Role of Herbal Extracts of Catechu from Uncaria gambir in the Treatment of Chronic Diabetic Wounds
Abstract
1. Introduction
2. Results and Discussions
2.1. Determination of Catechin and Epicatechin Content in Catechu Samples from Uncaria gambir
2.2. Catechu Extract-Induced Pro-Angiogenic Effects in Zebrafish Embryos
| Catechu Conc. (μg/mL) | 1250 | 1000 | 800 | 600 | 500 | 400 | 300 | 150 | Control |
|---|---|---|---|---|---|---|---|---|---|
| Embryo survival rate | 0% | 0% | 0% | 0% | 40% | 60% | 100% | 100% | 100% |

| Blood Vessel Number | Control | Catechu Extract-Treated |
|---|---|---|
| 0 | 13 (65%) | 8 (34.8%) |
| 1 | 7 (35%) | 10(43.5%) |
| 2 | 0 (0.0%) | 5 (21.7%) |
| 3 | 0 (0.0%) | 0 (0.0%) |
| Blood Vessel Length (px) | Control | Catechu Extract-Treated |
| 0 | 13 (65%) | 8 (34.8%) |
| 1–200 | 5 (25%) | 7 (30.4%) |
| 201–500 | 2 (10%) | 8 (34.8%) |
| >500 | 0 (0.0%) | 1 (6.7%) |
2.3. In Vitro Tube Formation Angiogenic Assay
2.4. Reverse Transcription and Quantitative Polymerase Chain Reaction
2.5. Cell Proliferation Assay
2.6. In Vitro Wound Healing Assay
3. Materials and Methods
3.1. Materials
3.2. HPLC Analysis of Catechu from Uncaria Gambir
3.3. Preparation of Crude Catechu Extracts
3.4. In Vivo Zebrafish Embryo Angiogenesis Assay
3.5. Cell Culture
3.6. In Vitro Tube Formation Angiogenesis Assay
3.7. Reverse Transcription and Quantitative Polymerase Chain Reaction
3.8. Cell Proliferation Assay
3.9. In Vitro Wound Healing Assay
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ho, T.J.; Jiang, S.J.; Lin, G.H.; Li, T.S.; Yiin, L.M.; Yang, J.S.; Hsieh, M.C.; Wu, C.C.; Lin, J.G.; Chen, H.P. The In Vitro and In Vivo Wound Healing Properties of the Chinese Herbal Medicine “Jinchuang Ointment”. Evid. Based Complement. Alternat. Med. 2016, 2016, 1654056. [Google Scholar] [CrossRef] [PubMed]
- Ho, T.J.; Chen, J.K.; Li, T.S.; Lin, J.H.; Hsu, Y.H.; Wu, J.R.; Tsai, W.T.; Chen, H.P. The curative effects of the traditional Chinese herbal medicine “Jinchuang ointment” on excisional wounds. Chin. Med. 2020, 15, 41. [Google Scholar] [CrossRef]
- Hsu, W.H.; Tsai, W.T.; Hung, S.J.; Cheng, H.C.; Hsu, C.H.; Ho, T.J.; Chen, H.P. Treatment of leprosy wounds with “jinchuang ointment”, a traditional Chinese herbal medicine complex. Lepr. Rev. 2019, 90, 460–468. [Google Scholar] [CrossRef]
- Wu, C.; Cai, X.Q.; Chang, Y.; Chen, C.H.; Ho, T.J.; Lai, S.C.; Chen, H.P. Rapid identification of dragon blood samples from Daemonorops draco, Dracaena cinnabari and Dracaena cochinchinensis by MALDI-TOF mass spectrometry. Phytochem. Anal. 2019, 30, 720–726. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Jiang, T.; Liu, W.; Hu, Q.; Yin, H. The angiogenic effect of dracorhodin perchlorate on human umbilical vein endothelial cells and its potential mechanism of action. Mol. Med. Rep. 2016, 14, 1667–1672. [Google Scholar] [CrossRef] [PubMed]
