Aptamer Applications in Neuroscience
Abstract
1. Introduction
2. Molecular Detection
2.1. Neurotoxin Detection
2.2. Neurotransmitter Detection
2.3. Biomarker Detection
3. Diagnostic and Therapeutic Applications
3.1. Alzheimer’s Disease
3.1.1. AD Diagnostics
3.1.2. AD Therapeutics
3.2. Parkinson’s Disease
3.2.1. PD Diagnostics
3.2.2. PD Therapeutics
3.3. Multiple Sclerosis
3.3.1. MS Diagnostics
3.3.2. MS Therapeutics
3.4. Amyotrophic Lateral Sclerosis
3.5. Huntington Disease
3.6. Prion Disease
3.7. Brain Tumors
3.7.1. Brain Imaging
3.7.2. Diagnosis
4. Conclusions and Future Perspective
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rangel, A.E.; Chen, Z.; Ayele, T.M.; Heemstra, J.M. In vitro selection of an XNA aptamer capable of small-molecule recognition. Nucleic Acids Res. 2018, 46, 8057–8068. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ilgu, M.; Nilsen-hamilton, M. Aptamers in Analytics. Analyst 2016, 141, 1551–1558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ellington, A.D.; Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818–822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robertson, D.L.; Joyce, G.F. Selection in vitro of an RNA enzyme that specifically cleaves single-stranded DNA. Nature 1990, 344, 467–468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tuerk, C.; Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990, 249, 505–510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blind, M.; Blank, M. Aptamer Selection Technology and Recent Advances. Mol. Ther. Nucleic Acids 2015, 4, e223. [Google Scholar] [CrossRef] [Scilit]
- Kang, K.-N.N.; Lee, Y.-S.S. RNA aptamers: A review of recent trends and applications. Future Trends Biotechnol. 2013, 131, 153–169. [Google Scholar] [CrossRef] [Scilit]
- Munzar, J.D.; Ng, A.; Juncker, D. Duplexed aptamers: History, design, theory, and application to biosensing. Chem. Soc. Rev. 2019, 48, 1390–1419. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Lai, B.S.; Juhas, M. Recent advances in aptamer discovery and applications. Molecules 2019, 24, 941. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Rossi, J. Aptamers as targeted therapeutics: Current potential and challenges. Nat. Rev. Drug Discov. 2017, 16, 181–202. [Google Scholar] [CrossRef] [Scilit]
- Boussebayle, A.; Groher, F.; Suess, B. RNA-based Capture-SELEX for the selection of small molecule-binding aptamers. Methods 2019, 161, 10–15. [Google Scholar] [CrossRef] [Scilit]
- Hamaguchi, N.; Ellington, A.; Stanton, M. Aptamer beacons for the direct detection of proteins. Anal. Biochem. 2001, 294, 126–131. [Google Scholar] [CrossRef] [Scilit]
- Oh, S.S.; Plakos, K.; Lou, X.; Xiao, Y.; Soh, H.T. In vitro selection of structure-switching, self-reporting aptamers. Proc. Natl. Acad. Sci. USA 2010, 107, 14053–14058. [Google Scholar] [CrossRef] [Scilit]
- Golden, M.C.; Collins, B.D.; Willis, M.C.; Koch, T.H. Diagnostic potential of PhotoSELEX-evolved ssDNA aptamers. J. Biotechnol. 2000, 81, 167–178. [Google Scholar] [CrossRef] [Scilit]
- Ohuchi, S. Cell-Selex technology. BioRes. Open Access 2012, 1, 265–272. [Google Scholar] [CrossRef] [Scilit]
- Sola, M.; Menon, A.P.; Moreno, B.; Meraviglia-Crivelli, D.; Soldevilla, M.M.; Cartón-García, F.; Pastor, F. Aptamers Against Live Targets: Is In Vivo SELEX Finally Coming to the Edge? Mol. Ther. Nucleic Acids 2020, 21, 192–204. [Google Scholar] [CrossRef] [Scilit]
- Wondergem, J.A.J.; Schiessel, H.; Tompitak, M. Performing SELEX experiments in silico. J. Chem. Phys. 2017, 147, 174101. [Google Scholar] [CrossRef] [Scilit]
- Mosing, R.K.; Bowser, M.T. Isolating aptamers using capillary electrophoresis-SELEX (CE-SELEX). Methods Mol. Biol. 2009, 535, 33–43. [Google Scholar] [CrossRef] [Scilit]
- Vater, A.; Jarosch, F.; Buchner, K.; Klussmann, S. Short bioactive Spiegelmers to migraine-associated calcitonin gene-related peptide rapidly identified by a novel approach: Tailored-SELEX. Nucleic Acids Res. 2003, 31, e130. [Google Scholar] [CrossRef] [Scilit]
- Lai, J.C.; Hong, C.Y. Magnetic-assisted rapid aptamer selection (MARAS) for generating high-affinity DNA aptamer using rotating magnetic fields. ACS Comb. Sci. 2014, 16, 321–327. [Google Scholar] [CrossRef] [Scilit]
- Biondi, E.; Benner, S.A. Artificially expanded genetic information systems for new aptamer technologies. Biomedicines 2018, 6, 53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Breuers, S.; Bryant, L.L.; Legen, T.; Mayer, G. Robotic assisted generation of 2′-deoxy-2′-fluoro-modifed RNA aptamers—High performance enabling strategies in aptamer selection. Methods 2019, 161, 3–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szeto, K.; Latulippe, D.R.; Ozer, A.; Pagano, J.M.; White, B.S.; Shalloway, D.; Lis, J.T.; Craighead, H.G. RAPID-SELEX for RNA aptamers. PLoS ONE 2013, 8, e82667. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nguyen, V.T.; Kwon, Y.S.; Kim, J.H.; Gu, M.B. Multiple GO-SELEX for efficient screening of flexible aptamers. Chem. Commun. 2014, 50, 10513–10516. [Google Scholar] [CrossRef] [Scilit]
