Micromeria fruticosa Induces Cell Cycle Arrest and Apoptosis in Breast and Colorectal Cancer Cells
Abstract
1. Introduction
2. Results
2.1. Cytotoxic Activity
2.2. Apoptotic Activity
2.3. Caspase Activity
2.4. Cell Cycle Analysis
2.5. qRT-PCR and Western Blot
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Plant Material and Extraction
4.3. Cell Lines
4.4. Cytotoxicity Assay
4.5. Annexin V/PI
4.6. Caspase 8/9 Assay
4.7. Cell Cycle Analysis
4.8. RNA Isolation, cDNA and qRT-PCR
4.9. Western Blotting Analysis
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- World Health Organization. Cancer registration and statistics. J. Am. Med. Womens Assoc. 1951, 6, 142. [Google Scholar]
- MacDonald, V. Chemotherapy: Managing side effects and safe handling. Can. Vet. J. 2009, 50, 665–668. [Google Scholar]
- Zi, X.; Zhang, R. Anti-cancer molecular targets of natural products. Curr. Cancer Drug Targets 2013, 13, 485. [Google Scholar] [CrossRef]
- Salameh, N.; Shraim, N.; Jaradat, N. Chemical Composition and Enzymatic Screening of Micromeria fruticosa serpyllifolia Volatile Oils Collected from Three Different Regions of West Bank, Palestine. Biomed. Res. Int. 2018, 2018, 6536919. [Google Scholar] [CrossRef] [PubMed]
- Yaniv, Z.; Dudai, N. Medicinal and Aromatic Plants of the Middle-East; Springer: Berlin, Germany, 2014; Volume 2. [Google Scholar]
- Dafni, A.; Yaniv, Z.; Palevitch, D. Ethnobotanical survey of medicinal plants in northern Israel. J. Ethnopharmacol. 1984, 10, 295–310. [Google Scholar] [CrossRef]
- Abu-Gharbieh, E.; Shehab, N.G.; Khan, S.A. Anti-inflammatory and gastroprotective activities of the aqueous extract of Micromeria fruticosa (L.) Druce ssp Serpyllifolia in mice. Pak. J. Pharm. Sci. 2013, 26, 799–803. [Google Scholar] [PubMed]
- Abu-Gharbieh, E.; Bustanji, Y.; Mohammad, M. In vitro effects of Micromeria fruticosa on human leukocyte myeloperoxidase activity. J. Pharm. Res. 2010, 3, 2492–2493. [Google Scholar]
- Abu-Gharbieh, E.; Ahmed, N.G. Bioactive content, hepatoprotective and antioxidant activities of whole plant extract of Micromeria fruticosa (L) Druce ssp Serpyllifolia F Lamiaceae against Carbon tetrachloride-induced hepatotoxicity in mice. Trop. J. Pharm. Res. 2016, 15, 2099–2106. [Google Scholar] [CrossRef]
- Shehab, N.G.; Abu-Gharbieh, E. Constituents and biological activity of the essential oil and the aqueous extract of Micromeria fruticosa (L.) Druce subsp. serpyllifolia. Pak. J. Pharm. Sci. 2012, 25, 687–692. [Google Scholar]
- Koc, K.; Ozdemir, O.; Kizilkaya, O.F.; Sengul, M.; Turkez, H. Cytotoxic activity of the aqueous extract of Micromeria fruticosa (L.) Druce subsp. serpyllifolia on human U-87 MG cell lines. Arch. Biol. Sci. 2017, 69, 449–453. [Google Scholar] [CrossRef]
- Liu, T.; Zhu, W.; Yang, X.; Chen, L.; Yang, R.; Hua, Z.; Li, G. Detection of apoptosis based on the interaction between annexin V and phosphatidylserine. Anal. Chem. 2009, 81, 2410–2413. [Google Scholar] [CrossRef] [PubMed]
- Baskic, D.; Popovic, S.; Ristic, P.; Arsenijevic, N.N. Analysis of cycloheximide-induced apoptosis in human leukocytes: Fluorescence microscopy using annexin V/propidium iodide versus acridin orange/ethidium bromide. Cell Biol. Int. 2006, 30, 924–932. [Google Scholar] [CrossRef] [PubMed]
- Julien, O.; Wells, J.A. Caspases and their substrates. Cell Death Differ. 2017, 24, 1380–1389. [Google Scholar] [CrossRef] [PubMed]
