Aspergillus oryzae Fermented Plumula Nelumbinis Against Atopic Dermatitis Through AKT/mTOR and Jun Pathways
Abstract
1. Introduction
2. Results
2.1. Potential Targets of FPN for AD Treatment
2.2. “Compounds–Target–AD” Network
2.3. PPI Network Diagram
2.4. GO and KEGG Enrichment Analysis
2.5. Molecular Docking Results
2.6. Effect of FPN on Gene Expression
2.7. Effect of FPN on Protein Expression
2.8. The Effect of FPN on Neutrophils in Zebrafish
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Prediction of Drug and Disease Targets
4.3. Network Construction
4.4. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analysis of Core Targets
4.5. Molecular Docking
4.6. RT-qPCR
4.7. Western Blot Analysis
4.8. The Anti-Inflammatory Activity Assay In Vivo
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Oh, J.H.; Kim, S.H.; Kwon, O.K.; Kim, J.H.; Oh, S.R.; Han, S.B.; Park, J.W.; Ahn, K.S. Purpurin suppresses atopic dermatitis via TNF-α/IFN-γ-induced inflammation in HaCaT cells. Int. J. Immunopathol. Pharmacol. 2022, 36, 3946320221111135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahn, K.; Kim, B.E.; Kim, J.; Leung, D.Y.M. Recent advances in atopic dermatitis. Curr. Opin. Immunol. 2020, 66, 14–21. [Google Scholar] [CrossRef] [Scilit]
- Portugal-Cohen, M.; Horev, L.; Ruffer, C.; Schlippe, G.; Voss, W.; Ma’or, Z.; Oron, M.; Soroka, Y.; Frušić-Zlotkin, M.; Milner, Y.; et al. Non-invasive skin biomarkers quantification of psoriasis and atopic dermatitis: Cytokines, antioxidants and psoriatic skin auto-fluorescence. Biomed. Pharmacother. 2012, 66, 293–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brandt, E.B.; Sivaprasad, U. Th2 Cytokines and Atopic Dermatitis. J. Clin. Cell Immunol. 2011, 2, 110. [Google Scholar] [CrossRef]
- Hadi, H.A.; Tarmizi, A.L.; Khalid, K.A.; Gajdács, M.; Aslam, A.; Jamshed, S. The Epidemiology and Global Burden of Atopic Dermatitis: A Narrative Review. Life 2021, 11, 936. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mosam, A.; Todd, G. Global epidemiology and disparities in atopic dermatitis. Br. J. Dermatol. 2023, 188, 726–737. [Google Scholar] [CrossRef] [Scilit]
- Eyerich, K.; Gooderham, M.J.; Silvestre, J.F.; Shumack, S.P.; Bastos, M.P.; Aoki, V.; Ortoncelli, M.; Silverberg, J.I.; Teixeira, H.D.; Chen, S.H.; et al. Real-world clinical, psychosocial and economic burden of atopic dermatitis: Results from a multicountry study. J. Eur. Acad. Dermatol. Venereol. 2024, 38, 340–353. [Google Scholar] [CrossRef] [Scilit]
- Kim, B.S.; Howell, M.D.; Sun, K.; Papp, K.; Nasir, A.; Kuligowski, M.E. Treatment of atopic dermatitis with ruxolitinib cream (JAK1/JAK2 inhibitor) or triamcinolone cream. J. Allergy Clin. Immunol. 2020, 145, 572–582. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.; Pang, Y.B.; He, Y.J.; Zhang, X.T.; Peng, L.; Guo, J.; Zeng, J.H. A comprehensive review of natural products against atopic dermatitis: Flavonoids, alkaloids, terpenes, glycosides and other compounds. Biomed. Pharmacother. 2021, 140, 111741. [Google Scholar] [CrossRef] [Scilit]