- Ahn, J.Y.; Jo, M.; Dua, P.; Lee, D.K.; Kim, S. A sol-gel-based microfluidics system enhances the efficiency of RNA aptamer selection. Oligonucleotides 2011, 21, 93–100. [Google Scholar] [CrossRef] [Scilit]
- Smith, J.D.; Gold, L. Conditional-Selex. U.S. Patent 650,688,7B1, 26 December 2002. [Google Scholar]
- Dausse, E.; Barré, A.; Aimé, A.; Groppi, A.; Rico, A.; Ainali, C.; Salgado, G.; Palau, W.; Daguerre, E.; Nikolski, M.; et al. Aptamer selection by direct microfluidic recovery and surface plasmon resonance evaluation. Biosens. Bioelectron. 2016, 80, 418–425. [Google Scholar] [CrossRef] [Scilit]
- Burke, D.H.; Willis, J.H. Recombination, RNA evolution, and bifunctional RNA molecules isolated through chimeric SELEX. RNA 1998, 4, 1165–1175. [Google Scholar] [CrossRef] [Scilit]
- Lecocq, S.; Spinella, K.; Dubois, B.; Lista, S.; Hampel, H.; Penner, G. Aptamers as biomarkers for neurological disorders. PLoS ONE 2018, 13, e0190212. [Google Scholar] [CrossRef] [Scilit]
- Tombelli, S.; Minunni, M.; Mascini, M. Analytical applications of aptamers. Biosens. Bioelectron. 2005, 20, 2424–2434. [Google Scholar] [CrossRef] [Scilit]
- Hoinka, J.; Zotenko, E.; Friedman, A.; Sauna, Z.E.; Przytycka, T.M. Identification of sequence-structure RNA binding motifs for SELEX-derived aptamers. Bioinformatics 2012, 28, i215–i223. [Google Scholar] [CrossRef] [Scilit]
- Hoinka, J.; Berezhnoy, A.; Sauna, Z.E.; Gilboa, E.; Przytycka, T.M. AptaCluster—A method to cluster HT-SELEX aptamer pools and lessons from its application. In International Conference on Research in Computational Molecular Biology; Springer: Cham, Switzerland, 2014. [Google Scholar] [CrossRef] [Scilit]
- Ortigao, J.F.R.; Rösch, H.; Montenarh, M.; Fröhlich, A.; Seliger, H. Oligonucleotide Analogs with Terminal 3′,3′- and 5′,5′-Internucleotidic Linkages as Antisense Inhibitors of Viral Replication. Antisense Res. Dev. 1991, 1, 380. [Google Scholar] [CrossRef] [Scilit]
- Dougan, H.; Lyster, D.M.; Vo, C.V.; Stafford, A.; Weitz, J.I.; Hobbs, J.B. Extending the lifetime of anticoagulant oligodeoxynucleotide aptamers in blood. Nucl. Med. Biol. 2000, 27, 289–297. [Google Scholar] [CrossRef] [Scilit]
- Padilla, R.; Sousa, R. Efficient synthesis of nucleic acids heavily modified with non-canonical ribose 2′-groups using a mutant T7 RNA polymerase (RNAP). Nucleic Acids Res. 1999, 27, 1561–1563. [Google Scholar] [CrossRef] [Scilit]
- Ruckman, J.; Green, L.S.; Beeson, J.; Waugh, S.; Gillette, W.L.; Henninger, D.D.; Claesson-Welsh, L.; Janjić, N. 2′-fluoropyrimidine RNA-based aptamers to the 165-amino acid form of vascular endothelial growth factor (VEGF165): Inhibition of receptor binding and VEGF-induced vascular permeability through interactions requiring the exon 7-encoded domain. J. Biol. Chem. 1998, 273, 20556–20567. [Google Scholar] [CrossRef] [Scilit]
- Saccà, B.; Lacroix, L.; Mergny, J.L. The effect of chemical modifications on the thermal stability of different G-quadruplex-forming oligonucleotides. Nucleic Acids Res. 2005, 33, 1182–1192. [Google Scholar] [CrossRef] [Scilit]
- Hoellenriegel, J.; Zboralski, D.; Maasch, C.; Rosin, N.Y.; Wierda, W.G.; Keating, M.J.; Kruschinski, A.; Burger, J.A. The Spiegelmer NOX-A12, a novel CXCL12 inhibitor, interferes with chronic lymphocytic leukemia cell motility and causes chemosensitization. Blood 2014, 123, 1032–1039. [Google Scholar] [CrossRef] [Scilit]
- Pozmogova, G.E.; Zaitseva, M.A.; Smirnov, I.P.; Shvachko, A.G.; Murina, M.A.; Sergeenko, V.I. Anticoagulant effects of thioanalogs of thrombin-binding DNA-aptamer and their stability in the plasma. Bull. Exp. Biol. Med. 2010, 150, 180–184. [Google Scholar] [CrossRef] [Scilit]
- Lee, C.H.; Lee, S.H.; Kim, J.H.; Noh, Y.H.; Noh, G.J.; Lee, S.W. Pharmacokinetics of a Cholesterol-conjugated Aptamer Against the Hepatitis C Virus (HCV) NS5B Protein. Mol. Ther. Nucleic Acids 2015, 4, e254. [Google Scholar] [CrossRef] [Scilit]
- Willis, M.C.; Collins, B.; Zhang, T.; Green, L.S.; Sebesta, D.P.; Bell, C.; Kellogg, E.; Gill, S.C.; Magallanez, A.; Knauer, S.; et al. Liposome-anchored vascular endothelial growth factor aptamers. Bioconjug. Chem. 1998, 9, 573–582. [Google Scholar] [CrossRef] [Scilit]
- Da Pieve, C.; Blackshaw, E.; Missailidis, S.; Perkins, A.C. PEGylation and biodistribution of an anti-MUC1 aptamer in MCF-7 tumor-bearing mice. Bioconjug. Chem. 2012, 23, 1377–1381. [Google Scholar] [CrossRef] [Scilit]
- Trinh, T.; Zhu, G.; Xiao, X.; Puszyk, W.; Sefah, K.; Wu, Q.; Tan, W.; Liu, C. A synthetic aptamer-drug adduct for targeted liver cancer therapy. PLoS ONE 2015, 10, e0136673. [Google Scholar] [CrossRef] [Scilit]
