJD) enhances M2 macrophage polarization by butyric acid in vitro. (a) Macrophage activity was significantly reduced in the QTJD and butyric acid groups of lung macrophages compared with the model group (p < 0.05). (b) Flow cytometry analysis of lung macrophages decreased CD86 (M1 marker) expression and significantly increased CD206 (M2 marker) (p < 0.01) expression in QTJD and butyric acid compared with the model group. (c) Quantitative reverse transcription–polymerase chain reaction (RT-PCR) analysis of lung macrophages with QTJD and butyric acid significantly decreased the expression of CXCL10 (M1 markers) and significantly increased the expression of Arg-1, MRC-1 (M2 marker) compared with the model group (p < 0.01). (d) QTJD and butyric acid induced an increase in IL-10 expression in macrophages compared with the model group (p < 0.01) and inhibited interleukin (IL)-6 and tumor necrosis factor (TNF)-α production (n = 3). Note: compared with the control group, *** p < 0.001, ** p < 0.01; compared with the model group, ## p < 0.01, # p < 0.05. MP, Mycoplasma pneumoniae.
Figure 6. Qingfei Tongluo Jiedu formula (QTJD) enhances M2 macrophage polarization by butyric acid in vitro. (a) Macrophage activity was significantly reduced in the QTJD and butyric acid groups of lung macrophages compared with the model group (p < 0.05). (b) Flow cytometry analysis of lung macrophages decreased CD86 (M1 marker) expression and significantly increased CD206 (M2 marker) (p < 0.01) expression in QTJD and butyric acid compared with the model group. (c) Quantitative reverse transcription–polymerase chain reaction (RT-PCR) analysis of lung macrophages with QTJD and butyric acid significantly decreased the expression of CXCL10 (M1 markers) and significantly increased the expression of Arg-1, MRC-1 (M2 marker) compared with the model group (p < 0.01). (d) QTJD and butyric acid induced an increase in IL-10 expression in macrophages compared with the model group (p < 0.01) and inhibited interleukin (IL)-6 and tumor necrosis factor (TNF)-α production (n = 3). Note: compared with the control group, *** p < 0.001, ** p < 0.01; compared with the model group, ## p < 0.01, # p < 0.05. MP, Mycoplasma pneumoniae.
Pharmaceuticals 19 00212 g006
Pharmaceuticals 19 00212 g007aPharmaceuticals 19 00212 g007b
Figure 7. Qingfei Tongluo Jiedu formula (QTJD) enhances M2 macrophage polarization via butyric acid-GPR109A in vitro. (a) Macrophage activity in wild-type bone marrow macrophages was significantly reduced in the QTJD, butyric acid, and nicotinic acid groups compared with the model group (p < 0.05). (b) No considerable difference was found in the activity of macrophages in the QTJD, butyric acid, and nicotinic acid groups compared to the model group in GPR109A−/− bone marrow macrophages. (c) Flow cytometry analysis of wild-type bone marrow macrophages remarkably decreased the expression of CD86 and significantly increased the expression of CD206 in the QTJD. (d) The expression of CD86 and CD206 in the QTJD, butyric acid, and nicotinic acid groups in the GPR109A−/− bone marrow macrophage cells, compared with the model group expression, was not significantly different. (e) Quantitative reverse transcription–polymerase chain reaction (RT-PCR) detection of wild-type bone marrow macrophages substantially decreased the expression of CXCL10, remarkably increasing the expression of Arg-1 and MRC-1 in the QTJD, butyric acid, and nicotinic acid groups compared to the model group (p < 0.01). (f) GPR109A−/− bone marrow macrophages were significantly more sensitive to the expression of CD86 and CD206 in the QTJD, butyric acid, and nicotinic acid groups compared to the model group (p < 0.01). No significant difference was found in CXCL10, MRC-1, and Arg-1 expression in QTJD, butyric acid, and nicotinic acid groups. (g) In wild-type bone marrow macrophages, QTJD, butyric acid, and nicotinic acid groups induced an increase in the macrophage interleukin (IL)-10. (h) They inhibited the production of IL-6 and tumor necrosis factor (TNF)-a, compared with the model group. No considerable difference was found in cytokine IL-10, IL-6, and TNF-α content in GPR109A−/− bone macrophages compared to the model group in QTJD, butyric acid, and nicotinic acid groups (n = 3). ns = not significant; MP, Mycoplasma pneumoniae. Note: Compared with the control group, *** p < 0.001, * p < 0.05; compared with the model group, ## p < 0.01, # p < 0.05.
