Khellin Mitigates Cisplatin-Induced Renal Injury by Targeting Oxidative Stress, Inflammation, and Apoptosis: Integration of Network Pharmacology, Molecular Docking, and Preclinical Validation
Abstract
1. Introduction
2. Results
2.1. Network Pharmacology Analysis
2.2. Molecular Docking Analysis
2.3. In Silico Prediction of Pharmacokinetic Properties of Khellin
2.4. Impact of Khe and/or CDDP on Vero and HepG2 Cells
2.5. Effect of Khe Treatment on the Nephrotoxicity Markers
2.6. Effect of Khe Treatment on Renal Oxidative Stress and Antioxidant Markers
2.7. Influence of Khe Treatment on Inflammatory Markers



2.8. Impact of Khe Treatment on the Apoptotic Markers
2.9. Khe Decreased CDDP-Triggered Kidney Damage
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Network Pharmacology of Khe Targets
4.3. Molecular Docking of Khe Targets
4.4. Pharmacokinetic Predication of Khe
4.5. Preparation of Khe
4.6. MTT Assay
4.7. Animals and Treatments
4.8. Biochemical Assays
4.9. Real-Time PCR
4.10. Histopathology Examination
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| AKI | Acute kidney injury |
| Bax | Bcl-2-associated X protein |
| Bcl2 | B-cell lymphoma 2 |
| BP | Biological process |
| CAT | Catalase |
| CDDP | Cisplatin |
| CC | Cellular component |
| GPX | Glutathione peroxidase |
| IL6 | Interleukin-6 |
| iNOs | Inducible nitric oxide synthase |
| Khe | Khellin |
| Kim1 | Kidney injury molecule 1 |
| MAPK14 | Mitogen-activated protein kinase 14 |
| MCP 1 | Monocyte chemoattractant protein 1 |
| MDA | Malondialdehyde |
| MFs | Molecular functions |
| PI3K | Phosphoinositide 3-kinase |
| ROS | Reactive oxygen species |
| SOD | Superoxide dismutase |
| TNFα | Tumor necrosis alpha |
References
- Kung, C.-W.; Chou, Y.-H. Acute kidney disease: An overview of the epidemiology, pathophysiology, and management. Korean J. Nephrol. 2023, 42, 686–699. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Chen, X.; Ding, X.; Teng, J. Analysis of the high incidence of acute kidney injury associated with acute-on-chronic liver failure. Hepatol. Int. 2018, 12, 262–268. [Google Scholar] [CrossRef] [PubMed]
- Gilani, S.J.; Bin-Jumah, M.N.; Al-Abbasi, F.A.; Nadeem, M.S.; Alzarea, S.I.; Ahmed, M.M.; Sayyed, N.; Kazmi, I. Rosinidin Protects against Cisplatin-Induced Nephrotoxicity via Subsiding Proinflammatory and Oxidative Stress Biomarkers in Rats. Int. J. Environ. Res. Public Health 2022, 19, 9719. [Google Scholar] [CrossRef] [PubMed]
- Rad, A.K.; Mohebbati, R.; Hosseinian, S. Drug-induced nephrotoxicity and medicinal plants. Iran. J. Kidney Dis. 2017, 11, 169. [Google Scholar]
- Al-kuraishy, H.M.; Al-Gareeb, A.I.; Al-Naimi, M.S. Pomegranate protects renal proximal tubules during gentamicin induced-nephrotoxicity in rats. J. Contemp. Med. Sci. 2019, 5, 35–40. [Google Scholar] [CrossRef]
- Song, M.; Cui, M.; Liu, K. Therapeutic strategies to overcome cisplatin resistance in ovarian cancer. Eur. J. Med. Chem. 2022, 232, 114205. [Google Scholar] [CrossRef]
