α-Cyperone Alleviates LPS-Induced Pyroptosis in Rat Aortic Endothelial Cells via the PI3K/AKT Signaling Pathway
Abstract
1. Introduction
2. Results
2.1. Analysis of Molecular Docking Results
2.2. Cytotoxic Effect of α-Cyperone on RAEC
2.3. α-Cyperone Can Alleviate LPS-Induced RAEC Cell Death
2.4. α-Cyperone Inhibits LPS-Induced IL-1β/18 Release in RAEC Cells
2.5. α-Cyperone Inhibits the LPS-Induced Expression of Caspase-1/GSDMD/NLRP3/ASC in RAEC Cells
2.6. Transcriptome Sequencing of RAEC Cells Induced by LPS Induced by α-Cyperone
2.7. DEG Profile and Functional Prediction Emphasize That α-Cyperone Inhibits LPS-Induced Pyroptosis in RAEC Cells via the PI3K/AKT Signaling Pathway
2.8. α-Cyperone Inhibits the PI3K/AKT Signaling Pathway
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Molecular Docking
- (1)
- Handling of Compounds
- (2)
- Screening of Protein Structures
- (3)
- Molecular Docking
4.3. Preparation of LPS Containing 10% Serum and α-Cyperone Drug Solution
4.4. Cell Culture and Treatment
4.5. Cell Viability Assay
4.6. LDH Release Assay
4.7. Hoechst 33342/PI Double Staining
4.8. Cytokine Detection
4.9. RNA-Seq Analysis
4.10. Real-Time Reverse Transcription PCR
4.11. Western Blot Detection
4.12. Results Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rao, Z.; Zhu, Y.; Yang, P.; Chen, Z.; Xia, Y.; Qiao, C.; Liu, W.; Deng, H.; Li, J.; Ning, P.; et al. Pyroptosis in inflammatory diseases and cancer. Theranostics 2022, 12, 4310–4329. [Google Scholar] [PubMed]
- Broz, P.; Pelegrín, P.; Shao, F. The gasdermins, a protein family executing cell death and inflammation. Nat. Rev. Immunol. 2020, 20, 143–157. [Google Scholar] [PubMed]
- Liu, X.; Xia, S.; Zhang, Z.; Wu, H.; Lieberman, J. Channelling inflammation: Gasdermins in physiology and disease. Nat. Rev. Drug Discov. 2021, 20, 384–405. [Google Scholar] [PubMed]
- Newton, K.; Strasser, A.; Kayagaki, N.; Dixit, V.M. Cell death. Cell 2024, 187, 235–256. [Google Scholar]
- Wei, Y.; Yang, L.; Pandeya, A.; Cui, J.; Zhang, Y.; Li, Z. Pyroptosis-Induced Inflammation and Tissue Damage. J. Mol. Biol. 2022, 434, 167301. [Google Scholar]
- Takahashi, M. NLRP3 inflammasome as a key driver of vascular disease. Cardiovasc. Res. 2022, 118, 372–385. [Google Scholar]
- Dejas, L.; Santoni, K.; Meunier, E.; Lamkanfi, M. Regulated cell death in neutrophils: From apoptosis to NETosis and pyroptosis. Semin. Immunol. 2023, 70, 101849. [Google Scholar]
- Chang, W.; Lin, J.; Dong, J.; Li, D. Pyroptosis: An inflammatory cell death implicates in atherosclerosis. Med. Hypotheses 2013, 81, 484–486. [Google Scholar]
- Bernard, N.J. Gasdermin splicing. Nat. Immunol. 2023, 24, 886. [Google Scholar]
- Yuan, J.; Ofengeim, D. A guide to cell death pathways. Nat. Rev. Mol. Cell Biol. 2024, 25, 379–395. [Google Scholar]
- Wang, D.; Wan, X. Progress in the study of molecular mechanisms of cell pyroptosis in tumor therapy. Int. Immunopharmacol. 2023, 118, 110143. [Google Scholar] [CrossRef] [PubMed]
- Pirzada, A.M.; Ali, H.H.; Naeem, M.; Latif, M.; Bukhari, A.H.; Tanveer, A. Cyperus rotundus L.: Traditional uses, phytochemistry, and pharmacological activities. J. Ethnopharmacol. 2015, 174, 540–560. [Google Scholar] [CrossRef] [PubMed]