Figure 7. Qingfei Tongluo Jiedu formula (QTJD) enhances M2 macrophage polarization via butyric acid-GPR109A in vitro. (a) Macrophage activity in wild-type bone marrow macrophages was significantly reduced in the QTJD, butyric acid, and nicotinic acid groups compared with the model group (p < 0.05). (b) No considerable difference was found in the activity of macrophages in the QTJD, butyric acid, and nicotinic acid groups compared to the model group in GPR109A−/− bone marrow macrophages. (c) Flow cytometry analysis of wild-type bone marrow macrophages remarkably decreased the expression of CD86 and significantly increased the expression of CD206 in the QTJD. (d) The expression of CD86 and CD206 in the QTJD, butyric acid, and nicotinic acid groups in the GPR109A−/− bone marrow macrophage cells, compared with the model group expression, was not significantly different. (e) Quantitative reverse transcription–polymerase chain reaction (RT-PCR) detection of wild-type bone marrow macrophages substantially decreased the expression of CXCL10, remarkably increasing the expression of Arg-1 and MRC-1 in the QTJD, butyric acid, and nicotinic acid groups compared to the model group (p < 0.01). (f) GPR109A−/− bone marrow macrophages were significantly more sensitive to the expression of CD86 and CD206 in the QTJD, butyric acid, and nicotinic acid groups compared to the model group (p < 0.01). No significant difference was found in CXCL10, MRC-1, and Arg-1 expression in QTJD, butyric acid, and nicotinic acid groups. (g) In wild-type bone marrow macrophages, QTJD, butyric acid, and nicotinic acid groups induced an increase in the macrophage interleukin (IL)-10. (h) They inhibited the production of IL-6 and tumor necrosis factor (TNF)-a, compared with the model group. No considerable difference was found in cytokine IL-10, IL-6, and TNF-α content in GPR109A−/− bone macrophages compared to the model group in QTJD, butyric acid, and nicotinic acid groups (n = 3). ns = not significant; MP, Mycoplasma pneumoniae. Note: Compared with the control group, *** p < 0.001, * p < 0.05; compared with the model group, ## p < 0.01, # p < 0.05.
Pharmaceuticals 19 00212 g007aPharmaceuticals 19 00212 g007b
Pharmaceuticals 19 00212 g008
Figure 8. Protein levels of each pathway in MAPK. (a) Effect of the model, Qingfei Tongluo Jiedu formula (QTJD), butyric acid, and nicotinic acid groups on MAPK protein expression in wild-type bone marrow macrophages. (b) Effect of the model, QTJD, butyric acid, and nicotinic acid groups on MAPK protein expression in GPR109A−/− bone marrow macrophages (n = 3). Note: compared with the control group, *** p < 0.001; compared with the model group, ### p < 0.001. MP, Mycoplasma pneumoniae.
Figure 8. Protein levels of each pathway in MAPK. (a) Effect of the model, Qingfei Tongluo Jiedu formula (QTJD), butyric acid, and nicotinic acid groups on MAPK protein expression in wild-type bone marrow macrophages. (b) Effect of the model, QTJD, butyric acid, and nicotinic acid groups on MAPK protein expression in GPR109A−/− bone marrow macrophages (n = 3). Note: compared with the control group, *** p < 0.001; compared with the model group, ### p < 0.001. MP, Mycoplasma pneumoniae.
Pharmaceuticals 19 00212 g008
Pharmaceuticals 19 00212 g009