- Czyrski, A.; Resztak, M.; Świderski, P.; Brylak, J.; Główka, F.K. The overview on the pharmacokinetic and pharmacodynamic interactions of triazoles. Pharmaceutics 2021, 13, 1961. [Google Scholar] [CrossRef]
- Shord, S.S.; Thompson, D.M.; Krempl, G.A.; Hanigan, M.H. Effect of concurrent medications on cisplatin-induced nephrotoxicity in patients with head and neck cancer. Anti-Cancer Drugs 2006, 17, 207–215. [Google Scholar] [CrossRef]
- Awad, M.G.; Ali, R.A.; Abd El-Monem, D.D.; El-Magd, M.A. Graviola leaves extract enhances the anticancer effect of cisplatin on various cancer cell lines. Mol. Cell. Toxicol. 2020, 16, 385–399. [Google Scholar] [CrossRef]
- Awad, M.G.; Hanafy, N.A.N.; Ali, R.A.; Abd El-Monem, D.D.; El-Shafiey, S.H.; El-Magd, M.A. Exploring the therapeutic applications of nano-therapy of encapsulated cisplatin and anthocyanin-loaded multiwalled carbon nanotubes coated with chitosan-conjugated folic acid in targeting breast and liver cancers. Int. J. Biol. Macromol. 2024, 280, 135854. [Google Scholar] [CrossRef]
- Awad, M.G.; Hanafy, N.A.N.; Ali, R.A.; El-Monem, D.D.A.; El-Shafiey, S.H.; El-Magd, M.A. Unveiling the therapeutic potential of anthocyanin/cisplatin-loaded chitosan nanoparticles against breast and liver cancers. Cancer Nanotechnol. 2024, 15, 57. [Google Scholar] [CrossRef]
- Abu Gazia, M.; El-Magd, M.A. Effect of pristine and functionalized multiwalled carbon nanotubes on rat renal cortex. Acta Histochem. 2018, 121, 207–217. [Google Scholar] [CrossRef] [PubMed]
- Diab, A.E.-A.A.; Al-Mathal, E.M.; Zahra, M.H.; Dowidar, M.F.; El-Sherbeny, S.A.; Abu El-Magd, M. Ameliorative Effect of Costus speciosus Extracts on Toxic Effects of Lead Acetate on Liver and Kidney of Male Rats. Egypt. J. Vet. Sci. 2024, 55, 895–901. [Google Scholar] [CrossRef]
- Elsisy, R.A.; Abdelkarim, M.A.; El-Magd, M.A. High-fructose diet induces earlier and more severe kidney damage than high-fat diet on rats. Egypt. J. Histol. 2021, 44, 535–544. [Google Scholar] [CrossRef]
- Launay-Vacher, V.; Rey, J.B.; Isnard-Bagnis, C.; Deray, G.; Daouphars, M. Prevention of cisplatin nephrotoxicity: State of the art and recommendations from the European Society of Clinical Pharmacy Special Interest Group on Cancer Care. Cancer Chemother Pharmacol 2008, 61, 903–909. [Google Scholar] [CrossRef]
- Zhou, J.; Nie, R.C.; Yin, Y.X.; Cai, X.X.; Xie, D.; Cai, M.Y. Protective Effect of Natural Antioxidants on Reducing Cisplatin-Induced Nephrotoxicity. Dis Markers 2022, 2022, 1612348. [Google Scholar] [CrossRef]
- Fang, C.Y.; Lou, D.Y.; Zhou, L.Q.; Wang, J.C.; Yang, B.; He, Q.J.; Wang, J.J.; Weng, Q.J. Natural products: Potential treatments for cisplatin-induced nephrotoxicity. Acta Pharmacol. Sin. 2021, 42, 1951–1969. [Google Scholar] [CrossRef]