- Xie, L.N.; Yang, K.Y.; Liang, Y.H.; Zhu, Z.Y.; Yuan, Z.Q.; Du, Z.Y. Tremella fuciformis polysaccharides alleviate induced atopic dermatitis in mice by regulating immune response and gut microbiota. Front. Pharmacol. 2022, 13, 944801. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.S.; Kim, E.N.; Jeong, G.S. Oral administration of liquiritigenin confers protection from atopic dermatitis through the inhibition of T cell activation. Biomolecules 2020, 10, 786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Du, W.X.; Zhu, D.F.; Li, M.L.; Qu, L.; Rao, G.X.; Lin, Y.P.; Tong, X.Y.; Sun, Y.; Huang, F. Vasicine alleviates 2,4-dinitrochlorobenzene-induced atopic dermatitis and passive cutaneous anaphylaxis in BALB/c mice. Clin. Immunol. 2022, 244, 109102. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Lu, H.Z.; Cheng, L.Y.; Guo, W.J.; Hu, Y.; Du, X.R.; Liu, X.; Xu, M.Y.; Liu, Y.Q.; Zhang, Y.B.; et al. Targeting mitochondrial dysfunction in atopic dermatitis with trilinolein: A triacylglycerol from the medicinal plant Cannabis fructus. Phytomedicine 2024, 132, 155856. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.X.; Li, X.P.; Wu, J.X.; Li, J.Y.; Xiao, M.Z.; Yang, Y.; Liu, Z.Q.; Cheng, Y.Y. Plumula Nelumbinis: A review of traditional uses, phytochemistry, pharmacology, pharmacokinetics, and safety. J. Ethnopharmacol. 2021, 266, 113429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Yuan, S.L.; Fan, H.; Zhang, W.; Zhang, H.G. Liensinine alleviates sepsis-induced acute liver injury by inhibiting the NF-κB and MAPK pathways in an Nrf2-dependent manner. Chem. Biol. Interact. 2024, 396, 111030. [Google Scholar] [CrossRef] [Scilit]
- Feng, X.; Xie, B.P.; Han, Y.T.; Li, Z.Y.; Cheng, Y.Y.; Tian, L.W. Bisbenzylisoquinoline alkaloids from Plumula Nelumbinis inhibit vascular smooth muscle cell migration and proliferation by regulating the ORAI2/Akt pathway. Phytochemistry 2023, 211, 113700. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.X.; Guo, W.Y.; Qi, X.X.; Zhou, J.Y.; Liu, Z.Q.; Cheng, Y.Y. Natural alkaloids from lotus plumule ameliorate lipopolysaccharide-induced depression-like behavior: Integrating network pharmacology and molecular mechanism evaluation. Food Funct. 2019, 10, 6062–6073. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, A.; Bai, H.L.; Liu, E.Q.; Chen, M.X.; Yu, C.S.; Wang, R.; Khan, A.; Bai, Z.L. Protective effect of Neferine against UV-B-mediated oxidative damage in human epidermal keratinocytes. J. Dermatol. Treat. 2018, 29, 733–741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, C.C.; Hung, Y.L.; Ko, W.C.; Tsai, Y.J.; Chang, J.F.; Liang, C.W.; Chang, D.C.; Hung, C.F. Effect of Neferine on DNCB-Induced atopic dermatitis in HaCaT cells and BALB/c mice. Int. J. Mol. Sci. 2021, 22, 8237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, M.T.; Zhang, C.; Tang, S.L.; Zhao, Z.Z.; Chen, H.B.; Zhang, J.Y. Metabolites identification for alkaloids from Nelumbinis Plumula in Caco-2 cells by LC/MS/MS. J. Chin. Med. Mater. 2015, 38, 2531–2534. [Google Scholar]
- Han, D.N. Identification of Metabolites and Pharmacokinetics of Total Alkaloids of Louts Plumule in Rats. Ph.D. Thesis, Liaoning University, Shenyang, China, 2018. [Google Scholar]
- Kim, S.H.; Seong, G.S.; Choung, S.Y. Fermented Morinda citrifolia (Noni) alleviates DNCB-induced atopic dermatitis in NC/Nga mice through modulating immune balance and skin barrier function. Nutrients 2020, 12, 249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, W.J.; Zhang, Y.W.; Li, W.J.; Hu, Q.Z.; Huang, H.Z.; Xu, X.; Du, B.; Li, P. Probiotic-fermented Portulaca oleracea L. alleviated DNFB-induced atopic dermatitis by inhibiting the NF-κB signaling pathway. J. Ethnopharmacol. 2023, 313, 116613. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saba, E.; Lee, C.H.; Jeong, D.H.; Lee, K.; Kim, T.H.; Roh, S.S.; Kim, S.H.; Rhee, M.H. Fermented rice bran prevents atopic dermatitis in DNCB-treated NC/Nga mice. J. Biomed. Res. 2016, 30, 334–343. [Google Scholar] [PubMed]