- Sofia, H.N.; Walter, T.M.; Merish, S.; Tamizhamuthu, M. An overview of nut grass (Cyperus rotundus) with special reference to ayush. World J. Pharm. Res. 2014, 3, 1459–1471. [Google Scholar]
- Sivapalan, S.R.S. Medicinal uses and Pharmacological activities of Cyperus rotundus Linn—A Review. Int. J. Sci. Res. Publ. 2013, 3, 2250–3153. [Google Scholar]
- Taheri, Y.; Herrera-Bravo, J.; Huala, L.; Salazar, L.A.; Sharifi-Rad, J.; Akram, M.; Shahzad, K.; Melgar-Lalanne, G.; Baghalpour, N.; Tamimi, K.; et al. Cyperus spp.: A Review on Phytochemical Composition, Biological Activity, and Health-Promoting Effects. Oxidative Med. Cell. Longev. 2021, 2021, 4014867. [Google Scholar] [CrossRef]
- Huang, B.; He, D.; Chen, G.; Ran, X.; Guo, W.; Kan, X.; Wang, W.; Liu, D.; Fu, S.; Liu, J. α-Cyperone inhibits LPS-induced inflammation in BV-2 cells through activation of Akt/Nrf2/HO-1 and suppression of the NF-κB pathway. Food Funct. 2018, 9, 2735–2743. [Google Scholar] [CrossRef]
- Zhang, H.; Li, S.; Lu, J.; Jin, J.; Zhu, G.; Wang, L.; Yan, Y.; He, L.; Wang, B.; Wang, X.; et al. α-Cyperone (CYP) down-regulates NF-κB and MAPKs signaling, attenuating inflammation and extracellular matrix degradation in chondrocytes, to ameliorate osteoarthritis in mice. Aging 2021, 13, 17690–17706. [Google Scholar] [CrossRef]
- Jung, S.H.; Kim, S.J.; Jun, B.G.; Lee, K.T.; Hong, S.P.; Oh, M.S.; Jang, D.S.; Choi, J.H. α-Cyperone, isolated from the rhizomes of Cyperus rotundus, inhibits LPS-induced COX-2 expression and PGE2 production through the negative regulation of NFκB signalling in RAW 264.7 cells. J. Ethnopharmacol. 2013, 147, 208–214. [Google Scholar] [CrossRef]
- Huang, B.; Hu, G.; Zong, X.; Yang, S.; He, D.; Gao, X.; Liu, D. α-Cyperone protects dopaminergic neurons and inhibits neuroinflammation in LPS-induced Parkinson’s disease rat model via activating Nrf2/HO-1 and suppressing NF-κB signaling pathway. Int. Immunopharmacol. 2023, 115, 109698. [Google Scholar] [CrossRef]
- Park, K.-T.; Sim, I.; Lee, J.-C.; Jin, Y.-H.; Kim, W. Cyperus rotundus Extract and Its Active Metabolite α-Cyperone Alleviates Paclitaxel-Induced Neuropathic Pain via the Modulation of the Norepinephrine Pathway. Metabolites 2024, 14, 719. [Google Scholar] [CrossRef]
- Pei, X.D.; Yao, H.L.; Shen, L.Q.; Yang, Y.; Lu, L.; Xiao, J.S.; Wang, X.Y.; He, Z.L.; Jiang, L.H. α-Cyperone inhibits the proliferation of human cervical cancer HeLa cells via ROS-mediated PI3K/Akt/mTOR signaling pathway. Eur. J. Pharmacol. 2020, 883, 173355. [Google Scholar] [CrossRef] [PubMed]
- Hsu, S.K.; Li, C.Y.; Lin, I.L.; Syue, W.J.; Chen, Y.F.; Cheng, K.C.; Teng, Y.N.; Lin, Y.H.; Yen, C.H.; Chiu, C.C. Inflammation-related pyroptosis, a novel programmed cell death pathway, and its crosstalk with immune therapy in cancer treatment. Theranostics 2021, 11, 8813–8835. [Google Scholar] [CrossRef] [PubMed]
- Huston, H.C.; Anderson, M.J.; Fink, S.L. Pyroptosis and the cellular consequences of gasdermin pores. Semin. Immunol. 2023, 69, 101803. [Google Scholar] [CrossRef]
- Hachim, M.Y.; Khalil, B.A.; Elemam, N.M.; Maghazachi, A.A. Pyroptosis: The missing puzzle among innate and adaptive immunity crosstalk. J. Leukoc. Biol. 2020, 108, 323–338. [Google Scholar] [CrossRef]