- Kato, K.; Ikeda, H.; Miyakawa, S.; Futakawa, S.; Nonaka, Y.; Fujiwara, M.; Okudaira, S.; Kano, K.; Aoki, J.; Morita, J.; et al. Structural basis for specific inhibition of Autotaxin by a DNA aptamer. Nat. Struct. Mol. Biol. 2016, 23, 395–401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lim, Y.C.; Kouzani, A.Z.; Duan, W. Aptasensors: A review. J. Biomed. Nanotechnol. 2010, 6, 93–105. [Google Scholar] [CrossRef] [Scilit]
- Hu, M.; Zhang, K. The application of aptamers in cancer research: An up-to-date review. Future Oncol. 2013, 9, 369–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, S.; Shin, H.S.; Gedi, V.; Dua, P.; Lee, D.K.; Kim, S. Selection of DNA Aptamers Against Botulinum Neurotoxin E for Development of Fluorescent Aptasensor. Bull. Korean Chem. Soc. 2017, 38, 324–328. [Google Scholar] [CrossRef] [Scilit]
- Kim, T.H.; Lee, S.W. Aptamers for anti-viral therapeutics and diagnostics. Int. J. Mol. Sci. 2021, 22, 4168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marrazza, G. Aptamer Sensors. Biosensors 2017, 7, 5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buglak, A.A.; Samokhvalov, A.V.; Zherdev, A.V.; Dzantiev, B.B. Methods and applications of in silico aptamer design and modeling. Int. J. Mol. Sci. 2020, 21, 8420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morita, Y.; Leslie, M.; Kameyama, H.; Volk, D.E.; Tanaka, T. Aptamer therapeutics in cancer: Current and future. Cancers 2018, 10, 80. [Google Scholar] [CrossRef] [Scilit]
- Song, S.; Wang, L.; Li, J.; Fan, C.; Zhao, J. Aptamer-based biosensors. TrAC Trends Anal. Chem. 2008, 27, 108–117. [Google Scholar] [CrossRef] [Scilit]
- Davis, K.A.; Abrams, B.; Lin, Y.; Jayasena, S.D. Use of a high affinity DNA ligand in flow cytometry. Nucleic Acids Res. 1996, 24, 702–706. [Google Scholar] [CrossRef] [Scilit]
- Kaur, H.; Shorie, M. Nanomaterial based aptasensors for clinical and environmental diagnostic applications. Nanoscale Adv. 2019, 1, 2123–2138. [Google Scholar] [CrossRef] [Scilit]
- Kou, X.; Zhang, X.; Shao, X.; Jiang, C.; Ning, L. Recent advances in optical aptasensor technology for amplification strategies in cancer diagnostics. Anal. Bioanal. Chem. 2020, 412, 6691–6705. [Google Scholar] [CrossRef] [Scilit]
- Yan, S.R.; Foroughi, M.M.; Safaei, M.; Jahani, S.; Ebrahimpour, N.; Borhani, F.; Rezaei Zade Baravati, N.; Aramesh-Boroujeni, Z.; Foong, L.K. A review: Recent advances in ultrasensitive and highly specific recognition aptasensors with various detection strategies. Int. J. Biol. Macromol. 2020, 155, 184–207. [Google Scholar] [CrossRef] [Scilit]
- Banerjee, J.; Nilsen-Hamilton, M. Aptamers: Multifunctional molecules for biomedical research. J. Mol. Med. 2013, 91, 1333–1342. [Google Scholar] [CrossRef] [Scilit]
- Catuogno, S.; Esposito, C.L. Aptamer cell-based selection: Overview and advances. Biomedicines 2017, 5, 49. [Google Scholar] [CrossRef] [Scilit]
- Kaur, H.; Bruno, J.G.; Kumar, A.; Sharma, T.K. Aptamers in the therapeutics and diagnostics pipelines. Theranostics 2018, 8, 4016–4032. [Google Scholar] [CrossRef] [Scilit]
- Rosenberg, J.E.; Bambury, R.M.; Van Allen, E.M.; Drabkin, H.A.; Lara, P.N.; Harzstark, A.L.; Wagle, N.; Figlin, R.A.; Smith, G.W.; Garraway, L.A.; et al. A phase II trial of AS1411 (a novel nucleolin-targeted DNA aptamer) in metastatic renal cell carcinoma. Investig. N. Drugs 2014, 32, 178–187. [Google Scholar] [CrossRef] [Scilit]
- Catuogno, S.; Esposito, C.L.; de Franciscis, V. Aptamer-mediated targeted delivery of therapeutics: An update. Pharmaceuticals 2016, 9, 69. [Google Scholar] [CrossRef] [Scilit]
- Chandola, C.; Neerathilingam, M. Aptamers for Targeted Delivery: Current Challenges and Future Opportunities. In Role of Novel Drug Delivery Vehicles in Nanobiomedicine; BoD–Books on Demand: Norderstedt, Germany, 2020. [Google Scholar]
- Bayrac, A.T.; Sefah, K.; Parekh, P.; Bayrac, C.; Gulbakan, B.; Oktem, H.A.; Tan, W. In vitro selection of DNA aptamers to glioblastoma multiforme. ACS Chem. Neurosci. 2011, 2, 175–181. [Google Scholar] [CrossRef] [Scilit]
- de Almeida, C.E.B.; Alves, L.N.; Rocha, H.F.; Cabral-Neto, J.B.; Missailidis, S. Aptamer delivery of siRNA, radiopharmaceutics and chemotherapy agents in cancer. Int. J. Pharm. 2017, 525, 334–342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McNamara, J.O.; Andrechek, E.R.; Wang, Y.; Viles, K.D.; Rempel, R.E.; Gilboa, E.; Sullenger, B.A.; Giangrande, P.H. Cell type-specific delivery of siRNAs with aptamer-siRNA chimeras. Nat. Biotechnol. 2006, 24, 1005–1015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sivakumar, P.; Kim, S.; Kang, H.C.; Shim, M.S. Targeted siRNA delivery using aptamer-siRNA chimeras and aptamer-conjugated nanoparticles. Wiley Interdiscip. Rev. Nanomed. Nanobiotechnol. 2019, 11, 1–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- WHO. Dementia. 2019. Available online: https://www.who.int/news-room/fact-sheets/detail/dementia (accessed on 30 September 2021).