- Yu, X.W.; Zhang, L.; Li, Y.Y.; Jia, H.L.; Liu, C.H.; Zhao, B.T.; Yang, C. Exploring the alleviating effects of Aspergillus oryzae-fermented Plumula Nelumbinis extracts in atopic dermatitis. Food Ferment. Ind. 2024, 50, 76–82. [Google Scholar]
- Hussain, S.; Mustafa, G.; Ahmed, S.; Albeshr, M.F. Underlying mechanisms of Bergenia spp. to treat hepatocellular carcinoma using an integrated network pharmacology and molecular docking approach. Pharmaceuticals 2023, 16, 1239. [Google Scholar] [CrossRef] [Scilit]
- Gao, S.S.; Sun, J.J.; Wang, X.; Hu, Y.Y.; Feng, Q.; Gou, X.J. Research on the mechanism of Qushi Huayu Decoction in the intervention of nonalcoholic fatty liver disease based on network pharmacology and molecular docking technology. BioMed Res. Int. 2020, 2020, 1704960. [Google Scholar] [CrossRef] [Scilit]
- Yan, X.X.; Inta, A.; Yang, X.F.; Pandith, H.; Disayathanoowat, T.; Yang, L.X. An investigation of the effect of the traditional Naxi herbal formula against liver cancer through network pharmacology, molecular docking, and in vitro experiments. Pharmaceuticals 2024, 17, 1429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mhalhel, K.; Sicari, M.; Pansera, L.; Chen, J.; Levanti, M.; Diotel, N.; Rastegar, S.; Germanà, A.; Montalbano, G. Zebrafish: A model deciphering the impact of flavonoids on neurodegenerative disorders. Cells 2023, 12, 252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohammad, S.; Karim, M.R.; Iqbal, S.; Lee, J.H.; Mathiyalagan, R.; Kim, Y.J.; Yang, D.U.; Yang, D.C. Atopic dermatitis: Pathophysiology, microbiota, and metabolome—A comprehensive review. Microbiol. Res. 2024, 281, 127595. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rao, H.; Tan, J.B.L. Polysaccharide-based hydrogels for atopic dermatitis management: A review. Carbohydr. Polym. 2025, 349, 122966. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.C.; Liu, Y.Y.; Chen, L.; Tang, D.M.; Zhao, Y.L.; Luo, X.D. Antimelanogenic effect of isoquinoline alkaloids from Plumula nelumbinis. J. Agric. Food Chem. 2023, 71, 16090–16101. [Google Scholar] [CrossRef] [Scilit]
- Duan, W.J.; Chen, J.M.; Wu, Y.; Zhang, Y.; Xu, Y.S. Protective effect of higenamine ameliorates collagen-induced arthritis through heme oxygenase-1 and PI3K/Akt/Nrf-2 signaling pathways. Exp. Ther. Med. 2016, 12, 3107–3112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, H.C.; Yang, Y.P.; Guo, S.; Yang, J.; Jiang, K.F.; Zhao, G.; Qiu, C.W.; Deng, G.Z. Nuciferine ameliorates inflammatory responses by inhibiting the TLR4-mediated pathway in lipopolysaccharide-induced acute lung injury. Front. Pharmacol. 2017, 8, 939. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, L.J.; Jiang, S.J.; Liu, X.Q.; Tang, Q.; Chen, Y.; Qu, J.J.; Wang, L.; Wang, Q.; Wang, Y.L.; Wang, J.M.; et al. Inflammatory response and oxidative stress as mechanism of reducing hyperuricemia of Gardenia jasminoides—Poria cocos with network pharmacology. Oxid. Med. Cell Longev. 2021, 2021, 8031319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Dong, Y.; Zhang, Z.L.; Han, J.; Chen, F.S.; Tong, X.Y.; Ma, H. Fra-1 induces apoptosis and neuroinflammation by targeting S100A8 to modulate TLR4 pathways in spinal cord ischemia/reperfusion injury. Brain Pathol. 2023, 33, e13113. [Google Scholar] [CrossRef] [Scilit]
