Betulinic Acid-Brosimine B Hybrid Compound Has a Synergistic Effect with Imatinib in Chronic Myeloid Leukemia Cell Line, Modulating Apoptosis and Autophagy
Abstract
1. Introduction
2. Results
2.1. The Hybrid Compound Inhibits the Growth of Human Leukemia Cells
2.2. The Combination of the Hybrid Compound and Imatinib Synergistically Inhibited the Growth of Human Leukemia Cells
2.3. The Hybrid Compound Induces Apoptosis by Increasing Caspase-3 and Caspase-9 Expression in K-562 and K-562R Cells
2.4. The Hybrid Compound Modulates the Cell Cycle Distributions of K-562 and K-562R Cells
2.5. The Hybrid Compound Activates Autophagy by Increasing the Expressions of LC3-II and Beclin-1 in K-562 and K-562R Cells
2.6. The Hybrid Compound Induces Intracellular Reactive Oxygen Species (ROS) Generation in Human Leukemia Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Synthesis of Hybrid Compound
4.3. Cell Counting
4.4. Selectivity Index (SI) Analysis
4.5. Analysis of the Effects of Drug Combinations
4.6. Evaluation of Cell Death
4.6.1. Annexin V–FITC/PI Staining
4.6.2. Detection of Morphological Changes
4.6.3. Cell Cycle Analysis
4.6.4. Autophagy Analysis
4.7. Quantitative Reverse Transcription-Polymerase Chain Reaction (RT-qPCR)
4.8. Determination of ROS Generation
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tamascar, I.; Ramanarayanan, J. Targeted treatment of chronic myeloid leukemia: Role of imatinib. OncoTargets Ther. 2009, 2, 63–71. [Google Scholar] [CrossRef] [Scilit]
- Druker, B.J. Translation of the Philadelphia chromosome into therapy for CML. Blood 2008, 112, 4808–4817. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rossari, F.; Minutolo, F.; Orciuolo, E. Past, present, and future of Bcr-Abl inhibitors: From chemical development to clinical efficacy. J. Hematol. Oncol. 2018, 11, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Cragg, G.M.; Pezzuto, J.M. Natural Products as a Vital Source for the Discovery of Cancer Chemotherapeutic and Chemopreventive Agents. Med. Princ. Pract. 2016, 25, 41–59. [Google Scholar] [CrossRef] [Scilit]
- Mitchell, S.A.; Ferdinand, R.; Tumur, I.; Batson, S. Treatments for chronic myeloid leukemia: A qualitative systematic review. J. Blood Med. 2012, 3, 51–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takashima, J.; Ohsaki, A. Brosimacutins A−I, Nine New Flavonoids from Brosimum acutifolium. J. Nat. Prod. 2002, 65, 1843–1847. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takashima, J.; Komiyama, K.; Ishiyama, H.; Kobayashi, J.; Ohsaki, A.; Brosimacutins, J.-M. Four New Flavonoids from Brosimum acutifolium and their Cytotoxic Activity. Planta Med. 2005, 71, 654–658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kommera, H.; Kaluđerović, G.N.; Kalbitz, J.; Paschke, R. Synthesis and Anticancer Activity of Novel Betulinic acid and Betulin Derivatives. Arch. der Pharm. (Weinheim.) 2010, 343, 449–457. [Google Scholar] [CrossRef] [Scilit]