- Bouvier-Müller, A.; Ducongé, F. Nucleic acid aptamers for neurodegenerative diseases. Biochimie 2018, 145, 73–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qu, J.; Yu, S.; Zheng, Y.; Zheng, Y.; Yang, H.; Zhang, J. Aptamer and its applications in neurodegenerative diseases. Cell. Mol. Life Sci. 2017, 74, 683–695. [Google Scholar] [CrossRef] [Scilit]
- Lange, C.W.; VanBrocklin, H.F.; Taylor, S.E. Photoconjugation of 3-azido-5-nitrobenzyl-[18F]fluoride to an oligonucleotide aptamer. J. Label. Compd. Radiopharm. 2002, 45, 257–268. [Google Scholar] [CrossRef] [Scilit]
- Rutkowska, M.; Płotka-Wasylka, J.; Majchrzak, T.; Wojnowski, W.; Mazur-Marzec, H.; Namieśnik, J. Recent trends in determination of neurotoxins in aquatic environmental samples. TrAC Trends Anal. Chem. 2019, 112, 112–122. [Google Scholar] [CrossRef] [Scilit]
- Eissa, S.; Siaj, M.; Zourob, M. Aptamer-based competitive electrochemical biosensor for brevetoxin-2. Biosens. Bioelectron. 2015, 69, 148–154. [Google Scholar] [CrossRef] [Scilit]
- Gao, S.; Zheng, X.; Wu, J. A biolayer interferometry-based competitive biosensor for rapid and sensitive detection of saxitoxin. Sens. Actuators B Chem. 2017, 246, 169–174. [Google Scholar] [CrossRef] [Scilit]
- Dhiman, A.; Anand, A.; Malhotra, A.; Khan, E.; Santra, V.; Kumar, A.; Sharma, T.K. Rational truncation of aptamer for cross-species application to detect krait envenomation. Sci. Rep. 2018, 8, 17795. [Google Scholar] [CrossRef] [Scilit]
- Si, B.; Song, E. Recent advances in the detection of neurotransmitters. Chemosensors 2018, 6, 1. [Google Scholar] [CrossRef] [Scilit]
- Masato, A.; Plotegher, N.; Boassa, D.; Bubacco, L. Impaired dopamine metabolism in Parkinson’s disease pathogenesis. Mol. Neurodegener. 2019, 14, 35. [Google Scholar] [CrossRef] [Scilit]
- Mannironi, C.; Di Nardo, A.; Fruscoloni, P.; Tocchini-Valentini, G.P. In vitro selection of dopamine RNA ligands. Biochemistry 1997, 36, 9726–9734. [Google Scholar] [CrossRef] [Scilit]
- Liu, S.; Xing, X.; Yu, J.; Lian, W.; Li, J.; Cui, M.; Huang, J. A novel label-free electrochemical aptasensor based on graphene-polyaniline composite film for dopamine determination. Biosens. Bioelectron. 2012, 36, 186–191. [Google Scholar] [CrossRef] [Scilit]
- Wei, B.; Zhong, H.; Wang, L.; Liu, Y.; Xu, Y.; Zhang, J.; Xu, C.; He, L.; Wang, H. Facile preparation of a collagen-graphene oxide composite: A sensitive and robust electrochemical aptasensor for determining dopamine in biological samples. Int. J. Biol. Macromol. 2019, 135, 400–406. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Chen, X.; Zhang, Z.; Tang, J.; Zhang, B. Gold Nanoparticle-DNA conjugates enhanced determination of dopamine by aptamer-based microcantilever array sensor. Sens. Actuators B Chem. 2018, 275, 25–30. [Google Scholar] [CrossRef] [Scilit]
- Iván, G.; Szigeti-Csúcs, N.; Oláh, M.; Nagy, G.M.; Góth, M.I. Treatment of pituitary tumors: Dopamine agonists. Endocrine 2005, 28, 101–110. [Google Scholar] [CrossRef] [Scilit]
- Höglinger, G.U.; Rizk, P.; Muriel, M.P.; Duyckaerts, C.; Oertel, W.H.; Caille, I.; Hirsch, E.C. Dopamine depletion impairs precursor cell proliferation in Parkinson disease. Nat. Neurosci. 2004, 7, 726–735. [Google Scholar] [CrossRef] [Scilit]
- Jakel, R.J.; Maragos, W.F. Neuronal cell death in Huntington’s disease: A potential role for dopamine. Trends Neurosci. 2000, 23, 239–245. [Google Scholar] [CrossRef] [Scilit]
- Hussain, T.; Lokhandwala, M.F. Renal dopamine receptors and hypertension. Exp. Biol. Med. 2003, 228, 134–142. [Google Scholar] [CrossRef] [Scilit]
- Chávez, J.L.; Hagen, J.A.; Kelley-Loughnane, N. Fast and selective plasmonic serotonin detection with Aptamer-gold nanoparticle conjugates. Sensors 2017, 17, 681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, C.; Cheung, K.M.; Huang, I.; Yang, H.; Nakatsuka, N.; Liu, W.; Cao, Y.; Man, T.; Weiss, P.S.; Monbouquette, H.G.; et al. Implantable aptamer—Field-effect transistor neuroprobes for in vivo neurotransmitter monitoring. Sci. Adv. 2021, 7422, 25–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saraf, N.; Bosak, A.; Willenberg, A.; Das, S.; Willenberg, B.J.; Seal, S. Colorimetric detection of epinephrine using an optimized paper-based aptasensor. RSC Adv. 2017, 7, 49133–49143. [Google Scholar] [CrossRef] [Scilit]
- Pollak, T.A.; Rogers, J.P.; Nagele, R.G.; Peakman, M.; Stone, J.M.; David, A.S.; McGuire, P. Antibodies in the diagnosis, prognosis, and prediction of psychotic disorders. Schizophr. Bull. 2019, 45, 233–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mroczko, B.; Groblewska, M.; Litman-Zawadzka, A. The role of protein misfolding and tau oligomers (TauOs) in Alzheimer’s disease (AD). Int. J. Mol. Sci. 2019, 20, 4661. [Google Scholar] [CrossRef] [Scilit]
- Rahimi, F.; Murakami, K.; Summers, J.L.; Chen, C.H.B.; Bitan, G. RNA aptamers generated against oligomeric Aβ40 recognize common amyloid aptatopes with low specificity but high sensitivity. PLoS ONE 2009, 4, e7694. [Google Scholar] [CrossRef] [Scilit]
- Tsukakoshi, K.; Abe, K.; Sode, K.; Ikebukuro, K. Selection of DNA aptamers that recognize alpha-synuclein oligomers using a competitive screening method. Anal. Chem. 2012, 84, 5542–5547. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Figueroa-Miranda, G.; Lyu, Z.; Zafiu, C.; Willbold, D.; Offenhäusser, A.; Mayer, D. Monitoring amyloid-Β proteins aggregation based on label-free aptasensor. Sens. Actuators B Chem. 2019, 288, 535–542. [Google Scholar] [CrossRef] [Scilit]
- Amouzadeh Tabrizi, M.; Ferré-Borrull, J.; Marsal, L.F. Highly sensitive aptasensor based on interferometric reflectance spectroscopy for the determination of amyloid Beta as an Alzheimer’s disease biomarkers using nanoporous anodic alumina. Biosens. Bioelectron. 2019, 137, 279–286. [Google Scholar] [CrossRef] [Scilit]
- Krylova, S.M.; Musheev, M.; Nutiu, R.; Li, Y.; Lee, G.; Krylov, S.N. Tau protein binds single-stranded DNA sequence specifically—The proof obtained in vitro with non-equilibrium capillary electrophoresis of equilibrium mixtures. FEBS Lett. 2005, 579, 1371–1375. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.; Wark, A.W.; Lee, H.J. Femtomolar Detection of Tau Proteins in Undiluted Plasma Using Surface Plasmon Resonance. Anal. Chem. 2016, 88, 7793–7799. [Google Scholar] [CrossRef] [Scilit]
- Lisi, S.; Fiore, E.; Scarano, S.; Pascale, E.; Boehman, Y.; Ducongé, F.; Chierici, S.; Minunni, M.; Peyrin, E.; Ravelet, C. Non-SELEX isolation of DNA aptamers for the homogeneous-phase fluorescence anisotropy sensing of tau Proteins. Anal. Chim. Acta 2018, 1038, 173–181. [Google Scholar] [CrossRef] [Scilit]
- Takahashi, T.; Tada, K.; Mihara, H. RNA aptamers selected against amyloid β-peptide (Aβ) inhibit the aggregation of Aβ. Mol. Biosyst. 2009, 5, 986–991. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Yang, Y.; Jia, M.Y.; Ma, C.; Wang, M.Y.; Che, L.H.; Yang, Y.; Wu, J. The novel amyloid-beta peptide aptamer inhibits intracellular amyloid-beta peptide toxicity. Neural Regen. Res. 2013, 8, 39–48. [Google Scholar] [CrossRef]
- Teng, I.T.; Li, X.; Yadikar, H.A.; Yang, Z.; Li, L.; Lyu, Y.; Pan, X.; Wang, K.K.; Tan, W. Identification and Characterization of DNA Aptamers Specific for Phosphorylation Epitopes of Tau Protein. J. Am. Chem. Soc. 2018, 140, 14314–14323. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.H.; Kim, E.; Choi, W.H.; Lee, J.; Lee, J.H.; Lee, H.; Kim, D.E.; Suh, Y.H.; Lee, M.J. Inhibitory RNA Aptamers of Tau Oligomerization and Their Neuroprotective Roles against Proteotoxic Stress. Mol. Pharm. 2016, 13, 2039–2048. [Google Scholar] [CrossRef] [Scilit]
- Rentmeister, A.; Bill, A.; Wahle, T.; Walter, J.; Famulok, M. RNA aptamers selectively modulate protein recruitment to the cytoplasmic domain of b -secretase BACE1 in vitro. RNA 2006, 1650–1660. [Google Scholar] [CrossRef] [Scilit]
- Xiang, J.; Zhang, W.; Cai, X.F.; Cai, M.; Yu, Z.H.; Yang, F.; Zhu, W.; Li, X.T.; Wu, T.; Zhang, J.S.; et al. DNA Aptamers Targeting BACE1 Reduce Amyloid Levels and Rescue Neuronal Deficiency in Cultured Cells. Mol. Ther. Nucleic Acids 2019, 16, 302–312. [Google Scholar] [CrossRef] [Scilit]
- Tsukakoshi, K.; Harada, R.; Sode, K.; Ikebukuro, K. Screening of DNA aptamer which binds to α-synuclein. Biotechnol. Lett. 2010, 32, 643–648. [Google Scholar] [CrossRef] [Scilit]
- Sun, K.; Xia, N.; Zhao, L.; Liu, K.; Hou, W.; Liu, L. Aptasensors for the selective detection of alpha-synuclein oligomer by colorimetry, surface plasmon resonance and electrochemical impedance spectroscopy. Sens. Actuators B Chem. 2017, 245, 87–94. [Google Scholar] [CrossRef] [Scilit]
- Taghdisi, S.M.; Danesh, N.M.; Nameghi, M.A.; Ramezani, M.; Alibolandi, M.; Hassanzadeh-Khayat, M.; Emrani, A.S.; Abnous, K. A novel electrochemical aptasensor based on nontarget-induced high accumulation of methylene blue on the surface of electrode for sensing of α-synuclein oligomer. Biosens. Bioelectron. 2019, 123, 14–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pero-Gascon, R.; Benavente, F.; Minic, Z.; Berezovski, M.V.; Sanz-Nebot, V. On-line Aptamer Affinity Solid-Phase Extraction Capillary Electrophoresis-Mass Spectrometry for the Analysis of Blood α-Synuclein. Anal. Chem. 2020, 92, 1525–1533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, Y.; Qu, J.; Xue, F.; Zheng, Y.; Yang, B.; Chang, Y.; Yang, H.; Zhang, J. Novel DNA Aptamers for Parkinson’s Disease Treatment Inhibit α-Synuclein Aggregation and Facilitate its Degradation. Mol. Ther. Nucleic Acids 2018, 11, 228–242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, X.; Zhao, Y.; Xue, F.; Zheng, Y.; Huang, H.; Wang, W.; Chang, Y.; Yang, H.; Zhang, J. Exosomal DNA Aptamer Targeting α-Synuclein Aggregates Reduced Neuropathological Deficits in a Mouse Parkinson’s Disease Model. Mol. Ther. Nucleic Acids 2019, 17, 726–740. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wallin, M.T.; Culpepper, W.J.; Nichols, E.; Bhutta, Z.A.; Gebrehiwot, T.T.; Hay, S.I.; Khalil, I.A.; Krohn, K.J.; Liang, X.; Naghavi, M.; et al. Global, regional, and national burden of multiple sclerosis 1990–2016: A systematic analysis for the Global Burden of Disease Study 2016. Lancet Neurol. 2019, 18, 269–285. [Google Scholar] [CrossRef] [Scilit]
- Masvekar, R.; Wu, T.; Kosa, P.; Barbour, C.; Fossati, V.; Bielekova, B. Cerebrospinal fluid biomarkers link toxic astrogliosis and microglial activation to multiple sclerosis severity. Mult. Scler. Relat. Disord. 2019, 28, 34–43. [Google Scholar] [CrossRef] [Scilit]
- Krasitskaya, V.V.; Chaukina, V.V.; Abroskina, M.V.; Vorobyeva, M.A.; Ilminskaya, A.A.; Kabilov, M.R.; Prokopenko, S.V.; Nevinsky, G.A.; Venyaminova, A.G.; Frank, L.A. Bioluminescent aptamer-based sandwich-type assay of anti-myelin basic protein autoantibodies associated with multiple sclerosis. Anal. Chim. Acta 2019, 1064, 112–118. [Google Scholar] [CrossRef] [Scilit]
- Browne, P.; Chandraratna, D.; Angood, C.; Tremlett, H.; Baker, C.; Taylor, B.V.; Thompson, A.J. Atlas of multiple sclerosis 2013: A growing global problem with widespread inequity. Neurology 2014, 83, 1022–1024. [Google Scholar] [CrossRef] [Scilit]
- Hosseini Shamili, F.; Alibolandi, M.; Rafatpanah, H.; Abnous, K.; Mahmoudi, M.; Kalantari, M.; Taghdisi, S.M.; Ramezani, M. Immunomodulatory properties of MSC-derived exosomes armed with high affinity aptamer toward mylein as a platform for reducing multiple sclerosis clinical score. J. Control. Release 2019, 299, 149–164. [Google Scholar] [CrossRef] [Scilit]
- Nastasijevic, B.; Wright, B.R.; Smestad, J.; Warrington, A.E.; Rodriguez, M.; Maher, L.J. Remyelination induced by a DNA Aptamer in a mouse model of multiple sclerosis. PLoS ONE 2012, 7, e39595. [Google Scholar] [CrossRef] [Scilit]
- Voge, N.V.; Alvarez, E. Monoclonal antibodies in multiple sclerosis: Present and future. Biomedicines 2019, 7, 20. [Google Scholar] [CrossRef] [Scilit]
- Huang, Z.; Pei, W.; Jayaseelan, S.; Shi, H.; Niu, L. RNA Aptamers Selected against the GluR2 Glutamate Receptor Channel. Biochemistry 2007, 46, 12648–12655. [Google Scholar] [CrossRef] [Scilit]
- Zacco, E.; Graña-Montes, R.; Martin, S.R.; de Groot, N.S.; Alfano, C.; Tartaglia, G.G.; Pastore, A. RNA as a key factor in driving or preventing self-assembly of the TAR DNA-binding protein 43. J. Mol. Biol. 2019, 431, 1671–1688. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.J.; Chen, W.W.; Zhang, X. Huntington’s disease: Molecular basis of pathology and status of current therapeutic approaches. Exp. Ther. Med. 2016, 12, 1951–1956. [Google Scholar] [CrossRef] [Scilit]
- Chaudhary, R.K.; Patel, K.A.; Patel, M.K.; Joshi, R.H.; Roy, I. Inhibition of Aggregation of Mutant Huntingtin by Nucleic Acid Aptamers in Vitro and in a Yeast Model of Huntington’s Disease. Mol. Ther. 2015, 23, 1912–1926. [Google Scholar] [CrossRef] [Scilit]
- Shin, B.; Jung, R.; Oh, H.; Owens, G.E.; Lee, H.; Kwak, S.; Lee, R.; Cotman, S.L.; Lee, J.M.; MacDonald, M.E.; et al. Novel DNA Aptamers that Bind to Mutant Huntingtin and Modify Its Activity. Mol. Ther. Nucleic Acids 2018, 11, 416–428. [Google Scholar] [CrossRef] [Scilit]
- Macedo, B.; Cordeiro, Y. Unraveling prion protein interactions with aptamers and other PrP-binding nucleic acids. Int. J. Mol. Sci. 2017, 18, 1023. [Google Scholar] [CrossRef] [Scilit]
- Cavaliere, P.; Pagano, B.; Granata, V.; Prigent, S.; Rezaei, H.; Giancola, C.; Zagari, A. Cross-talk between prion protein and quadruplex-forming nucleic acids: A dynamic complex formation. Nucleic Acids Res. 2013, 41, 327–339. [Google Scholar] [CrossRef] [Scilit]
- Hanif, F.; Muzaffar, K.; Perveen, K.; Malhi, S.M.; Simjee, S.U. Glioblastoma multiforme: A review of its epidemiology and pathogenesis through clinical presentation and treatment. Asian Pac. J. Cancer Prev. 2017, 18, 3–9. [Google Scholar] [CrossRef] [Scilit]
- Bastien, J.I.L.; McNeill, K.A.; Fine, H.A. Molecular characterizations of glioblastoma, targeted therapy, and clinical results to date. Cancer 2015, 121, 502–516. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Peng, L.; Liang, Z.; Kou, Z.; Chen, Y.; Shi, G.; Li, X.; Liang, Y.; Wang, F.; Shi, Y. Effects of Aptamer to U87-EGFRvIII Cells on the Proliferation, Radiosensitivity, and Radiotherapy of Glioblastoma Cells. Mol. Ther. Nucleic Acids 2018, 10, 438–449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aldape, K.; Brindle, K.M.; Chesler, L.; Chopra, R.; Gajjar, A.; Gilbert, M.R.; Gottardo, N.; Gutmann, D.H.; Hargrave, D.; Holland, E.C.; et al. Challenges to curing primary brain tumours. Nat. Rev. Clin. Oncol. 2019, 16, 509–520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bellettato, C.M.; Scarpa, M. Possible strategies to cross the blood-brain barrier. Ital. J. Pediatr. 2018, 44, 127–133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Röthlisberger, P.; Gasse, C.; Hollenstein, M. Nucleic acid aptamers: Emerging applications in medical imaging, nanotechnology, neurosciences, and drug delivery. Int. J. Mol. Sci. 2017, 18, 2430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, Y.D.; Paudel, R.; Liu, J.; Ma, C.; Zhang, Z.S.; Zhou, S.K. MRI contrast agents: Classification and application (Review). Int. J. Mol. Med. 2016, 38, 1319–1326. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.; Lu, Y. A smart magnetic resonance imaging contrast agent responsive to adenosine based on a DNA aptamer-conjugated gadolinium complex. Chem. Commun. 2011, 47, 4998–5000. [Google Scholar] [CrossRef] [Scilit]