Figure 9. Mechanism of Qingfei Tongluo Jiedu formula (QTJD) in the treatment of Mycoplasma pneumoniae pneumonia (MPP). (a) MP infection reduces the abundance of butyrate-producing bacteria, leading to decreased butyrate concentrations. This failure to effectively activate GPR109A results in M1 macrophage polarisation, release of inflammatory cytokines, and exacerbated pulmonary inflammatory responses. QTJD increases the abundance of beneficial gut bacteria, particularly butyrate-producing strains, elevates butyrate levels, and activates the GPR109A receptor. (b) By elevating butyrate concentrations, QTJD activates GPR109A to inhibit the MAPK pathway, specifically suppressing ERK1/2 expression. This converts macrophages towards an anti-inflammatory M2 phenotype, diminishing pro-inflammatory cytokine release and thereby mitigating inflammatory responses.
Figure 9. Mechanism of Qingfei Tongluo Jiedu formula (QTJD) in the treatment of Mycoplasma pneumoniae pneumonia (MPP). (a) MP infection reduces the abundance of butyrate-producing bacteria, leading to decreased butyrate concentrations. This failure to effectively activate GPR109A results in M1 macrophage polarisation, release of inflammatory cytokines, and exacerbated pulmonary inflammatory responses. QTJD increases the abundance of beneficial gut bacteria, particularly butyrate-producing strains, elevates butyrate levels, and activates the GPR109A receptor. (b) By elevating butyrate concentrations, QTJD activates GPR109A to inhibit the MAPK pathway, specifically suppressing ERK1/2 expression. This converts macrophages towards an anti-inflammatory M2 phenotype, diminishing pro-inflammatory cytokine release and thereby mitigating inflammatory responses.
Pharmaceuticals 19 00212 g009
Table 1. QTJD composition.
Table 1. QTJD composition.
Chinese NameLatin NameEnglish NamePlant Part UsedWeights (g)Pharmacopeial Dosage (g)
SangbaipiMorus alba L.MORI CORTEXroot and rhizome66–12
DigupiLycium chinense Mill.LYCIICORTEXroot and rhizome69–15
HuzhangPolygonum cuspidatum Siebold & Zucc.POLYGONI CUSPIDATI RHIZOMA ET RADIXroot and rhizome69–15
TaorenPrunus persica (L.) BatschPERSICAE SEMENseed65–10
BanzhilianScutellaria barbata D. DonSCUTELLARIAE BARBA TAE HERBAwhole plant615–30
DilongPheretima aspergillum (E. Perrier)PHERETIMAearthworm65–10
ZisuziPerilla frutescens (L.) Britt.PERILLAE FRUCTUSseed63–10
TingliziDescurainia sophia (L.) Webb ex Prantl.DESCURAINIAE SEMEN LEPIDII SEMENseed63–10
GanCaoGlycyrrhiza uralensis FischLICORICEroot and rhizome32–10
Abbreviation: QTJD—Qingfei Tongluo Jiedu formula.
Table 2. Primer sequences for QRT-PCR.
Table 2. Primer sequences for QRT-PCR.
GeneForward StrandReverse Strand
CXCL10CCAAGTGCTGCCGTCATTTTCTCAACACGTGGGCAGGATA
MRC1TGTCCATTGCACTTTGAGGGACGTGGATCTCCGTGACACTC
ARG1CGCACACCATGCTCAACCTCGGCCTCTTAGAGACACCAGC
GAPDHCTCAGGAGAGTGTTTCCTCGTTTTGCCGTGAGTGGAGTCAT
Abbreviation: CXCL10, C-X-C motif chemokine ligand 10; MRC1, Mannose receptor C type 1; ARG1, Arginase-1; GAPDH, Glyceraldehyde-3-phosphate dehydrogenase.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, Z.; Fan, Q.; Sun, R.; Jiang, Y. Qingfei Tongluo Jiedu Formula Regulates M2 Macrophage Polarization via the Butyric Acid-GPR109A-MAPK Pathway for the Treatment of Mycoplasma pneumoniae Pneumonia. Pharmaceuticals 2026, 19, 212. https://doi.org/10.3390/ph19020212

AMA Style

Liu Z, Fan Q, Sun R, Jiang Y. Qingfei Tongluo Jiedu Formula Regulates M2 Macrophage Polarization via the Butyric Acid-GPR109A-MAPK Pathway for the Treatment of Mycoplasma pneumoniae Pneumonia. Pharmaceuticals. 2026; 19(2):212. https://doi.org/10.3390/ph19020212

Chicago/Turabian Style

Liu, Zhilin, Qiuyue Fan, Ruohan Sun, and Yonghong Jiang. 2026. "Qingfei Tongluo Jiedu Formula Regulates M2 Macrophage Polarization via the Butyric Acid-GPR109A-MAPK Pathway for the Treatment of Mycoplasma pneumoniae Pneumonia" Pharmaceuticals 19, no. 2: 212. https://doi.org/10.3390/ph19020212

APA Style

Liu, Z., Fan, Q., Sun, R., & Jiang, Y. (2026). Qingfei Tongluo Jiedu Formula Regulates M2 Macrophage Polarization via the Butyric Acid-GPR109A-MAPK Pathway for the Treatment of Mycoplasma pneumoniae Pneumonia. Pharmaceuticals, 19(2), 212. https://doi.org/10.3390/ph19020212

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop