Established Immortalized Cavernous Endothelial Cells Improve Erectile Dysfunction in Rats with Cavernous Nerve Injury
Abstract
1. Introduction
2. Results
2.1. Immortalization of Penile Cavernous Endothelial Cells
2.2. RT-PCT of vRECs
2.3. In Vitro Angiogenesis Assay of Immortalization of Penile Cavernous Endothelial Cells
2.4. Change of Collagen Deposition after Transplantation
2.5. Erectile Response to Nerve Stimulation in Cavernous Nerve Injury Model of Rats
2.6. Immunohistochemical Study
3. Materials and Methods
3.1. Preparation of Rat Cavernous Endothelial Cells
3.2. Cell Culture
3.3. Immortalized Rat Cavernous Endothelial Cells
3.4. Confirmation of vREC
3.5. Reverse Transcriptase PCR (RT-PCR)
3.6. In Vitro Angiogenesis Assay
3.7. Flowcytometry Analysis
3.8. Transplantation of vREC in Rats with Cavernous Nerve Injury
3.9. Measurement of Erectile Function
3.10. Histology
3.11. Immunohistochemistry
3.12. Statistical Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Walsh, P.C.; Donker, P.J. Impotence Following Radical Prostatectomy: Insight into Etiology and Prevention. J. Urol. 2017, 197, S165–S170. [Google Scholar] [CrossRef] [Scilit]
- Fukuda, K.; Muto, S.; China, T.; Koyasu, H.; Noma, Y.; Ashizawa, T.; Hirano, H.; Kitamura, K.; Shimizu, F.; Nagata, M.; et al. Clinical use of expanded prostate cancer index composite-based health-related quality of life outcomes after robot-assisted radical prostatectomy for localized prostate cancer. Prostate Int. 2021, 10, 62–67. [Google Scholar]
- Hatzimouratidis, K.; Burnett, A.L.; Hatzichristou, D.; McCullough, A.R.; Montorsi, F.; Mulhall, J.P. Phosphodiesterase type 5 inhibitors in postprostatectomy erectile dysfunction: A critical analysis of the basic science rationale and clinical application. Eur. Urol. 2009, 55, 334–347. [Google Scholar] [CrossRef] [Scilit]
- Fall, P.A.; Izikki, M.; Tu, L.; Swieb, S.; Giuliano, F.; Bernabe, J.; Souktani, R.; Abbou, C.; Adnot, S.; Eddahibi, S.; et al. Apoptosis and effects of intracavernous bone marrow cell injection in a rat model of postprostatectomy erectile dysfunction. Eur. Urol. 2009, 56, 716–725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iacono, F.; Giannella, R.; Somma, P.; Manno, G.; Fusco, F.; Mirone, V. Histological alterations in cavernous tissue after radical prostatectomy. J. Urol. 2005, 173, 1673–1676. [Google Scholar] [CrossRef] [Scilit]
- Cho, T.; Bae, J.H.; Choi, H.B.; Kim, S.S.; McLarnon, J.G.; Suh-Kim, H.; Kim, S.U.; Min, C.K. Human neural stem cells: Electrophysiological properties of voltage-gated ion channels. Neuroreport 2002, 13, 1447–1452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flax, J.D.; Aurora, S.; Yang, C.; Simonin, C.; Wills, A.M.; Billinghurst, L.L.; Jendoubi, M.; Sidman, R.L.; Wolfe, J.H.; Kim, S.U.; et al. Engraftable human neural stem cells respond to developmental cues, replace neurons, and express foreign genes. Nat. Biotechnol. 1998, 16, 1033–1039. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.U. Human neural stem cells genetically modified for brain repair in neurological disorders. Neuropathology 2004, 24, 159–171. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.U.; Nakagawa, E.; Hatori, K.; Nagai, A.; Lee, M.A.; Bang, J.H. Production of immortalized human neural crest stem cells. Methods. Mol. Biol. 2002, 198, 55–65. [Google Scholar] [CrossRef] [Scilit]
- Stopeck, A.T.; Vahedian, M.; Williams, S.K. Transfer and expression of the interferon gamma gene in human endothelial cells inhibits vascular smooth muscle cell growth in vitro. Cell Transplant. 1997, 6, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Wessells, H.; Williams, S.K. Endothelial cell transplantation into the corpus cavernosum: Moving towards cell-based gene therapy. J. Urol. 1999, 162, 2162–2164. [Google Scholar] [CrossRef] [Scilit]