- Bai, K.-K.; Yu, Z.; Chen, F.-L.; Li, F.; Li, W.-Y.; Guo, Y.-H. Synthesis and evaluation of ursolic acid derivatives as potent cytotoxic agents. Bioorganic Med. Chem. Lett. 2012, 22, 2488–2493. [Google Scholar] [CrossRef] [Scilit]
- Waechter, F.; Silva, G.S.; Willig, J.; De Oliveira, C.B.; Trivella, D.B.; Zimmer, A.R.; Buffon, A.; Gnoatto, S.; Vieira, B.D.; Pilger, D.A. Design, Synthesis and Biological Evaluation of Betulinic Acid Derivatives as New Antitumor Agents for Leukemia. Anti-Cancer Agents Med. Chem. 2017, 17, 1777–1785. [Google Scholar] [CrossRef] [Scilit]
- Fulda, S. Betulinic acid: A natural product with anticancer activity. Mol. Nutr. Food Res. 2009, 53, 140–146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Couto, N.M.G.; Willig, J.B.; Ruaro, T.C.; De Oliveira, D.L.; Buffon, A.; Pilger, D.A.; Arruda, M.S.; Miron, D.; Zimmer, A.R.; Gnoatto, S.C. Betulinic Acid and Brosimine B Hybrid Derivatives as Potential Agents against Female Cancers. Anti-Cancer Agents Med. Chem. 2020, 20, 622–633. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galluzzi, L.; Vitale, I.; Aaronson, S.A.; Abrams, J.M.; Adam, D.; Agostinis, P.; Alnemri, E.S.; Altucci, L.; Amelio, I.; Andrews, D.W.; et al. Molecular mechanisms of cell death: Recommendations of the Nomenclature Committee on Cell Death 2018. Cell Death Differ. 2018, 25, 486–541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chou, T.-C. Theoretical Basis, Experimental Design, and Computerized Simulation of Synergism and Antagonism in Drug Combination Studies. Pharmacol. Rev. 2006, 58, 621–681. [Google Scholar] [CrossRef] [Scilit]
- Hassan, A.H.; Choi, E.; Yoon, Y.M.; Lee, K.W.; Yoo, S.Y.; Cho, M.C.; Yang, J.S.; Kim, H.I.; Hong, J.Y.; Shin, J.-S.; et al. Natural products hybrids: 3,5,4′-Trimethoxystilbene-5,6,7-trimethoxyflavone chimeric analogs as potential cytotoxic agents against diverse human cancer cells. Eur. J. Med. Chem. 2019, 161, 559–580. [Google Scholar] [CrossRef] [Scilit]
- Ackermann, A.; Karagöz, A.; Ghoochani, A.; Buchfelder, M.; Eyüpoglu, I.; Tsogoeva, S.B.; Savaskan, N. Cytotoxic profiling of artesunic and betulinic acids and their synthetic hybrid compound on neurons and gliomas. Oncotarget 2017, 8, 61457–61474. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; Zhang, Z.; Lu, X.; Feng, Y.; Luo, K.; Gan, J.; Yingxue, L.; Wan, J.; Li, X.; Zhang, F.; et al. Hybrid compounds as new Bcr/Abl inhibitors. Bioorg. Med. Chem. Lett. 2011, 21, 1965–1968. [Google Scholar] [CrossRef] [Scilit]
- Willig, J.B.; Vianna, D.R.B.; Beckenkamp, A.; Beckenkamp, L.R.; Sévigny, J.; Wink, M.R.; Buffon, A.; Pilger, D.A. Imatinib mesylate affects extracellular ATP catabolism and expression of NTPDases in a chronic myeloid leukemia cell line. Purinergic Signal. 2020, 16, 29–40. [Google Scholar] [CrossRef] [Scilit]
- Filippi-Chiela, E.C.; Villodre, E.S.; Zamin, L.L.; Lenz, G. Autophagy Interplay with Apoptosis and Cell Cycle Regulation in the Growth Inhibiting Effect of Resveratrol in Glioma Cells. PLoS ONE 2011, 6, e20849. [Google Scholar] [CrossRef] [Scilit]