- Ragab, S.S.; Diab, L.A.; Alkady, M.A. The Effect of Khella Baladi (Ammi visnaga) on hyperoxaluric rats. J. Home Econ.-Menofia Univ. 2021, 31, 82–97. [Google Scholar]
- Thiab, S.; Abutaima, R.; Barakat, M.; Daoud, S.; Abu-Taha, M.; Abutayeh, R. Khella (Ammi visnaga): Molecular and Cellular Aspects and Potential in Biomedicine. In Ancient and Traditional Foods, Plants, Herbs and Spices Used in the Middle East; CRC Press: Boca Raton, FL, USA, 2024; pp. 179–192. [Google Scholar]
- Ouyang, X.; Zhu, D.; Huang, Y.; Zhao, X.; Xu, R.; Wang, J.; Li, W.; Shen, X. Khellin as a selective monoamine oxidase B inhibitor ameliorated paclitaxel-induced peripheral neuropathy in mice. Phytomedicine 2023, 111, 154673. [Google Scholar] [CrossRef]
- Babu, A.H.; Prasanth, D.; Yaraguppi, D.A.; Panda, S.P.; Ahmad, S.F.; Al-Mazroua, H.A.; Sai, A.R.; Kumar, P.P. Antiparkinson potential of khellin on rotenone-induced Parkinson’s disease in a zebrafish model: Targeting MAO, inflammatory, and oxidative stress markers with molecular docking, MD simulations, and histopathology evidence. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2024, 284, 109997. [Google Scholar]
- Ulloa, M.; Macías, F.; Clapp, C.; Martínez de la Escalera, G.; Arnold, E. Prolactin is an Endogenous Antioxidant Factor in Astrocytes That Limits Oxidative Stress-Induced Astrocytic Cell Death via the STAT3/NRF2 Signaling Pathway. Neurochem. Res. 2024, 49, 1879–1901. [Google Scholar] [CrossRef] [PubMed]
- Cassidy, H.; Radford, R.; Slyne, J.; O’Connell, S.; Slattery, C.; Ryan, M.P.; McMorrow, T. The role of MAPK in drug-induced kidney injury. J. Signal Transduct. 2012, 2012, 463617. [Google Scholar] [CrossRef] [PubMed]
- Kilari, S.; Sharma, A.; Zhao, C.; Singh, A.; Cai, C.; Simeon, M.; van Wijnen, A.J.; Misra, S.J.T.R. Identification of novel therapeutic targets for contrast induced acute kidney injury (CI-AKI): Alpha blockers as a therapeutic strategy for CI-AKI. Transl. Res. 2021, 235, 32–47. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Bakky, M.S.; Aldakhili, A.S.A.; Ali, H.M.; Babiker, A.Y.; Alhowail, A.H.; Mohammed, S.A.A. Evaluation of Cisplatin-Induced Acute Renal Failure Amelioration Using Fondaparinux and Alteplase. Pharmaceuticals 2023, 16, 910. [Google Scholar] [CrossRef]
- McSweeney, K. Identification and Use of Novel Vasodilators in the Prevention of Cisplatin-Induced Acute Kidney Injury. Ph.D. Thesis, Victoria University, Melbourne, Australia, 2023. [Google Scholar]
- Chang, H.-A.; Ou Yang, R.-Z.; Su, J.-M.; Nguyen, T.M.H.; Sung, J.-M.; Tang, M.-J.; Chiu, W.-T. YAP nuclear translocation induced by HIF-1α prevents DNA damage under hypoxic conditions. Cell Death Discov. 2023, 9, 385. [Google Scholar] [CrossRef]
- Rane, M.J.; Song, Y.E.; Jin, S.; Barati, M.T.; Wu, R.; Kausar, H.; Tan, Y.; Wang, Y.; Zhou, G.; Klein, J.B. Interplay between Akt and p38 MAPK pathways in the regulation of renal tubular cell apoptosis associated with diabetic nephropathy. Am. J. Physiol.-Ren. Physiol. 2010, 298, F49–F61. [Google Scholar] [CrossRef]