- Sasakura, M.; Urakami, H.; Tachibana, K.; Ikeda, K.; Hasui, K.I.; Matsuda, Y.; Sunagawa, K.; Ennishi, D.; Tomida, S.; Morizane, S. Topical application of activator protein-1 inhibitor T-5224 suppresses inflammation and improves skin barrier function in a murine atopic dermatitis-like dermatitis. Allergol. Int. 2024, 73, 323–331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, Z.L.; Zhang, K.; Lv, S.C.; Xu, G.W.; Zhang, J.F.; Jia, H.Y. LncRNA MEG3 suppresses PI3K/AKT/mTOR signaling pathway to enhance autophagy and inhibit inflammation in TNF-α-treated keratinocytes and psoriatic mice. Cytokine 2021, 148, 155657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agamia, N.F.; Abdallah, D.M.; Sorour, O.; Mourad, B.; Younan, D.N. Skin expression of mammalian target of rapamycin and forkhead box transcription factor O1, and serum insulin-like growth factor-1 in patients with acne vulgaris and their relationship with diet. Br. J. Dermatol. 2016, 174, 1299–1307. [Google Scholar] [CrossRef] [Scilit]
- Naeem, A.S.; Tommasi, C.; Cole, C.; Brown, S.J.; Zhu, Y.; Way, B.; Willis Owen, S.A.G.; Moffatt, M.; Cookson, W.O.; Harper, J.I.; et al. A mechanistic target of rapamycin complex 1/2 (MTORC1)/V-Akt murine thymoma viral oncogene homolog 1 (AKT1)/cathepsin H axis controls filaggrin expression and processing in skin, a novel mechanism for skin barrier disruption in patients with atopic dermatitis. J. Allergy Clin. Immunol. 2017, 139, 1228–1241. [Google Scholar]
- Chamcheu, J.C.; Roy, T.; Uddin, M.B.; Banang-Mbeumi, S.; Chamcheu, R.C.N.; Walker, A.L.; Liu, Y.Y.; Huang, S. Role and therapeutic targeting of the PI3K/Akt/mTOR signaling pathway in skin cancer: A review of current status and future trends on natural and synthetic agents therapy. Cells 2019, 8, 803. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.Y.; Liu, E.Q.; Li, W.; Cui, J.; Li, T.X. MiR-3188 inhibits non-small cell lung cancer cell proliferation through FOXO1-mediated mTOR-p-PI3K/AKT-c-JUN signaling pathway. Front. Pharmacol. 2018, 9, 1362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roy, T.; Boateng, S.T.; Uddin, M.B.; Banang-Mbeumi, S.; Yadav, R.K.; Bock, C.R.; Folahan, J.T.; Siwe-Noundou, X.; Walker, A.L.; King, J.A.; et al. The PI3K-Akt-mTOR and associated signaling pathways as molecular drivers of immune-mediated inflammatory skin diseases: Update on therapeutic strategy using natural and synthetic compounds. Cells 2023, 12, 1671. [Google Scholar] [CrossRef] [Scilit]
- Tran, H.G.; Shuayprom, A.; Kueanjinda, P.; Leelahavanichkul, A.; Wongsinkongman, P.; Chaisomboonpan, S.; Tawatsin, A.; Ruchusatsawat, K.; Wongpiyabovorn, J. Oxyresveratrol attenuates inflammation in human keratinocyte via regulating NF-κB signaling and ameliorates eczematous lesion in DNCB-induced dermatitis mice. Pharmaceutics 2023, 15, 1709. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, J.; Seo, Y.Y.; Lee, Y.A.; Nam, H.H.; Ji, K.Y.; Kim, T.; Lee, S.; Hyun, J.W.; Moon, C.; Cho, Y.; et al. Anti-Atopic Effect of Scutellaria baicalensis and Raphanus sativus on Atopic Dermatitis-like Lesions in Mice by Experimental Verification and Compound-Target Prediction. Pharmaceuticals 2024, 7, 269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.Q.; Deng, J.L.; Shao, H.F.; Yang, N.N. Network pharmacology-based analysis to explore the therapeutic mechanism of Cortex Dictamni on atopic dermatitis. J. Ethnopharmacol. 2023, 304, 116023. [Google Scholar]