- Janicke, R.U.; Sprengart, M.L.; Wati, M.R.; Porter, A.G. Caspase-3 is required for DNA fragmentation and morphological changes associated with apoptosis. J. Biol. Chem. 1998, 273, 9357–9360. [Google Scholar] [CrossRef] [PubMed]
- Srinivasula, S.M.; Ahmad, M.; Fernandes-Alnemri, T.; Litwack, G.; Alnemri, E.S. Molecular ordering of the Fas-apoptotic pathway: The Fas/APO-1 protease Mch5 is a CrmA-inhibitable protease that activates multiple Ced-3/ICE-like cysteine proteases. Proc. Natl. Acad. Sci. USA 1996, 93, 14486–14491. [Google Scholar] [CrossRef]
- Ashkenazi, A. Targeting the extrinsic apoptosis pathway in cancer. Cytokine Growth Factor Rev. 2008, 19, 325–331. [Google Scholar] [CrossRef]
- Jelinek, M.; Balusikova, K.; Schmiedlova, M.; Nemcova-Furstova, V.; Sramek, J.; Stancikova, J.; Zanardi, I.; Ojima, I.; Kovar, J. The role of individual caspases in cell death induction by taxanes in breast cancer cells. Cancer Cell Int. 2015, 15, 8. [Google Scholar] [CrossRef]
- Dai, J.; Mumper, R.J. Plant phenolics: Extraction, analysis and their antioxidant and anticancer properties. Molecules 2010, 15, 7313–7352. [Google Scholar] [CrossRef]
- ElKhazendar, M.; Chalak, J.; El-Huneidi, W.; Vinod, A.; Abdel-Rahman, W.M.; Abu-Gharbieh, E. Antiproliferative and proapoptotic activities of ferulic acid in breast and liver cancer cell lines. Trop. J. Pharm. Res. 2019, 18, 2571–2576. [Google Scholar]
- Zhang, X.D.; Wu, Q.; Yang, S.H. Ferulic acid promoting apoptosis in human osteosarcoma cell lines. Pak. J. Med. Sci. 2017, 33, 127–131. [Google Scholar] [CrossRef]
- Han, Y.H.; Kee, J.Y.; Hong, S.H. Rosmarinic Acid Activates AMPK to Inhibit Metastasis of Colorectal Cancer. Front. Pharmacol. 2018, 9, 68. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Hu, M.; Liu, L.; Cheng, X.L.; Cai, J.; Zhou, J.; Wang, T. Anticancer effects of Rosmarinic acid in OVCAR-3 ovarian cancer cells are mediated via induction of apoptosis, suppression of cell migration and modulation of lncRNA MALAT-1 expression. J. BUON 2018, 23, 763–768. [Google Scholar]
- Jang, Y.G.; Hwang, K.A.; Choi, K.C. Rosmarinic Acid, a Component of Rosemary Tea, Induced the Cell Cycle Arrest and Apoptosis through Modulation of HDAC2 Expression in Prostate Cancer Cell Lines. Nutrients 2018, 10, 1784. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.H.; Ho, W.Y.; Wu, S.J.; Cheng, T.L.; Huang, P.J.; Wang, C.C.; Hung, J.H. Behavior-selective apoptotic capacity of 4-(3,4,5-Trimethoxyphenoxy) benzoic acid and its methyl derivatives on two breast cancer cell lines. Anticancer Res. 2014, 34, 1801–1809. [Google Scholar] [PubMed]
- Nguyen, L.T.; Lee, Y.H.; Sharma, A.R.; Park, J.B.; Jagga, S.; Sharma, G.; Lee, S.S.; Nam, J.S. Quercetin induces apoptosis and cell cycle arrest in triple-negative breast cancer cells through modulation of Foxo3a activity. Korean J. Physiol. Pharmacol. 2017, 21, 205–213. [Google Scholar] [CrossRef]
- Bishayee, K.; Ghosh, S.; Mukherjee, A.; Sadhukhan, R.; Mondal, J.; Khuda-Bukhsh, A.R. Quercetin induces cytochrome-c release and ROS accumulation to promote apoptosis and arrest the cell cycle in G2/M, in cervical carcinoma: Signal cascade and drug-DNA interaction. Cell Prolif. 2013, 46, 153–163. [Google Scholar] [CrossRef]