- Du, B.; Yin, Y.; Wang, Y.; Fu, H.; Sun, H.; Yue, Z.; Yu, S.; Zhang, Z. Calcium dobesilate efficiency in the treatment of diabetic kidney disease through suppressing MAPK and chemokine signaling pathways based on clinical evaluation and network pharmacology. Front. Pharmacol. 2022, 13, 850167. [Google Scholar] [CrossRef]
- Selim, A.A.; Essa, B.M.; Abdelmonem, I.M.; Amin, M.A.; Sarhan, M.O. Extraction, purification and radioiodination of Khellin as cancer theranostic agent. Appl. Radiat. Isot. 2021, 178, 109970. [Google Scholar] [CrossRef]
- Yadav, P.; Singh, S.K.; Datta, S.; Verma, S.; Verma, A.; Rakshit, A.; Bali, A.; Bhatti, J.S.; Khurana, A.; Navik, U. Therapeutic potential and pharmacological mechanism of visnagin. J. Integr. Med. 2024, 22, 399–412. [Google Scholar] [CrossRef]
- Kumar, A.; Chutia, D.; Ambala, S.; Kumar, S.; Das, A.M. Medicinal Chemistry of Khellin and Its Synthetic Derivatives: Progress and Future Potential in Drug Discovery. ChemistrySelect 2025, 10, e202405469. [Google Scholar] [CrossRef]
- Askari, V.R.; Najafi, Z.; Baradaran Rahimi, V.; Boskabady, M.H. Comparative study on the impacts of visnagin and its methoxy derivative khellin on human lymphocyte proliferation and Th1/Th2 balance. Pharmacol. Rep. 2023, 75, 411–422. [Google Scholar] [CrossRef] [PubMed]
- Harvengt, C.; Desager, J.-P. HDL-cholesterol increase in normolipaemic subjects on khellin: A pilot study. Int. J. Clin. Pharmacol. Res. 1983, 3, 363–366. [Google Scholar] [PubMed]
- Hofer, A.; Kerl, H.; Wolf, P. Long-term results in the treatment of vitiligo with oral khellin plus UVA. Eur. J. Dermatol. 2001, 11, 225–229. [Google Scholar] [PubMed]
- Anwer, T.; Alshahrani, S.; Somaili, A.M.; Khubrani, A.H.; Ahmed, R.A.; Jali, A.M.; Alshamrani, A.; Rashid, H.; Nomeir, Y.; Khalid, M. Nephroprotective Effect of Diosmin against Cisplatin-Induced Kidney Damage by Modulating IL-1β, IL-6, TNFα and Renal Oxidative Damage. Molecules 2023, 28, 1302. [Google Scholar] [CrossRef]
- Volarevic, V.; Djokovic, B.; Jankovic, M.G.; Harrell, C.R.; Fellabaum, C.; Djonov, V.; Arsenijevic, N. Molecular mechanisms of cisplatin-induced nephrotoxicity: A balance on the knife edge between renoprotection and tumor toxicity. J. Biomed. Sci. 2019, 26, 25. [Google Scholar] [CrossRef]
- Fawzy, M.H.; Khodeer, D.M.; El-Sayed, N.M.; Saeed, N.M.; Ahmed, Y.M. Molecular mechanisms of cisplatin induced nephrotoxicity. Rec. Pharm. Biomed. Sci. 2022, 6, 128–135. [Google Scholar]
- Abdelrahman, A.M.; Al Suleimani, Y.; Shalaby, A.; Ashique, M.; Manoj, P.; Al-Saadi, H.; Ali, B.H. Effect of levosimendan, a calcium sensitizer, on cisplatin-induced nephrotoxicity in rats. Toxicol. Rep. 2019, 6, 232–238. [Google Scholar] [CrossRef]