- Krishnaraj, P.; Chang, Y.; Ho, T.J.; Lu, N.C.; Lin, M.D.; Chen, H.P. In vivo pro-angiogenic effects of dracorhodin perchlorate in zebrafish embryos: A novel bioactivity evaluation platform for commercial dragon blood samples. J. Food Drug Anal. 2019, 27, 259–265. [Google Scholar] [CrossRef]
- Committee on Chinese Medicine and Pharmacy. Taiwan Herbl Pharmacopeia English Version, 2nd ed.; Ministry of Health and Welfare, Executive Yuan, Taiwan, Republic of China: Taipei, Taiwan, 2016; p. 108. [Google Scholar]
- State Pharmacopoeia Commission of the PRC. Pharmacopoeia of the People’s Republic of China, 1st ed.; People’s Medical Publishing House: Beijing, China, 2015; Volume 1, pp. 142–143. [Google Scholar]
- Wu, L.-C. Studies on the Chemical Specification of Forty Chinese Crude Drugs and Quantitative Analysis of Major Ingredients of Ercha and Qingdai. Master’s Thesis, China Medical University, Taichuang, Taiwan, 2006. [Google Scholar]
- State Pharmacopoeia Commission of the PRC. Pharmacopoeia of the People’s Republic of China, 1st ed.; People’s Medical Publishing House: Beijing, China, 2015; Volume 1, p. 10. [Google Scholar]
- Sazwi, N.N.; Nalina, T.; Abdul Rahim, Z.H. Antioxidant and cytoprotective activities of Piper betle, Areca catechu, Uncaria gambir and betel quid with and without calcium hydroxide. BMC Complement. Altern. Med. 2013, 13, 351. [Google Scholar] [CrossRef]
- Oswari, L.; Hidayat, R.; Fatmawati, F.; Hayati, L.; Alisa, B.S. Gambir Extract (Uncaria Gambir) Decreases Inflammatory Response and Increases Gastric Mucosal Integrity in Wistar Rats—Model Gastritis. Open Access Maced. J. Med. Sci. 2019, 7, 3149–3152. [Google Scholar] [CrossRef]
- Abral, H.; Kurniawan, A.; Rahmadiawan, D.; Handayani, D.; Sugiarti, E.; Muslimin, A.N. Highly antimicrobial and strong cellulose-based biocomposite film prepared with bacterial cellulose powders, Uncaria gambir, and ultrasonication treatment. Int. J. Biol. Macromol. 2022, 208, 88–96. [Google Scholar] [CrossRef]
- Teixeira, A.M.; Sousa, C. A Review on the Biological Activity of Camellia Species. Molecules 2021, 26, 2178. [Google Scholar] [CrossRef]
- Mendonça, R.J.; Coutinho-Netto, J. Cellular aspects of wound healing. An. Bras. Dermatol. 2009, 84, 257–262. [Google Scholar] [CrossRef] [PubMed]
- Koch, A.E.; Polverini, P.J.; Kunkel, S.L.; Harlow, L.A.; DiPietro, L.A.; Elner, V.M.; Elner, S.G.; Strieter, R.M. Interleukin-8 as a macrophage-derived mediator of angiogenesis. Science 1992, 258, 1798–1801. [Google Scholar] [CrossRef]
- Schönbeck, U.; Brandt, E.; Petersen, F.; Flad, H.D.; Loppnow, H. IL-8 specifically binds to endothelial but not to smooth muscle cells. J. Immunol. 1995, 154, 2375–2383. [Google Scholar] [CrossRef] [PubMed]
- Strieter, R.M.; Polverini, P.J.; Kunkel, S.L.; Arenberg, D.A.; Burdick, M.D.; Kasper, J.; Dzuiba, J.; Van Damme, J.; Walz, A.; Marriott, D.; et al. The functional role of the ELR motif in CXC chemokine-mediated angiogenesis. J. Biol. Chem. 1995, 270, 27348–27357. [Google Scholar] [CrossRef] [PubMed]
- Matsushima, K.; Yang, D.; Oppenheim, J.J. Interleukin-8: An evolving chemokine. Cytokine 2022, 153, 155828. [Google Scholar] [CrossRef]