- Hehlmann, R.; Cortes, J.E.; Zyczynski, T.; Gambacorti-Passerini, C.; Goldberg, S.L.; Mauro, M.J.; Michallet, M.; Simonsson, B.; Williams, L.A.; Gajavelli, S.; et al. Tyrosine kinase inhibitor interruptions, discontinuations and switching in patients with chronic-phase chronic myeloid leukemia in routine clinical practice: SIMPLICITY. Am. J. Hematol. 2018, 94, 46–54. [Google Scholar] [CrossRef] [Scilit]
- Stromskaya, T.P.; Rybalkina, E.Y.; Kruglov, S.S.; Zabotina, T.N.; Mechetner, E.B.; Turkina, A.G.; Stavrovskaya, A.A. Role of P-glycoprotein in evolution of populations of chronic myeloid leukemia cells treated with imatinib. Biochemistry 2008, 73, 29–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koschmieder, S.; Vetrie, D. Epigenetic dysregulation in chronic myeloid leukaemia: A myriad of mechanisms and therapeutic options. Semin. Cancer Biol. 2018, 51, 180–197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chou, T.-C.; Martin, N. CompuSyn for Drug Combinations and for General Dose-Effect Analysis User’s Guide; ComboSyn Inc.: Paramus, NJ, USA, 2005; pp. 1–68. [Google Scholar]
- Kalındemirtaş, F.D.; Birman, H.; Candöken, E.; Gazioğlu, S.B.; Melikoğlu, G.; Kuruca, S. Cytotoxic Effects of Some Flavonoids and Imatinib on K562 Chronic Myeloid Leukemia Cell Line: Data Analysis Using the Combination Index Method. Balk. Med. J. 2018, 36, 96–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fulda, S.; Debatin, K.-M. Sensitization for Anticancer Drug-Induced Apoptosis by Betulinic Acid. Neoplasia 2005, 7, 162–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, Y.; Jia, Z.; Kong, X.; Li, Q.; Chang, D.Z.; Wei, D.; Le, X.; Suyun, H.; Huang, S.; Wang, L.; et al. Combining betulinic acid and mithramycin A effectively suppresses pancreatic cancer by inhibiting proliferation, invasion and angiogenesis. Cancer Res. 2011, 71, 5182–5193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brentnall, M.; Rodriguez-Menocal, L.; De Guevara, R.L.; Cepero, E.; Boise, L.H. Caspase-9, caspase-3 and caspase-7 have distinct roles during intrinsic apoptosis. BMC Cell Biol. 2013, 14, 32. [Google Scholar] [CrossRef] [Scilit]
- Xu, T.; Pang, Q.; Wang, Y.; Yan, X. Betulinic acid induces apoptosis by regulating PI3K/Akt signaling and mitochondrial pathways in human cervical cancer cells. Int. J. Mol. Med. 2017, 40, 1669–1678. [Google Scholar] [CrossRef] [Scilit]
- Eichenmüller, M.; Von Schweinitz, D.; Kappler, R. Betulinic acid treatment promotes apoptosis in hepatoblastoma cells. Int. J. Oncol. 2009, 35, 873–879. [Google Scholar]
- Gopal, D.R.; Narkar, A.A.; Badrinath, Y.; Mishra, K.; Joshi, D. Betulinic acid induces apoptosis in human chronic myelogenous leukemia (CML) cell line K-562 without altering the levels of Bcr-Abl. Toxicol. Lett. 2005, 155, 343–351. [Google Scholar] [CrossRef] [Scilit]