- Abass, S.A.; Elgazar, A.A.; El-Kholy, S.S.; El-Refaiy, A.I.; Nawaya, R.A.; Bhat, M.A.; Farrag, F.A.; Hamdi, A.; Balaha, M.; El-Magd, M.A. Unraveling the Nephroprotective Potential of Papaverine against Cisplatin Toxicity through Mitigating Oxidative Stress and Inflammation: Insights from In Silico, In Vitro, and In Vivo Investigations. Molecules 2024, 29, 1927. [Google Scholar] [CrossRef]
- El-Kholie, E.; Khater, O.; Shehata, O. Effect of Gum Arabic and Khella Seeds in Treatment of Kidney Functions Defect in Gentamicin-Induced Rats. J. Home Econ.-Menofia Univ. 2023, 33, 87–98. [Google Scholar]
- Alaqeel, N.K.; Al-Hariri, M.T. Naringenin ameliorates Cyclophosphamide-induced nephrotoxicity in experimental model. Saudi J. Biol. Sci. 2023, 30, 103674. [Google Scholar] [CrossRef]
- Bonventre, J.V. Kidney injury molecule-1 (KIM-1): A urinary biomarker and much more. Nephrol. Dial. Transplant. 2009, 24, 3265–3268. [Google Scholar] [CrossRef] [PubMed]
- Ehsan, N.; Ijaz, M.; Ashraf, A.; Sarwar, S.; Samad, A.; Afzal, G.; Andleeb, R.; Al-Misned, F.; Al-Ghanim, K.; Ahmed, Z. Mitigation of cisplatin induced nephrotoxicity by casticin in male albino rats. Braz. J. Biol. 2021, 83, e243438. [Google Scholar] [CrossRef] [PubMed]
- Alshahrani, S.; Tripathi, P.; Ashafaq, M.; Sultan, M.H.; Moni, S.S.; Tripathi, R.; Siddiqui, A.H.; Rashid, H.; Malhan, A.M. Role of renin blocker (Aliskiren) on Cisplatin induced-nephrotoxicity in rats. Toxin Rev. 2022, 41, 175–185. [Google Scholar] [CrossRef]
- Khan, T.H.; Ganaie, M.A.; Alharthy, K.M.; Madkhali, H.; Jan, B.L.; Sheikh, I.A. Naringenin prevents doxorubicin-induced toxicity in kidney tissues by regulating the oxidative and inflammatory insult in Wistar rats. Arch. Physiol. Biochem. 2020, 126, 300–307. [Google Scholar] [CrossRef]
- Tawfic, A.A.; Ibrahim, H.M.; Mohammed-Geba, K.; El-Magd, M.A. Chitosan nanoparticles, camel milk exosomes and/or Sorafenib induce apoptosis, inhibit tumor cells migration and angiogenesis and ameliorate the associated liver damage in Ehrlich ascites carcinoma-bearing mice. Beni-Suef Univ. J. Basic Appl. Sci. 2024, 13, 74. [Google Scholar] [CrossRef]
- Hong, Y.A.; Park, C.W. Catalytic Antioxidants in the Kidney. Antioxidants 2021, 10, 130. [Google Scholar] [CrossRef]
- Mitazaki, S.; Hashimoto, M.; Matsuhashi, Y.; Honma, S.; Suto, M.; Kato, N.; Nakagawasai, O.; Tan-No, K.; Hiraiwa, K.; Yoshida, M.; et al. Interleukin-6 modulates oxidative stress produced during the development of cisplatin nephrotoxicity. Life Sci. 2013, 92, 694–700. [Google Scholar] [CrossRef]
- Kim, W.S.; Kim, H.; Kwon, K.W.; Im, S.-H.; Lee, B.R.; Ha, S.-J.; Shin, S.J. Cisplatin induces tolerogenic dendritic cells in response to TLR agonists via the abundant production of IL-10, thereby promoting Th2-and Tr1-biased T-cell immunity. Oncotarget 2016, 7, 33765. [Google Scholar] [CrossRef]
- Tadagavadi, R.K.; Reeves, W.B. Endogenous IL-10 attenuates cisplatin nephrotoxicity: Role of dendritic cells. J. Immunol. 2010, 185, 4904–4911. [Google Scholar] [CrossRef]