- Tan, Y.; Chen, Q.; Li, X.; Zeng, Z.; Xiong, W.; Li, G.; Li, X.; Yang, J.; Xiang, B.; Yi, M. Pyroptosis: A new paradigm of cell death for fighting against cancer. J. Exp. Clin. Cancer Res. 2021, 40, 153. [Google Scholar] [CrossRef]
- Xia, X.; Wang, X.; Cheng, Z.; Qin, W.; Lei, L.; Jiang, J.; Hu, J. The role of pyroptosis in cancer: Pro-cancer or pro-“host”? Cell Death Dis. 2019, 10, 650. [Google Scholar] [CrossRef]
- Du, T.; Gao, J.; Li, P.; Wang, Y.; Qi, Q.; Liu, X.; Li, J.; Wang, C.; Du, L. Pyroptosis, metabolism, and tumor immune microenvironment. Clin. Transl. Med. 2021, 11, e492. [Google Scholar] [CrossRef]
- Li, T.; Zheng, G.; Li, B.; Tang, L. Pyroptosis: A promising therapeutic target for noninfectious diseases. Cell Prolif. 2021, 54, e13137. [Google Scholar] [CrossRef]
- Yarovinsky, T.O.; Su, M.; Chen, C.; Xiang, Y.; Tang, W.H.; Hwa, J. Pyroptosis in cardiovascular diseases: Pumping gasdermin on the fire. Semin. Immunol. 2023, 69, 101809. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhu, Z.; Cao, Y.; Xiong, Z.; Duan, Y.; Lin, J.; Zhang, X.; Jiang, M.; Liu, Y.; Man, W.; et al. Rnd3 suppresses endothelial cell pyroptosis in atherosclerosis through regulation of ubiquitination of TRAF6. Clin. Transl. Med. 2023, 13, e1406. [Google Scholar] [CrossRef]
- Yang, Q.; Chen, S.; Wang, X.; Yang, X.; Chen, L.; Huang, T.; Zheng, Y.; Zheng, X.; Wu, X.; Sun, Y.; et al. Exercise Mitigates Endothelial Pyroptosis and Atherosclerosis by Downregulating NEAT1 Through N6-Methyladenosine Modifications. Arterioscler. Thromb. Vasc. Biol. 2023, 43, 910–926. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Zhang, H.; Qi, W.; Zhang, Y.; Li, J.; Li, Z.; Lin, Y.; Bai, X.; Liu, X.; Chen, X.; et al. Nicotine promotes atherosclerosis via ROS-NLRP3-mediated endothelial cell pyroptosis. Cell Death Dis. 2018, 9, 171. [Google Scholar] [PubMed]
- Wei, C.; Jiang, W.; Wang, R.; Zhong, H.; He, H.; Gao, X.; Zhong, S.; Yu, F.; Guo, Q.; Zhang, L.; et al. Brain endothelial GSDMD activation mediates inflammatory BBB breakdown. Nature 2024, 629, 893–900. [Google Scholar]
- Bai, B.; Yang, Y.; Wang, Q.I.; Li, M.; Tian, C.; Liu, Y.; Aung, L.H.; Li, P.F.; Yu, T.; Chu, X.M. NLRP3 inflammasome in endothelial dysfunction. Cell Death Dis. 2020, 11, 776. [Google Scholar]
- Bellut, M.; Papp, L.; Bieber, M.; Kraft, P.; Stoll, G.; Schuhmann, M.K. NLPR3 inflammasome inhibition alleviates hypoxic endothelial cell death in vitro and protects blood-brain barrier integrity in murine stroke. Cell Death Dis. 2021, 13, 20. [Google Scholar]
- Deng, M.; Tang, Y.; Li, W.; Wang, X.; Zhang, R.; Zhang, X.; Zhao, X.; Liu, J.; Tang, C.; Liu, Z.; et al. The Endotoxin Delivery Protein HMGB1 Mediates Caspase-11-Dependent Lethality in Sepsis. Immunity 2018, 49, 740–753.e7. [Google Scholar] [CrossRef]
- Kumari, P.; Vasudevan, S.O.; Russo, A.J.; Wright, S.S.; Fraile-Ágreda, V.; Krajewski, D.; Jellison, E.R.; Rubio, I.; Bauer, M.; Shimoyama, A.; et al. Host extracellular vesicles confer cytosolic access to systemic LPS licensing non-canonical inflammasome sensing and pyroptosis. Nat. Cell Biol. 2023, 25, 1860–1872. [Google Scholar] [CrossRef]