- da Silva, G.N.; Maria, N.R.; Schuck, D.C.; Cruz, L.N.; de Moraes, M.S.; Nakabashi, M.; Graebin, C.; Gosmann, G.; Garcia, C.R.; Gnoatto, S.C. Two series of new semisynthetic triterpene derivatives: Differences in anti-malarial activity, cytotoxicity and mechanism of action. Malar. J. 2013, 12, 89. [Google Scholar] [CrossRef] [Scilit]
- Vianna, D.R.B.; Gotardi, J.; Gnoatto, S.C.B.; Pilger, D.A. Natural and Semisynthetic Pentacyclic Triterpenes for Chronic Myeloid Leukemia Therapy: Reality, Challenges and Perspectives. Chemmedchem 2021, 16, 1835–1860. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saraei, R.; Marofi, F.; Naimi, A.; Talebi, M.; Ghaebi, M.; Javan, N.; Salimi, O.; Hassanzadeh, A. Leukemia therapy by flavonoids: Future and involved mechanisms. J. Cell. Physiol. 2018, 234, 8203–8220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Lu, X.; Zhu, R.; Zhang, K.; Li, S.; Chen, Z.; Li, L. Betulinic Acid Induces Apoptosis in Differentiated PC12 Cells Via ROS-Mediated Mitochondrial Pathway. Neurochem. Res. 2017, 42, 1130–1140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Li, L.; Li, M.; Huang, X.; Xie, W.; Xiang, W.; Yao, P. Combination of betulinic acid and chidamide inhibits acute myeloid leukemia by suppression of the HIF1α pathway and generation of reactive oxygen species. Oncotarget 2017, 8, 94743–94758. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; He, N.; Zhou, X.; Wang, F.; Cai, H.; Huang, S.H.; Chen, X.; Hu, Z.; Jin, X. Betulinic acid induces autophagy-dependent apoptosis via Bmi-1/ROS/AMPK-mTOR-ULK1 axis in human bladder cancer cells. Aging 2021, 13, 21251–21267. [Google Scholar] [CrossRef] [Scilit]
- Dash, S.K.; Chattopadhyay, S.; Dash, S.S.; Tripathy, S.; Das, B.; Mahapatra, S.K.; Bag, B.G.; Karmakar, P.; Roy, S. Self assembled nano fibers of betulinic acid: A selective inducer for ROS/TNF-alpha pathway mediated leukemic cell death. Bioorg. Chem. 2015, 63, 85–100. [Google Scholar] [CrossRef] [Scilit]
- Denton, D.; Kumar, S. Autophagy-dependent cell death. Cell Death Differ. 2018, 26, 605–616. [Google Scholar] [CrossRef] [Scilit]
- Bellodi, C.; Lidonnici, M.; Hamilton, A.; Helgason, V.; Soliera, A.R.; Ronchetti, M.; Galavotti, S.; Young, K.W.; Selmi, T.; Yacobi, R.; et al. Targeting autophagy. J. Clin. Investig. 2009, 119, 1109–1123. [Google Scholar] [CrossRef] [Scilit]
- Yan, J.W.; Zang, Q.H.; Liu, T. Autophagy facilitates anticancer effect of 5-fluorouracil in HCT-116 cells. J. Cancer Res. Theraoeutics 2018, 14 (Suppl. 5), S1141–S1147. [Google Scholar]
- Ebrahimi, S.; Hosseini, M.; Shanhidsales, S.; Maftouh, M.; Ferns, G.A.; Ghayour-Mobarhan, M.; Mahdi Hassanian, S.; Avan, A. Targeting the Akt/PI3K Signaling Pathway as a Potential Therapeutic Strategy for the Treatment of Pancreatic Cancer. Curr. Med. Chem. 2017, 24, 1321–1331. [Google Scholar] [CrossRef] [Scilit]