- Ramesh, G.; Brian Reeves, W. Cisplatin increases TNF-α mRNA stability in kidney proximal tubule cells. Ren. Fail. 2006, 28, 583–592. [Google Scholar] [CrossRef]
- Ramesh, G.; Reeves, W.B. Inflammatory cytokines in acute renal failure. Kidney Int. 2004, 66, S56–S61. [Google Scholar] [CrossRef] [PubMed]
- Zou, P.; Song, J.; Jiang, B.; Pei, F.; Chen, B.; Yang, X.; Liu, G.; Hu, Z. Epigallocatechin-3-gallate protects against cisplatin nephrotoxicity by inhibiting the apoptosis in mouse. Int. J. Clin. Exp. Pathol. 2014, 7, 4607–4616. [Google Scholar] [PubMed]
- Korsmeyer, S.; Wei, M.; Saito, M.; Weiler, S.; Oh, K.; Schlesinger, P. Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c. Cell Death Differ. 2000, 7, 1166–1173. [Google Scholar] [CrossRef] [PubMed]
- Byun, E.-B.; Song, H.-Y.; Kim, W.S.; Han, J.M.; Seo, H.S.; Park, S.-H.; Kim, K.; Byun, E.-H. Protective Effect of Polysaccharides Extracted from Cudrania tricuspidata Fruit against Cisplatin-Induced Cytotoxicity in Macrophages and a Mouse Model. Int. J. Mol. Sci. 2021, 22, 7512. [Google Scholar] [CrossRef]
- Kim, Y.K.; Kim, H.J.; Kwon, C.H.; Kim, J.H.; Woo, J.S.; Jung, J.S.; Kim, J.M. Role of ERK activation in cisplatin-induced apoptosis in OK renal epithelial cells. J. Appl. Toxicol. Int. J. 2005, 25, 374–382. [Google Scholar] [CrossRef]
- Elgazar, A.A.; El-Domany, R.A.; Eldehna, W.M.; Badria, F.A. Theophylline-based hybrids as acetylcholinesterase inhibitors endowed with anti-inflammatory activity: Synthesis, bioevaluation, in silico and preliminary kinetic studies. RSC Adv. 2023, 13, 25616–25634. [Google Scholar] [CrossRef]
- Al-Sanea, M.M.; Hamdi, A.; Mohamed, A.A.B.; El-Shafey, H.W.; Moustafa, M.; Elgazar, A.A.; Eldehna, W.M.; Ur Rahman, H.; Parambi, D.G.T.; Elbargisy, R.M.; et al. New benzothiazole hybrids as potential VEGFR-2 inhibitors: Design, synthesis, anticancer evaluation, and in silico study. J. Enzym. Inhib. Med. Chem. 2023, 38, 2166036. [Google Scholar] [CrossRef]
- Adawy, H.A.; Tawfik, S.S.; Elgazar, A.A.; Selim, K.B.; Goda, F.E. Design, synthesis, and in vitro and in vivo biological evaluation of triazolopyrimidine hybrids as multitarget directed anticancer agents. RSC Adv. 2024, 14, 35239–35254. [Google Scholar] [CrossRef]
- Travaini, M.L.; Sosa, G.M.; Ceccarelli, E.A.; Walter, H.; Cantrell, C.L.; Carrillo, N.J.; Dayan, F.E.; Meepagala, K.M.; Duke, S.O. Khellin and visnagin, furanochromones from Ammi visnaga (L.) Lam., as potential bioherbicides. J. Agric. Food Chem. 2016, 64, 9475–9487. [Google Scholar] [CrossRef]
- Elgamal, M.H.A.; Elewa, N.H.; Elkhrisy, E.A.M.; Duddeck, H. 13 C NMR Chemical shifts and carbon-proton coupling constants of some furocoumarins and furochromones. Phytochemistry 1979, 18, 139–143. [Google Scholar] [CrossRef]
- Jin, Y.; Zhao, X.; Zhang, H.; Li, Q.; Lu, G.; Zhao, X. Modulatory effect of silymarin on pulmonary vascular dysfunction through HIF-1α-iNOS following rat lung ischemia-reperfusion injury. Exp. Ther. Med. 2016, 12, 1135–1140. [Google Scholar] [CrossRef] [PubMed]