- Jacobson, O.; Yan, X.; Niu, G.; Weiss, I.D.; Ma, Y.; Szajek, L.P.; Shen, B.; Kiesewetter, D.O.; Chen, X. PET imaging of tenascin-C with a radiolabeled single-stranded DNA aptamer. J. Nucl. Med. 2015, 56, 616–621. [Google Scholar] [CrossRef] [Scilit]
- Jacobson, O.; Weiss, I.D.; Wang, L.; Wang, Z.; Yang, X.; Dewhurst, A.; Ma, Y.; Zhu, G.; Niu, G.; Kiesewetter, D.O.; et al. 18F-labeled single-stranded DNA aptamer for PET imaging of protein tyrosine kinase-7 expression. J. Nucl. Med. 2015, 56. [Google Scholar] [CrossRef]
- Kim, H.J.; Park, J.Y.; Lee, T.S.; Song, I.H.; Cho, Y.L.; Chae, J.R.; Kang, H.; Lim, J.H.; Lee, J.H.; Kang, W.J. PET imaging of HER2 expression with an 18 F-fluoride labeled aptamer. PLoS ONE 2019, 14, e0211047. [Google Scholar] [CrossRef] [Scilit]
- Mukherjee, B.; McEllin, B.; Camacho, C.V.; Tomimatsu, N.; Sirasanagandala, S.; Nannepaga, S.; Hatanpaa, K.J.; Mickey, B.; Madden, C.; Maher, E.; et al. EGFRvIII and DNA double-strand break repair: A molecular mechanism for radioresistance in glioblastoma. Cancer Res. 2009, 69, 4252–4259. [Google Scholar] [CrossRef] [Scilit]
- Wu, X.; Liang, H.; Tan, Y.; Yuan, C.; Li, S.; Li, X.; Li, G.; Shi, Y.; Zhang, X. Cell-SELEX aptamer for highly specific radionuclide molecular imaging of glioblastoma in vivo. PLoS ONE 2014, 9, e90752. [Google Scholar] [CrossRef] [Scilit]
- Zavyalova, E.; Turashev, A.; Novoseltseva, A.; Antipova, O.; Savchenko, E.; Golovin, A.; Pavlova, G.; Kopylov, A.; Zavyalova, E.; Novoseltseva, A.; et al. Pyrene-Modified DNA Aptamers with High Affinity to Wild-Type EGFR and EGFRvIII. Nucleic Acid Ther. 2020, 30, 175–187. [Google Scholar] [CrossRef] [Scilit]
- Zhu, G.; Niu, G.; Chen, X. Aptamer-Drug Conjugates. Bioconjug. Chem. 2015, 26, 2186–2197. [Google Scholar] [CrossRef] [Scilit]
- Ayatollahi, M.; Ayatollahi, G.; Rashidi, M.; Hekmatimoghaddam, S.; Mosshafi, M.; Jebali, A.; Iman, M.; Shahdadi Sardo, H. Prodigiosin-Conjugated Aptamer for Attachment to the Surface of Brain Cancer Cells Mediated by Glutamate Receptor. Colloids Interface Sci. Commun. 2018, 24, 45–48. [Google Scholar] [CrossRef] [Scilit]
- Willson, J. Transferrin’ across the blood-brain barrier. Nat. Rev. Drug Discov. 2020, 19, 444–445. [Google Scholar] [CrossRef] [Scilit]
- Kariolis, M.S.; Wells, R.C.; Getz, J.A.; Kwan, W.; Mahon, C.S.; Tong, R.; Kim, D.J.; Srivastava, A.; Bedard, C.; Henne, K.R.; et al. Brain delivery of therapeutic proteins using an Fc fragment blood-brain barrier transport vehicle in mice and monkeys. Sci. Transl. Med. 2020, 12, eaay1359. [Google Scholar] [CrossRef] [Scilit]
- Fishman, J.B.; Rubin, J.B.; Handrahan, J.V.; Connor, J.R.; Fine, R.E. Receptor-mediated transcytosis of transferrin across the blood-brain barrier. J. Neurosci. Res. 1987, 18, 299–304. [Google Scholar] [CrossRef] [Scilit]
- Macdonald, J.; Henri, J.; Goodman, L.; Xiang, D.; Duan, W.; Shigdar, S. Development of a Bifunctional Aptamer Targeting the Transferrin Receptor and Epithelial Cell Adhesion Molecule (EpCAM) for the Treatment of Brain Cancer Metastases. ACS Chem. Neurosci. 2017, 8, 777–784. [Google Scholar] [CrossRef] [Scilit]
- Zhu, X.; Zhou, H.; Liu, Y.; Wen, Y.; Wei, C.; Yu, Q.; Liu, J. Transferrin/aptamer conjugated mesoporous ruthenium nanosystem for redox- controlled and targeted chemo-photodynamic therapy of glioma. Acta Biomater. 2018, 82, 143–157. [Google Scholar] [CrossRef] [Scilit]
- Esposito, C.L.; Nuzzo, S.; Catuogno, S.; Romano, S.; de Nigris, F.; de Franciscis, V. STAT3 Gene Silencing by Aptamer-siRNA Chimera as Selective Therapeutic for Glioblastoma. Mol. Ther. Nucleic Acids 2018, 10, 398–411. [Google Scholar] [CrossRef] [Scilit]
- Wu, Q.; Wu, L.; Wang, Y.; Zhu, Z.; Song, Y.; Tan, Y.; Wang, X.F.; Li, J.; Kang, D.; Yang, C.J. Evolution of DNA aptamers for malignant brain tumor gliosarcoma cell recognition and clinical tissue imaging. Biosens. Bioelectron. 2016, 80, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Fechter, P.; Cruz Da Silva, E.; Mercier, M.C.; Noulet, F.; Etienne-Seloum, N.; Guenot, D.; Lehmann, M.; Vauchelles, R.; Martin, S.; Lelong-Rebel, I.; et al. RNA Aptamers Targeting Integrin α5β1 as Probes for Cyto- and Histofluorescence in Glioblastoma. Mol. Ther. Nucleic Acids 2019, 17, 63–77. [Google Scholar] [CrossRef] [Scilit]

| SELEX Type | Features | Reference |
|---|---|---|
| PhotoSELEX | Light sensitive oligonucleotides are excited by UV and covalently link to their target molecules | [14] |
| Cell-SELEX | Whole cells are used for the selection of aptamers that bind cell surface targets | [15] |
| In vivo SELEX | Aptamers are selected from an oligonucleotide pool in living animals | [16] |
| In silico SELEX | Computer programs are used to predict tertiary structure, affinity, and target interaction of aptamer candidates | [17] |
| CE-SELEX | Capillary electrophoresis is used to select high-affinity aptamers, which reduces the selection process time from weeks to days | [18] |
| Spiegelmer Technology | After selection, aptamers are synthesized as unnatural L-oligonucleotides, which are more stable than D-oligonucleotides | [19] |