- Haudenschild, C.C.; Cotran, R.S.; Gimbrone, M.A., Jr.; Folkman, J. Fine structure of vascular endothelium in culture. J. Ultrastruct. Res. 1975, 50, 22–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, S.S.; Yoon, S.B.; Lee, S.R.; Kim, S.U.; Cha, Y.J.; Lee, D.; Kim, S.U.; Chang, K.T.; Lee, H.J. Establishment and Characterization of Immortalized Minipig Neural Stem Cell Line. Cell Transplant. 2017, 26, 271–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.H.; Yun, J.H.; Song, E.S.; Kim, S.U.; Lee, H.J.; Song, Y.S. Improvement of damaged cavernosa followed by neuron-like differentiation at injured cavernous nerve after transplantation of stem cells seeded on the PLA nanofiber in rats with cavernous nerve injury. Mol. Biol. Rep. 2021, 48, 3549–3559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, D.; Lee, H.J.; Joo, S.S.; Bae, D.K.; Yang, G.; Yang, Y.H.; Lim, I.; Matsuo, A.; Tooyama, I.; Kim, Y.B.; et al. Human neural stem cells over-expressing choline acetyltransferase restore cognition in rat model of cognitive dysfunction. Exp. Neurol. 2012, 234, 521–526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, K.S.; Lee, H.J.; Jeong, H.S.; Li, J.; Teng, Y.D.; Sidman, R.L.; Snyder, E.Y.; Kim, S.U. Self-renewal induced efficiently, safely, and effective therapeutically with one regulatable gene in a human somatic progenitor cell. Proc. Natl. Acad. Sci. USA 2011, 108, 4876–4881. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.J.; Lim, I.J.; Lee, M.C.; Kim, S.U. Human neural stem cells genetically modified to overexpress brain-derived neurotrophic factor promote functional recovery and neuroprotection in a mouse stroke model. J. Neurosci. Res. 2010, 88, 3282–3294. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.R.; Lee, H.J.; Cha, S.H.; Jeong, K.J.; Lee, Y.; Jeon, C.Y.; Yi, K.S.; Lim, I.; Cho, Z.H.; Chang, K.T.; et al. Long-term survival and differentiation of human neural stem cells in nonhuman primate brain with no immunosuppression. Cell Transplant. 2015, 24, 191–201. [Google Scholar] [CrossRef] [Scilit]
- Birdwell, C.R.; Gospodarowicz, D.; Nicolson, G.L. Identification, localization, and role of fibronectin in cultured bovine endothelial cells. Proc. Natl. Acad. Sci. USA 1978, 75, 3273–3277. [Google Scholar] [CrossRef] [Scilit]
- Nemecek, G.M. Properties of adenylate cyclase and cyclic nucleotide phosphodiesterase in hamster isolated capillary preparations. Biochim. Biophys. Acta (BBA)-Gen. Subj. 1980, 628, 125–135. [Google Scholar] [CrossRef] [Scilit]
- Davison, P.M.; Karasek, M.A. Human dermal microvascular endothelial cells in vitro: Effect of cyclic AMP on cellular morphology and proliferation rate. J. Cell. Physiol. 1981, 106, 253–258. [Google Scholar] [CrossRef] [Scilit]
- Cotta-Pereira, G.; Sage, H.; Bornstein, P.; Ross, R.; Schwartz, S. Studies of morphologically atypical (“sprouting”) cultures of bovine aortic endothelial cells. Growth characteristics and connective tissue protein synthesis. J. Cell. Physiol. 1980, 102, 183–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ager, A.; Gordon, J.L.; Moncada, S.; Pearson, J.D.; Salmon, J.A.; Trevethick, M.A. Effects of isolation and culture on prostaglandin synthesis by porcine aortic endothelial and smooth muscle cells. J. Cell. Physiol. 1982, 110, 9–16. [Google Scholar] [CrossRef] [Scilit]
- Ying, C.C.; Yang, M.; Wang, Y.; Guo, Y.L.; Hu, W.L.; Zheng, X.M. Neural-like cells from adipose-derived stem cells for cavernous nerve injury in rats. Neural Regen. Res. 2019, 14, 1085–1090. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohamed, S.Y.; Mohammed, H.L.; Ibrahim, H.M.; Mohamed, E.M.; Salah, M. Role of VEGF, CD105, and CD31 in the Prognosis of Colorectal Cancer Cases. J. Gastrointest. Cancer 2019, 50, 23–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minhajat, R.; Mori, D.; Yamasaki, F.; Sugita, Y.; Satoh, T.; Tokunaga, O. Endoglin (CD105) expression in angiogenesis of colon cancer: Analysis using tissue microarrays and comparison with other endothelial markers. Virchows Arch. 2006, 448, 127–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Behrem, S.; Zarkovic, K.; Eskinja, N.; Jonjic, N. Endoglin is a better marker than CD31 in evaluation of angiogenesis in glioblastoma. Croat. Med. J. 2005, 46, 417–422. [Google Scholar] [PubMed]