- Patton, C.J.; Crouch, S. Spectrophotometric and kinetics investigation of the Berthelot reaction for the determination of ammonia. Anal. Chem. 1977, 49, 464–469. [Google Scholar] [CrossRef]
- Fossati, P.; Prencipe, L.; Berti, G. Enzymic creatinine assay: A new colorimetric method based on hydrogen peroxide measurement. Clin. Chem. 1983, 29, 1494–1496. [Google Scholar] [CrossRef] [PubMed]
- Shaban, A.M.; Raslan, M.; Qahl, S.H.; Elsayed, K.; Abdelhameed, M.S.; Oyouni, A.A.A.; Al-Amer, O.M.; Hammouda, O.; El-Magd, M.A. Ameliorative Effects of Camel Milk and Its Exosomes on Diabetic Nephropathy in Rats. Membranes 2022, 12, 1060. [Google Scholar] [CrossRef]
- Elmoslemany, A.M.; El-Magd, M.A.; Ghamry, H.I.; Alshahrani, M.Y.; Zidan, N.S.; Zedan, A.M.G. Avocado Seeds Relieve Oxidative Stress-Dependent Nephrotoxicity but Enhance Immunosuppression Induced by Cyclosporine in Rats. Antioxidants 2021, 10, 1194. [Google Scholar] [CrossRef]
- Zedan, A.M.G.; Sakran, M.I.; Bahattab, O.; Hawsawi, Y.M.; Al-Amer, O.; Oyouni, A.A.A.; Nasr Eldeen, S.K.; El-Magd, M.A. Oriental Hornet (Vespa orientalis) Larval Extracts Induce Antiproliferative, Antioxidant, Anti-Inflammatory, and Anti-Migratory Effects on MCF7 Cells. Molecules 2021, 26, 3303. [Google Scholar] [CrossRef]





| Gene Symbol | Numbers Related KEGG | Numbers Related BP | Numbers Related MF | Numbers Related CC |
|---|---|---|---|---|
| PIK3 | 69/86 | 112/461 | 13/52 | 9/32 |
| MAPK14 | 45/86 | 91/461 | 8/52 | 8/32 |
| GSK3B | 36/86 | 127/461 | 7/52 | 3/32 |
| PRKACA | 29/86 | 69/461 | 8/52 | 5/32 |
| JAK2 | 19/86 | 174/461 | 9/52 | 5/32 |
| CDK2 | 17/86 | 51/461 | 4/52 | 8/32 |
| PTPN11 | 16/86 | 106/461 | 4/52 | 0/32 |
| GSTT2B | 6/86 | 0/461 | 0/52 | 0/32 |
| NQO1 | 4/86 | 28/461 | 5/52 | 0/32 |
| PLK1 | 4/86 | 78/461 | 4/52 | 4/32 |
| KAT2B | 4/86 | 65/461 | 7/52 | 8/32 |
| Compound | MAPK14 | PI3K | ||
|---|---|---|---|---|
| Binding Energy | RMSD | Binding Energy | RMSD | |
| Standard inhibitor MAPK14 | −30.3 kJ/mol | 1.15 | -- | -- |
| Standard inhibitor of PI3K | -- | -- | 18 kJ/mol | 1.5 |
| Khellin | −25 kJ/mol | -- | −16 kJ/mol | -- |
| Category | Parameter | Prediction/Value | Interpretation |
|---|---|---|---|
| Absorption | Human intestinal absorption | 0.999 | Highly absorbed |
| Human oral bioavailability (20%) | 0.844 | Bioavailable | |
| Human oral bioavailability (50%) | 0.564 | Bioavailable | |
| Distribution | Blood–brain barrier Penetration | 0.956 | Penetrable |
| Plasma protein binding (%) | 82.68% | Therapeutic index < 90% | |
| Volume of distribution | 0.59 L/kg | Low (primarily plasma-distributed) | |
| Metabolism | CYP1A2 inhibition | 0.991 | Inhibitor |
| CYP2C19 inhibition | 0.883 | Inhibitor | |
| CYP3A4 inhibition | 0.839 | Inhibitor | |
| CYP3A4 substrate | 0.003 | Non-substrate | |
| Excretion | Half-life | 0.255 | Short (<3 h) |