- Kim, G.T.; Lee, S.H.; Kim, J.I.; Kim, Y.M. Quercetin regulates the sestrin 2-AMPK-p38 MAPK signaling pathway and induces apoptosis by increasing the generation of intracellular ROS in a p53-independent manner. Int. J. Mol. Med. 2014, 33, 863–869. [Google Scholar] [CrossRef]
- Maurya, A.K.; Vinayak, M. Anticarcinogenic action of quercetin by downregulation of phosphatidylinositol 3-kinase (PI3K) and protein kinase C (PKC) via induction of p53 in hepatocellular carcinoma (HepG2) cell line. Mol. Biol. Rep. 2015, 42, 1419–1429. [Google Scholar] [CrossRef]
- Vidya Priyadarsini, R.; Senthil Murugan, R.; Maitreyi, S.; Ramalingam, K.; Karunagaran, D.; Nagini, S. The flavonoid quercetin induces cell cycle arrest and mitochondria-mediated apoptosis in human cervical cancer (HeLa) cells through p53 induction and NF-kappaB inhibition. Eur. J. Pharmacol. 2010, 649, 84–91. [Google Scholar] [CrossRef]
- Taylor, W.R.; Stark, G.R. Regulation of the G2/M transition by p53. Oncogene 2001, 20, 1803–1815. [Google Scholar] [CrossRef]
- Garg, H.; Suri, P.; Gupta, J.C.; Talwar, G.P.; Dubey, S. Survivin: A unique target for tumor therapy. Cancer Cell Int. 2016, 16, 49. [Google Scholar] [CrossRef] [PubMed]
- Nestal de Moraes, G.; Silva, K.L.; Vasconcelos, F.C.; Maia, R.C. Survivin overexpression correlates with an apoptosis-resistant phenotype in chronic myeloid leukemia cells. Oncol. Rep. 2011, 25, 1613–1619. [Google Scholar] [PubMed]
- Li, F.; Ambrosini, G.; Chu, E.Y.; Plescia, J.; Tognin, S.; Marchisio, P.C.; Altieri, D.C. Control of apoptosis and mitotic spindle checkpoint by survivin. Nature 1998, 396, 580–584. [Google Scholar] [CrossRef] [PubMed]
- Norbury, C.; Nurse, P. Animal cell cycles and their control. Annu. Rev. Biochem. 1992, 61, 441–470. [Google Scholar] [CrossRef]





| Genes | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| Survivin | 5’ACCGCATCTCTACATTCAAG3’ | 5’CAAGTCTGGCTCGTTCTC3′ |
| CDK1 Cyclin B1 | 5’CAGACTAGAAAGTGAAGAGGAAGG3’ 5’AAGAGCTTTAAACTTTGGTCTGGG3’ | 5’ACTGACCAGGAGGGATAGAA3′ 5’GTTTGTAAGTCCTTGATTTACCATG3′ |
| 18S rRNA | 5’TCAGATACCGTCGTAGTTCCG3’ | 5’CAGCTTTGCAACCATACTCCC3′ |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
El-Huneidi, W.; Shehab, N.G.; Bajbouj, K.; Vinod, A.; El-Serafi, A.; Shafarin, J.; Bou Malhab, L.J.; Abdel-Rahman, W.M.; Abu-Gharbieh, E. Micromeria fruticosa Induces Cell Cycle Arrest and Apoptosis in Breast and Colorectal Cancer Cells. Pharmaceuticals 2020, 13, 115. https://doi.org/10.3390/ph13060115
El-Huneidi W, Shehab NG, Bajbouj K, Vinod A, El-Serafi A, Shafarin J, Bou Malhab LJ, Abdel-Rahman WM, Abu-Gharbieh E. Micromeria fruticosa Induces Cell Cycle Arrest and Apoptosis in Breast and Colorectal Cancer Cells. Pharmaceuticals. 2020; 13(6):115. https://doi.org/10.3390/ph13060115
Chicago/Turabian StyleEl-Huneidi, Waseem, Naglaa G. Shehab, Khuloud Bajbouj, Arya Vinod, Ahmed El-Serafi, Jasmin Shafarin, Lara J. Bou Malhab, Wael M. Abdel-Rahman, and Eman Abu-Gharbieh. 2020. "Micromeria fruticosa Induces Cell Cycle Arrest and Apoptosis in Breast and Colorectal Cancer Cells" Pharmaceuticals 13, no. 6: 115. https://doi.org/10.3390/ph13060115
APA StyleEl-Huneidi, W., Shehab, N. G., Bajbouj, K., Vinod, A., El-Serafi, A., Shafarin, J., Bou Malhab, L. J., Abdel-Rahman, W. M., & Abu-Gharbieh, E. (2020). Micromeria fruticosa Induces Cell Cycle Arrest and Apoptosis in Breast and Colorectal Cancer Cells. Pharmaceuticals, 13(6), 115. https://doi.org/10.3390/ph13060115