- Wang, E.-X.; Zou, B.-Y.; Shi, L.; Du, L.-Y.; Zhu, Y.-Y.; Jiang, Y.-M.; Ma, X.-D.; Kang, X.-H.; Wang, C.-Y.; Zhen, Y.-H.; et al. 7-O-geranylquercetin-induced autophagy contributes to apoptosis via ROS generation in human non-small cell lung cancer cells. Life Sci. 2017, 180, 102–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maiuri, M.C.; Zalckvar, E.; Kimchi, A.; Kroemer, G. Self-eating and self-killing: Crosstalk between autophagy and apoptosis. Nat. Rev. Mol. Cell Biol. 2007, 8, 741–752. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghiulai, R.; Mioc, A.; Racoviceanu, R.; Mioc, M.; Milan, A.; Prodea, A.; Semenescu, A.; Dehelean, C.; Tudoran, L.B.; Avram, Ș.; et al. The Anti-Melanoma Effect of Betulinic Acid Functionalized Gold Nanoparticles: A Mechanistic In Vitro Approach. Pharmaceuticals 2022, 15, 1362. [Google Scholar] [CrossRef] [Scilit] [PubMed]










| Drugs Combinations | Combination Index (CI) | |
|---|---|---|
| Hybrid compound (µM) | Imatinib (µM) | |
| 5 | 0.20 | 0.59 |
| 10 | 0.40 | 0.37 |
| 20 | 0.80 | 0.27 |
| 40 | 1.60 | 0.44 |
| 80 | 3.20 | 0.38 |
| Gene Product | Primer Sequences | Annealing Temperature | Product Size (bp) |
|---|---|---|---|
| Caspase-3 | F-5′-ACATGGCGTGTCATAAAA-3′ R-5′-CACAAAGCGACTGGAC-3′ | 60 °C | 120 |
| Caspase-8 | F-5′-CTGCTGGGGATGGCCACTGTG-3′ R-5′-TCGCCTCGAGGACATCGCTC-3′ | 60 °C | 113 |
| Caspase-9 | F-5′-GAGTCAGGCTCTTCCTTTG-3′ R-5′-CCTCAA ACTCTCAAGAGCAC-3′ | 60 °C | 241 |
| LC3-II |
F-5′-GAGAAGCAGCTTCCTGTTCTGG-3′ R-5′-GTGTCCGTTCACCAACAGGAAG-3′ | 60 °C | 138 |
| Beclin-1 |
F-5′-GGCTGAGAGACTGGATCAGG-3′ R-5′-CTGCGTCTGGGCATAACG-3′ | 60 °C | 127 |
| GAPDH | F: CAAAGTTGTCATGGATGACC R: CCATGGAGAAGGCTGGGG | 60 °C | 195 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Willig, J.B.; de Couto, N.M.G.; Vianna, D.R.B.; Mariot, C.d.S.; Gnoatto, S.C.B.; Buffon, A.; Pilger, D.A. Betulinic Acid-Brosimine B Hybrid Compound Has a Synergistic Effect with Imatinib in Chronic Myeloid Leukemia Cell Line, Modulating Apoptosis and Autophagy. Pharmaceuticals 2023, 16, 586. https://doi.org/10.3390/ph16040586
Willig JB, de Couto NMG, Vianna DRB, Mariot CdS, Gnoatto SCB, Buffon A, Pilger DA. Betulinic Acid-Brosimine B Hybrid Compound Has a Synergistic Effect with Imatinib in Chronic Myeloid Leukemia Cell Line, Modulating Apoptosis and Autophagy. Pharmaceuticals. 2023; 16(4):586. https://doi.org/10.3390/ph16040586
Chicago/Turabian StyleWillig, Julia Biz, Nádia Miléo Garcês de Couto, Débora Renz Barreto Vianna, Camila da Silveira Mariot, Simone Cristina Baggio Gnoatto, Andréia Buffon, and Diogo André Pilger. 2023. "Betulinic Acid-Brosimine B Hybrid Compound Has a Synergistic Effect with Imatinib in Chronic Myeloid Leukemia Cell Line, Modulating Apoptosis and Autophagy" Pharmaceuticals 16, no. 4: 586. https://doi.org/10.3390/ph16040586
APA StyleWillig, J. B., de Couto, N. M. G., Vianna, D. R. B., Mariot, C. d. S., Gnoatto, S. C. B., Buffon, A., & Pilger, D. A. (2023). Betulinic Acid-Brosimine B Hybrid Compound Has a Synergistic Effect with Imatinib in Chronic Myeloid Leukemia Cell Line, Modulating Apoptosis and Autophagy. Pharmaceuticals, 16(4), 586. https://doi.org/10.3390/ph16040586