| Toxicity | AMES mutagenesis | 0.316 | Non-mutagenic |
| Skin sensitization | 0.487 | Low risk (low confidence) |
| Groups | Control | Control Khe 50 | Control Khe 100 | CDDP | Khe 50 | Khe 100 |
|---|---|---|---|---|---|---|
| Glomerular affection | 0 | 0 | 0 | 1.40 ± 0.10 a | 0.30 ± 0.01 b | 0.10 ± 0.01 c |
| Degeneration of renal tubules | 0 | 0 | 0 | 2.70 ± 0.14 a | 0.90 ± 0.04 b | 0.20 ± 0.01 c |
| Congestion of blood vessels | 0 | 0 | 0.30 ± 0.03 d | 2.50 ± 0.12 a | 1.00 ± 0.04 b | 0.50 ± 0.02 c |
| Gene | Forward Primer (5′-----3′) | Reverse Primer (5′-----3′) |
|---|---|---|
| MAPK14 | GGAGATGAGCGTGAGAACGA | TCCAGGTCCTCATCTCCATC |
| PI3K | AACACAGAAGACCAATACTC | TTCGCCATCTACCACTAC |
| KIM1 | TGGCACTGTGACATCCTCAGA | GCAACGGACATGCCAACATA |
| iNOs | CACCACCCTCCTTGTTCAAC | CAATCCACAACTCGCTCCAA |
| SOD3 | AAGGAGCAAGGTCGCTTACA | ACACATCAATCCCCAGCAGT |
| CAT | GAATGGCTATGGCTCACACA | CAAGTTTTTGATGCCCTGGT |
| TNFα | GCATGATCCGCGACGTGGAA | AGATCCATGCCGTTGGCCAG |
| MCP1 | TCGCTTCTGACACCATGCA | TGCTACAGGCAGCAAATGTGA |
| IL6 | TCCTACCCCAACTTCCAATGCTC | TTGGATGGTCTTGGTCCTTAGCC |
| IL10 | GTTGCCAAGCCTTGTCAGAAA | TTTCTGGGCCATGGTTCTCT |
| Bax | ACACCTGAGCTGACCTTG | AGCCCATGATGGTTCTGATC |
| Bcl2 | ATCGCTCTGTGGATGACTGAGTAC | AGAGACAGCCAGGAGAAATCAAAC |
| β-actin | AAGTCCCTCACCCTCCCAAAAG | AAGCAATGCTGTCACCTTCCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sharawi, Z.W.; Abass, S.A.; Zubair, M.A.; Hegazy, R.A.; Farrag, F.A.; Hamdi, A.; El-Magd, M.A.; Elgazar, A.A. Khellin Mitigates Cisplatin-Induced Renal Injury by Targeting Oxidative Stress, Inflammation, and Apoptosis: Integration of Network Pharmacology, Molecular Docking, and Preclinical Validation. Pharmaceuticals 2025, 18, 836. https://doi.org/10.3390/ph18060836
Sharawi ZW, Abass SA, Zubair MA, Hegazy RA, Farrag FA, Hamdi A, El-Magd MA, Elgazar AA. Khellin Mitigates Cisplatin-Induced Renal Injury by Targeting Oxidative Stress, Inflammation, and Apoptosis: Integration of Network Pharmacology, Molecular Docking, and Preclinical Validation. Pharmaceuticals. 2025; 18(6):836. https://doi.org/10.3390/ph18060836
Chicago/Turabian StyleSharawi, Zeina W., Shimaa A. Abass, Manal A. Zubair, Rabab A. Hegazy, Foad A. Farrag, Abdelrahman Hamdi, Mohammed A. El-Magd, and Abdullah A. Elgazar. 2025. "Khellin Mitigates Cisplatin-Induced Renal Injury by Targeting Oxidative Stress, Inflammation, and Apoptosis: Integration of Network Pharmacology, Molecular Docking, and Preclinical Validation" Pharmaceuticals 18, no. 6: 836. https://doi.org/10.3390/ph18060836
APA StyleSharawi, Z. W., Abass, S. A., Zubair, M. A., Hegazy, R. A., Farrag, F. A., Hamdi, A., El-Magd, M. A., & Elgazar, A. A. (2025). Khellin Mitigates Cisplatin-Induced Renal Injury by Targeting Oxidative Stress, Inflammation, and Apoptosis: Integration of Network Pharmacology, Molecular Docking, and Preclinical Validation. Pharmaceuticals, 18(6), 836. https://doi.org/10.3390/ph18060836