- Lee, G.; Park, J.; Lee, H.; Kim, K.S.; Park, J.H.; Kyung, S.Y.; Kim, H.S.; Yang, H.O.; Jung, B.H. Anti-inflammatory effect and metabolic mechanism of BS012, a mixture of Asarum sieboldii, Platycodon grandiflorum, and Cinnamomum cassia extracts, on atopic dermatitis in vivo and in vitro. Phytomedicine 2023, 115, 154818. [Google Scholar] [CrossRef] [Scilit]
- Luo, J.L.; Li, Y.; Zhai, Y.M.; Liu, Y.; Zeng, J.X.; Wang, D.; Li, L.; Zhu, Z.Y.; Chang, B.; Deng, F.; et al. D-Mannose ameliorates DNCB-induced atopic dermatitis in mice and TNF-α-induced inflammation in human keratinocytes via mTOR/NF-κB pathway. Int. Immunopharmacol. 2022, 113, 109378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daina, A.; Michielin, O.; Zoete, V. SwissTargetPrediction: Updated data and new features for efficient prediction of protein targets of small molecules. Nucleic Acids Res. 2019, 47, W357–W364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Safran, M.; Rosen, N.; Twik, M.; BarShir, R.; Stein, T.I.; Dahary, D.; Fishilevich, S.; Lancet, D. The genecards suite. In Practical Guide to Life Science Databases; Springer: Singapore, 2021; pp. 27–56. [Google Scholar]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [Scilit]
- Sherman, B.T.; Hao, M.; Qiu, J.; Jiao, X.L.; Baseler, M.W.; Lane, H.C.; Imamichi, T.; Chang, W. DA VID: A web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. 2022, 50, W216–W221. [Google Scholar] [CrossRef] [Scilit]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, Y.G.; Fu, W.; Xu, J.Q.; Lei, Y.W.; Song, X.; Liang, Z.W.; Zhu, T.; Liang, Y.H.; Hao, Y.H.; Yuan, L.B.; et al. Bromodomain-containing proteins BRD1, BRD2, and BRD13 are core subunits of SWI/SNF complexes and vital for their genomic targeting in Arabidopsis. Mol. Plant 2021, 14, 888–904. [Google Scholar] [CrossRef] [Scilit]








| Target | Affinity (kcal/mol) | ||||||
|---|---|---|---|---|---|---|---|
| Neferine | Liensinine | Isoliensinine | Armepavine | N-Demethylcolletine | N-Methylcoclaurine | Control | |
| mTOR | −11.1 | −11.2 | −11.6 | −8.9 | −8.6 | −7.4 | −8.9 |
| Jun | −10.4 | −10.7 | −10.1 | −8.1 | −9.1 | −7.2 | −7.6 |
| AKT | −10.0 | −9.9 | −9.9 | −7.9 | −8.5 | −7.6 | −8.8 |
| Gene | Primer | Sequence (5′-3′) | Length (bp) |
|---|---|---|---|
| Homo GAPDH | Forward | TCAAGAAGGTGGTGAAGCAGG | 115 |
| Reverse | TCAAAGGTGGAGGAGTGGGT | ||
| Homo AKT | Forward | ACACCAGGTATTTTGATGAGGAG | 143 |
| Reverse | TCAGGCCGTGCCGCTGGCCGAGTAG | ||
| Homo c-Jun | Forward | AACGTGACAGATGAGCAGGA | 232 |
| Reverse | CTGGGTTGAAGTTGCTGAGG | ||
| Homo mTOR | Forward | CCCCTTCACCAGTTTCCA | 220 |
| Reverse | CAGCGAGTTCTTGCTATTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, F.; Liu, J.; Yu, X.; Jia, H.; Yang, C.; Zhao, B. Aspergillus oryzae Fermented Plumula Nelumbinis Against Atopic Dermatitis Through AKT/mTOR and Jun Pathways. Pharmaceuticals 2025, 18, 20. https://doi.org/10.3390/ph18010020
Chen F, Liu J, Yu X, Jia H, Yang C, Zhao B. Aspergillus oryzae Fermented Plumula Nelumbinis Against Atopic Dermatitis Through AKT/mTOR and Jun Pathways. Pharmaceuticals. 2025; 18(1):20. https://doi.org/10.3390/ph18010020
Chicago/Turabian StyleChen, Fengfeng, Jing Liu, Xinwei Yu, Honglei Jia, Cheng Yang, and Bingtian Zhao. 2025. "Aspergillus oryzae Fermented Plumula Nelumbinis Against Atopic Dermatitis Through AKT/mTOR and Jun Pathways" Pharmaceuticals 18, no. 1: 20. https://doi.org/10.3390/ph18010020
APA StyleChen, F., Liu, J., Yu, X., Jia, H., Yang, C., & Zhao, B. (2025). Aspergillus oryzae Fermented Plumula Nelumbinis Against Atopic Dermatitis Through AKT/mTOR and Jun Pathways. Pharmaceuticals, 18(1), 20. https://doi.org/10.3390/ph18010020