- Farjood, F.; Ahmadpour, A.; Ostvar, S.; Vargis, E. Acute mechanical stress in primary porcine RPE cells induces angiogenic factor expression and in vitro angiogenesis. J. Biol. Eng. 2020, 14, 13. [Google Scholar] [CrossRef] [PubMed]
- Cane, G.; Ginouvès, A.; Marchetti, S.; Buscà, R.; Pouysségur, J.; Berra, E.; Hofman, P.; Vouret-Craviari, V. HIF-1alpha mediates the induction of IL-8 and VEGF expression on infection with Afa/Dr diffusely adhering E. coli and promotes EMT-like behaviour. Cell. Microbiol. 2010, 12, 640–653. [Google Scholar] [CrossRef] [PubMed]
- Beck, L., Jr.; D’Amore, P.A. Vascular development: Cellular and molecular regulation. FASEB J. 1997, 11, 365–373. [Google Scholar] [CrossRef]
- Klein, S.; Bikfalvi, A.; Birkenmeier, T.M.; Giancotti, F.G.; Rifkin, D.B. Integrin regulation by endogenous expression of 18-kDa fibroblast growth factor-2. J. Biol. Chem. 1996, 271, 22583–22590. [Google Scholar] [CrossRef]
- Klein, S.; Giancotti, F.G.; Presta, M.; Albelda, S.M.; Buck, C.A.; Rifkin, D.B. Basic fibroblast growth factor modulates integrin expression in microvascular endothelial cells. Mol. Biol. Cell 1993, 4, 973–982. [Google Scholar] [CrossRef]
- Seghezzi, G.; Patel, S.; Ren, C.J.; Gualandris, A.; Pintucci, G.; Robbins, E.S.; Shapiro, R.L.; Galloway, A.C.; Rifkin, D.B.; Mignatti, P. Fibroblast growth factor-2 (FGF-2) induces vascular endothelial growth factor (VEGF) expression in the endothelial cells of forming capillaries: An autocrine mechanism contributing to angiogenesis. J. Cell Biol. 1998, 141, 1659–1673. [Google Scholar] [CrossRef] [PubMed]
- Hart, K.C.; Robertson, S.C.; Kanemitsu, M.Y.; Meyer, A.N.; Tynan, J.A.; Donoghue, D.J. Transformation and Stat activation by derivatives of FGFR1, FGFR3, and FGFR4. Oncogene 2000, 19, 3309–3320. [Google Scholar] [CrossRef] [PubMed]
- Evans, R.M. Vimentin: The conundrum of the intermediate filament gene family. Bioessays 1998, 20, 79–86. [Google Scholar] [CrossRef]
- Osborn, M.; Geisler, N.; Shaw, G.; Sharp, G.; Weber, K. Intermediate filaments. Cold Spring Harb. Symp. Quant. Biol. 1982, 46 Pt 1, 413–429. [Google Scholar] [CrossRef] [PubMed]
- Ivaska, J.; Pallari, H.M.; Nevo, J.; Eriksson, J.E. Novel functions of vimentin in cell adhesion, migration, and signaling. Exp. Cell Res. 2007, 313, 2050–2062. [Google Scholar] [CrossRef] [PubMed]
- Eckes, B.; Colucci-Guyon, E.; Smola, H.; Nodder, S.; Babinet, C.; Krieg, T.; Martin, P. Impaired wound healing in embryonic and adult mice lacking vimentin. J. Cell Sci. 2000, 113 Pt 13, 2455–2462. [Google Scholar] [CrossRef]
- Eckes, B.; Dogic, D.; Colucci-Guyon, E.; Wang, N.; Maniotis, A.; Ingber, D.; Merckling, A.; Langa, F.; Aumailley, M.; Delouvée, A.; et al. Impaired mechanical stability, migration and contractile capacity in vimentin-deficient fibroblasts. J. Cell Sci. 1998, 111 Pt 13, 1897–1907. [Google Scholar] [CrossRef] [PubMed]