| Structure Switching SELEX | The nucleic acid pool has a short, unvaried sequence by which all oligonucleotides can be captured on a complementary sequence. The oligonucleotides are released when they switch structures to bind their target molecule. | [13] |
| Magnetic-assisted Rapid Aptamer Selection (MARAS) | Magnetic nanoparticle-attached targets are used to capture aptamers in the presence of an externally applied rotating magnetic field with varying frequencies that influence the selected aptamer affinities. | [20] |
| Artificially Expanded Genetic Information (AEGIS)-SELEX | The AEGIS-SELEX library is composed of oligonucleotides containing natural and non-natural nucleosides. These libraries have higher sequence diversities than libraries of oligonucleotides containing only natural nucleosides. | [21] |
| Robotic Assisted-SELEX | Robotic platforms perform the selection without any manual intervention. It reduces the selection process to less than 2 days | [22] |
| RAPID-SELEX | A conventional SELEX protocol, but without amplification. After each round, Kd values are measured, and the enriched aptamers are sent to HTS. | [23] |
| GO-SELEX | A conventional SELEX protocol with unbound oligos adsorbed by graphene oxide (GO) | [24] |
| Sol-gel SELEX | The desired aptamer target is immobilized on a microfluidic device | [25] |
| Conditional SELEX | This method enables the selection of aptamers that only function under the chosen condition such as when they are in the presence of a regulatory molecule | [26] |
| Tailored SELEX | The library sequences do not have primer complements and SELEX is performed in the absence of primer complements. To amplify the selected oligonucleotides, the primer complements are ligated with primers. This method prevents the primer complements on the oligonucleotides from being part of the selected aptamer structure that binds to target | [19] |
| SPR-SELEX | The desired target is immobilized on an SPR chip and the oligo pool injected on the biosensor chip for aptamer selection. | [27] |
| Chimeric SELEX | Two or more libraries are used to isolate functionally different aptamers, which are then fused to create a dual function aptamer. | [28] |
| FRELEX | Random 8mers are used to capture the aptamers in Phase I and the target molecule is free in solution during Phase II of selection. This method allows for a true free aptamer selection strategy. | [29] |
| Feature | Modification | Reference |
|---|---|---|
| increases stability and resistance to 3′ exonuclease | 3′-3′ and 5′-5′ internucleotide linkage | [33] |
| resistance to 3′ exonuclease | 3′ Biotin Conjugates | [34] |
| increases nuclease resistance | 2′-fluoro (2′-F) Substitution | [35] |
| 2′-amino (2′NH2) Substitution | [35] | |
| 2′-O-methly (2′-OMe) Substitution | [36] | |
| Triazole replacement | [37] | |
| L-DNA | [38] | |
| increases DNA nuclease resistance, destabilizes quadruplexes in aptamer structure | thiophosphoryl modifications | [39] |
| resistance to renal clearance | 5′-End with Cholesterol | [40] |
| 5′-End with Dialkyl Lipids | [41] | |
| 5′-End with PEGylation | [42] | |
| improving binding affinity and target selectivity | base modifications (SOMAmers) | [43] |
| structure-based modifications | [44] |
| Aptamer | Sequence (5′-3′) | Target | Kd | Ref. |
|---|---|---|---|---|
| BT5.6 | GGGGACGTAAATTGGATGTGGCTGCTTATGCTCTACTTG | BoNT-E | 53 nM | [47] |
| M-30 | GGTATTGAGGGTCGCATCCCGTGGAAACAGGTTCATTGGGCGCAC TCCGCTTTCTGTAGATGGCTCTAACTCTCCTCT | saxitoxin | 128 nM | [73] |
| α-Tox-T2 | AGTTAGGGGCGACATGACCAAACGTT | α-toxin | 2.85 nM | [74] |
| Dopa2 | GCCGCGGAAGACGUUGGAAGGAUAGAUACCUACAACGGGGAAUAUAGAGGCCACCACAUAGUGAGGCCCUCCUCCCAAG | dopamine | 2.8 μM | [77] |
| T-SO508 | GCCTGTGGTGTTGGGGCGGGTGCG | amyloid beta | 68 nM | [91] |
| T-SO530 | GGTGCGGCGGGACTAGTGGGTGTG | amyloid beta | 63 nM | [91] |
| ssDNA1 | GCGGAGCGTGGCAGG | Tau381 | 190 nM | [94] |
| DNA aptamer | - | Tau441 | 28 nM | [96] |
| E2 | - | amyloid beta 1–40 | 10.9 μM | [97] |
| N2 | - | amyloid beta 1–40 | 21.6 μM | [97] |
| TH14 | CGCAACGCCGGGCCACTACGCGAATGGCAAGCCCGTCGAC | BACE1 | 280 nM | [101] |
| S10 | GTACACGTCGGCCACCTACGCGAAGTGGAAGCCTCATTTG | BACE1 | 360 nM | [101] |
| M5-15 | - | α-syn | - | [103] |
| AN58 | - | GluR2 | - | [116] |
| MS1 | AGGGGTGGGGAGGGGTGGGGA | huntingtin | - | [120] |
| MS2 | AGGGGTGGGGAGGGGAGGGGA | huntingtin | - | [120] |
| U2 | - | EGFRvIII | 6.27 nM | [125] |
| SLYC3 | CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG | EpCAM | - | [142] |
| TEPN | GCGCGGTACCGCGCTAACGGATTCCTTTTCCGT | transferrin receptor | 65 nM | [142] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ozturk, M.; Nilsen-Hamilton, M.; Ilgu, M. Aptamer Applications in Neuroscience. Pharmaceuticals 2021, 14, 1260. https://doi.org/10.3390/ph14121260
Ozturk M, Nilsen-Hamilton M, Ilgu M. Aptamer Applications in Neuroscience. Pharmaceuticals. 2021; 14(12):1260. https://doi.org/10.3390/ph14121260
Chicago/Turabian StyleOzturk, Meric, Marit Nilsen-Hamilton, and Muslum Ilgu. 2021. "Aptamer Applications in Neuroscience" Pharmaceuticals 14, no. 12: 1260. https://doi.org/10.3390/ph14121260
APA StyleOzturk, M., Nilsen-Hamilton, M., & Ilgu, M. (2021). Aptamer Applications in Neuroscience. Pharmaceuticals, 14(12), 1260. https://doi.org/10.3390/ph14121260