- Tomada, N.; Tomada, I.; Cruz, F.; Vendeira, P.; Neves, D. Characterization of VEGF and angiopoietins expression in human corpus cavernosum during aging. J. Sex. Med. 2010, 7, 1410–1418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajasekaran, M.; Kasyan, A.; Allilain, W.; Monga, M. Ex vivo expression of angiogenic growth factors and their receptors in human penile cavernosal cells. J. Androl. 2003, 24, 85–90. [Google Scholar]
- Tomada, N.; Tomada, I.; Vendeira, P.; Neves, D. Expression of vascular endothelial growth factor and angiopoietins in human corpus cavernosum. BJU Int. 2010, 105, 269–273. [Google Scholar] [CrossRef] [Scilit]
- Acosta, S.A.; Lee, J.Y.; Nguyen, H.; Kaneko, Y.; Borlongan, C.V. Endothelial Progenitor Cells Modulate Inflammation-Associated Stroke Vasculome. Stem Cell Rev. Rep. 2019, 15, 256–275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, A.D.; Cantz, T.; Manns, M.P.; Ott, M. The role of stem cells in physiology, pathophysiology, and therapy of the liver. Stem Cell Rev. 2006, 2, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Ishikawa, H.; Tajiri, N.; Shinozuka, K.; Vasconcellos, J.; Kaneko, Y.; Lee, H.J.; Mimura, O.; Dezawa, M.; Kim, S.U.; Borlongan, C.V. Vasculogenesis in experimental stroke after human cerebral endothelial cell transplantation. Stroke 2013, 44, 3473–3481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silva, G.V.; Litovsky, S.; Assad, J.A.; Sousa, A.L.; Martin, B.J.; Vela, D.; Coulter, S.C.; Lin, J.; Ober, J.; Vaughn, W.K.; et al. Mesenchymal stem cells differentiate into an endothelial phenotype, enhance vascular density, and improve heart function in a canine chronic ischemia model. Circulation 2005, 111, 150–156. [Google Scholar] [CrossRef] [Scilit]
- Kinnaird, T.; Stabile, E.; Burnett, M.S.; Shou, M.; Lee, C.W.; Barr, S.; Fuchs, S.; Epstein, S.E. Local delivery of marrow-derived stromal cells augments collateral perfusion through paracrine mechanisms. Circulation 2004, 109, 1543–1549. [Google Scholar] [CrossRef] [Scilit]
- Fang, B.; Shi, M.; Liao, L.; Yang, S.; Liu, Y.; Zhao, R.C. Systemic infusion of FLK1+ mesenchymal stem cells ameliorate carbon tetrachloride-induced liver fibrosis in mice. Transplantation 2004, 78, 83–88. [Google Scholar] [CrossRef] [Scilit]
- Ortiz, L.A.; Gambelli, F.; McBride, C.; Gaupp, D.; Baddoo, M.; Kaminski, N.; Phinney, D.G. Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc. Natl. Acad. Sci. USA 2003, 100, 8407–8411. [Google Scholar] [CrossRef] [Scilit]







| Gene | Forward Primer | Reverse Primer | Tm (°C) |
|---|---|---|---|
| v-myc | GGTGTCACGTCAACATCCAC | GTTCGCCTCTTGTCGTTCTC | 58 |
| CD31 | GGCCGAAGCTAGAACTCTCC | CACCTGGACGGGTACCAAAT | 58 |
| CD105 | GTGTCTACATGGTGCCCACA | CCGATGCTGTGGTTGGTACT | 58 |
| vWF | TCAGTGTGTTGGGGACGATG | GCAAGTTGCAGTTGACCAGG | 58 |
| Flt-1 | GAAAAGTCCGTGTCGTCCCT | GCTGAGTGATGCCCTCGATT | 58 |
| KDR | AAAGAGAGGGACTTTGGCCG | GTCGCCACTTGACAAAACCC | 58 |
| GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA | 58 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bak, S.H.; Kim, J.H.; Kim, S.U.; Lee, D.-S.; Song, Y.S.; Lee, H.J. Established Immortalized Cavernous Endothelial Cells Improve Erectile Dysfunction in Rats with Cavernous Nerve Injury. Pharmaceuticals 2023, 16, 123. https://doi.org/10.3390/ph16010123
Bak SH, Kim JH, Kim SU, Lee D-S, Song YS, Lee HJ. Established Immortalized Cavernous Endothelial Cells Improve Erectile Dysfunction in Rats with Cavernous Nerve Injury. Pharmaceuticals. 2023; 16(1):123. https://doi.org/10.3390/ph16010123
Chicago/Turabian StyleBak, Sang Hong, Jae Heon Kim, Seung U. Kim, Dong-Seok Lee, Yun Seob Song, and Hong J. Lee. 2023. "Established Immortalized Cavernous Endothelial Cells Improve Erectile Dysfunction in Rats with Cavernous Nerve Injury" Pharmaceuticals 16, no. 1: 123. https://doi.org/10.3390/ph16010123
APA StyleBak, S. H., Kim, J. H., Kim, S. U., Lee, D.-S., Song, Y. S., & Lee, H. J. (2023). Established Immortalized Cavernous Endothelial Cells Improve Erectile Dysfunction in Rats with Cavernous Nerve Injury. Pharmaceuticals, 16(1), 123. https://doi.org/10.3390/ph16010123