- Lundkvist, A.; Reichenbach, A.; Betsholtz, C.; Carmeliet, P.; Wolburg, H.; Pekny, M. Under stress, the absence of intermediate filaments from Müller cells in the retina has structural and functional consequences. J. Cell Sci. 2004, 117, 3481–3488. [Google Scholar] [CrossRef]
- Kamal, S.; Susanti, M.; Febriyenti; Zaini, E.; Hamidi, D. Simultaneous TLC-densitometric analysis of catechin, pyrocatechol and quercetine in gambir block from Pesisir Selatan. Heliyon 2022, 8, e08985. [Google Scholar] [CrossRef]
- Lawson, N.D.; Weinstein, B.M. In vivo imaging of embryonic vascular development using transgenic zebrafish. Dev. Biol. 2002, 248, 307–318. [Google Scholar] [CrossRef]
- Chiang, J.H.; Yang, J.S.; Lu, C.C.; Hour, M.J.; Chang, S.J.; Lee, T.H.; Chung, J.G. Newly synthesized quinazolinone HMJ-38 suppresses angiogenetic responses and triggers human umbilical vein endothelial cell apoptosis through p53-modulated Fas/death receptor signaling. Toxicol. Appl. Pharmacol. 2013, 269, 150–162. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.-R.; Lu, Y.-C.; Hung, S.-J.; Lin, J.-H.; Chang, K.-C.; Chen, J.-K.; Tsai, W.-T.; Ho, T.-J.; Chen, H.-P. Antimicrobial and Immunomodulatory Activity of Herb Extracts Used in Burn Wound Healing: “San Huang Powder”. Evid.-Based Complement. Altern. Med. 2021, 2021, 2900060. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Song, D. LncRNA MEG3 Participates in Caerulein-Induced Inflammatory Injury in Human Pancreatic Cells via Regulating miR-195-5p/FGFR2 Axis and Inactivating NF-κB Pathway. Inflammation 2021, 44, 160–173. [Google Scholar] [CrossRef] [PubMed]
- Blick, C.; Ramachandran, A.; Wigfield, S.; McCormick, R.; Jubb, A.; Buffa, F.M.; Turley, H.; Knowles, M.A.; Cranston, D.; Catto, J.; et al. Hypoxia regulates FGFR3 expression via HIF-1α and miR-100 and contributes to cell survival in non-muscle invasive bladder cancer. Br. J. Cancer 2013, 109, 50–59. [Google Scholar] [CrossRef]
- Pina-Canseco Mdel, S.; Páez-Arenas, A.; Massó, F.; Pérez-Campos, E.; Martínez-Cruz, R.; Hernández-Cruz, P.; Majluf-Cruz, A.; Martínez-Cruz, M.; Pérez-Campos Mayoral, L.; Pérez-Santiago, A.D.; et al. Protein C activation peptide inhibits the expression of ICAM-1, VCAM-1, and interleukin-8 induced by TNF-α in human dermal microvascular endothelial cells. Folia Histochem. Cytobiol. 2012, 50, 407–413. [Google Scholar] [CrossRef]
- Yuan, W.; Sun, Q.; Jiang, Y.; Zhang, X.; Chen, L.; Xie, C.; Qin, F.; Chen, Y.; Lv, H.; Chen, W.; et al. MiR-146a affects the alteration in myeloid differentiation induced by hydroquinone in human CD34(+) hematopoietic progenitor cells and HL-60 cells. Toxicol. Res. (Camb.) 2016, 5, 848–858. [Google Scholar] [CrossRef]
- Goel, S.; Sahu, S.; Minz, R.W.; Singh, S.; Suri, D.; Oh, Y.M.; Rawat, A.; Sehgal, S.; Saikia, B. STAT3-Mediated Transcriptional Regulation of Osteopontin in STAT3 Loss-of-Function Related Hyper IgE Syndrome. Front. Immunol. 2018, 9, 1080. [Google Scholar] [CrossRef]
- Li, J.; Dong, L.; Wei, D.; Wang, X.; Zhang, S.; Li, H. Fatty acid synthase mediates the epithelial-mesenchymal transition of breast cancer cells. Int. J. Biol. Sci. 2014, 10, 171–180. [Google Scholar] [CrossRef]