- Chen, S.; Li, S.; Chen, H.; Gong, Y.; Yang, D.; Zhang, Y.; Liu, Q. Caspase-mediated LPS sensing and pyroptosis signaling in Hydra. Sci. Adv. 2023, 9, eadh4054. [Google Scholar]
- Toldo, S.; Abbate, A. The role of the NLRP3 inflammasome and pyroptosis in cardiovascular diseases. Nat. Rev. Cardiol. 2024, 21, 219–237. [Google Scholar]
- Zhao, Y.; Shao, C.; Zhou, H.; Yu, L.; Bao, Y.; Mao, Q.; Yang, J.; Wan, H. Salvianolic acid B inhibits atherosclerosis and TNF-α-induced inflammation by regulating NF-κB/NLRP3 signaling pathway. Phytomed. Int. J. Phytother. Phytopharm. 2023, 119, 155002. [Google Scholar]
- Zhang, S.; Yan, F.; Luan, F.; Chai, Y.; Li, N.; Wang, Y.W.; Chen, Z.L.; Xu, D.Q.; Tang, Y.P. The pathological mechanisms and potential therapeutic drugs for myocardial ischemia reperfusion injury. Phytomed. Int. J. Phytother. Phytopharm. 2024, 129, 155649. [Google Scholar]
- She, Y.; Shao, L.; Jiao, K.; Sun, R.; Lang, T.; Long, H.; Tang, Y.; Zhang, W.; Ding, C.; Deng, C. Glycosides of Buyang Huanwu decoction inhibits pyroptosis associated with cerebral ischemia-reperfusion through Nrf2-mediated antioxidant signaling pathway both in vivo and in vitro. Phytomed. Int. J. Phytother. Phytopharm. 2023, 120, 155001. [Google Scholar]
- Yu, P.; Zhang, X.; Liu, N.; Tang, L.; Peng, C.; Chen, X. Pyroptosis: Mechanisms and diseases. Signal Transduct. Target. Ther. 2021, 6, 128. [Google Scholar] [PubMed]








| Protein Name | 2D Structure | 3D Structure | Active Pocket | Binding Affinity (kcal/mol) |
|---|---|---|---|---|
| Caspase-1 | ![]() | ![]() | ![]() | −5.285 |
| GSDMD | ![]() | ![]() | ![]() | −5.348 |
| NLRP3 | ![]() | ![]() | ![]() | −5.047 |
| ASC | ![]() | ![]() | ![]() | −5.160 |
| Primer | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| Caspase-1 | CTGGGCAAAGGGAAGACTGTAGATG | ATGATGGCAACGATGGCAGGATAC |
| GSDMD | GTGAGCCACCCTGCTATTCA | GCAGGCATCCAGGCA ATAGA |
| NLRP3 | GAGCTGGACCTCAGTGACAATGC | AGAACCAATGCGAGATCCTGACAAC |
| ASC | ATGGTTTGCTGGATGCTCTGTATGG | AAGGAACAAGTTCTTGCAGGTCAGG |
| GAPDH | ACTCTACCCACGGCAAGTTC | TGGGTTTCCCGTTGATGACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, S.; Zhang, Y.; Liang, X.; Yin, L.; He, C. α-Cyperone Alleviates LPS-Induced Pyroptosis in Rat Aortic Endothelial Cells via the PI3K/AKT Signaling Pathway. Pharmaceuticals 2025, 18, 303. https://doi.org/10.3390/ph18030303
Liu S, Zhang Y, Liang X, Yin L, He C. α-Cyperone Alleviates LPS-Induced Pyroptosis in Rat Aortic Endothelial Cells via the PI3K/AKT Signaling Pathway. Pharmaceuticals. 2025; 18(3):303. https://doi.org/10.3390/ph18030303
Chicago/Turabian StyleLiu, Shuanghui, Yankun Zhang, Xiaoxia Liang, Lizi Yin, and Changliang He. 2025. "α-Cyperone Alleviates LPS-Induced Pyroptosis in Rat Aortic Endothelial Cells via the PI3K/AKT Signaling Pathway" Pharmaceuticals 18, no. 3: 303. https://doi.org/10.3390/ph18030303
APA StyleLiu, S., Zhang, Y., Liang, X., Yin, L., & He, C. (2025). α-Cyperone Alleviates LPS-Induced Pyroptosis in Rat Aortic Endothelial Cells via the PI3K/AKT Signaling Pathway. Pharmaceuticals, 18(3), 303. https://doi.org/10.3390/ph18030303