- Chen, F.; Zhang, G.; Yu, L.; Feng, Y.; Li, X.; Zhang, Z.; Wang, Y.; Sun, D.; Pradhan, S. High-efficiency generation of induced pluripotent mesenchymal stem cells from human dermal fibroblasts using recombinant proteins. Stem Cell Res. Ther. 2016, 7, 99. [Google Scholar] [CrossRef][Green Version]
- Lu, C.C.; Yang, J.S.; Chiu, Y.J.; Tsai, F.J.; Hsu, Y.M.; Yin, M.C.; Juan, Y.N.; Ho, T.J.; Chen, H.P. Dracorhodin perchlorate enhances wound healing via β-catenin, ERK/p38, and AKT signaling in human HaCaT keratinocytes. Exp. Ther. Med. 2021, 22, 822. [Google Scholar] [CrossRef]
- Gebrehiwot, M.; Asres, K.; Bisrat, D.; Mazumder, A.; Lindemann, P.; Bucar, F. Evaluation of the wound healing property of Commiphora guidottii Chiov. ex. Guid. BMC Complement. Altern. Med. 2015, 15, 282. [Google Scholar] [CrossRef] [PubMed]
- Negahdari, S.; Galehdari, H.; Kesmati, M.; Rezaie, A.; Shariati, G. Wound Healing Activity of Extracts and Formulations of Aloe vera, Henna, Adiantum capillus-veneris, and Myrrh on Mouse Dermal Fibroblast Cells. Int. J. Prev. Med. 2017, 8, 18. [Google Scholar] [CrossRef] [PubMed]






| Time (min) | Eluent (B, C%) |
|---|---|
| 0 | 0%, 0% |
| 3.5 | 100%, 0% |
| 18 | 96%, 4% |
| 23 | 0%, 0% |
| Gene | Primer Sequence | Reference |
|---|---|---|
| FGFR2 | FORWARD: GAGAAGGAGATCACGGCTTC REVERSE: AAGTCTGGCTTCTTGGTCGT | [37] |
| FGFR3 | FORWARD: GCCTCCTCGGAGTCCTTG REVERSE: GCCTCCTCGGAGTCCTTG | [38] |
| IL8 | FORWARD: CTCTCTTGGCAGCCTTCCTGA REVERSE: CCCTCTGCACCCAGTTTTCCTT | [39] |
| NF-kB | FORWARD: CCTGGATGACTCTTGGGAAA REVERSE: TCAGCCAGCTGTTTCATGTC | [40] |
| STAT3 | FORWARD: CATATGCGGCCAGCAAAGAA REVERSE: ATACCTGCTCTGAAGAAACT | [41] |
| Vimentin | FORWARD: TCAATGTTAAGATGGCCCTTG REVERSE: TGAGTGGGTATCAACCAGAGG | [42] |
| β-actin | FORWARD: AGAGCTACGAGCTGCCTGAC REVERSE: AGCACTGTGTTGGCGTACAG | [43] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ho, T.-J.; Tsai, P.-H.; Hsieh, C.-H.; Lin, J.-H.; Lin, Y.-W.; Wu, J.-R.; Chen, H.-P. Role of Herbal Extracts of Catechu from Uncaria gambir in the Treatment of Chronic Diabetic Wounds. Pharmaceuticals 2023, 16, 66. https://doi.org/10.3390/ph16010066
Ho T-J, Tsai P-H, Hsieh C-H, Lin J-H, Lin Y-W, Wu J-R, Chen H-P. Role of Herbal Extracts of Catechu from Uncaria gambir in the Treatment of Chronic Diabetic Wounds. Pharmaceuticals. 2023; 16(1):66. https://doi.org/10.3390/ph16010066
Chicago/Turabian StyleHo, Tsung-Jung, Pei-Hsuan Tsai, Chia-Ho Hsieh, Jung-Hsing Lin, Yu-Wei Lin, Jia-Ru Wu, and Hao-Ping Chen. 2023. "Role of Herbal Extracts of Catechu from Uncaria gambir in the Treatment of Chronic Diabetic Wounds" Pharmaceuticals 16, no. 1: 66. https://doi.org/10.3390/ph16010066
APA StyleHo, T.-J., Tsai, P.-H., Hsieh, C.-H., Lin, J.-H., Lin, Y.-W., Wu, J.-R., & Chen, H.-P. (2023). Role of Herbal Extracts of Catechu from Uncaria gambir in the Treatment of Chronic Diabetic Wounds. Pharmaceuticals, 16(1), 66. https://doi.org/10.3390/ph16010066

